ID: 1106905877

View in Genome Browser
Species Human (GRCh38)
Location 13:34408371-34408393
Sequence GGGACCTAACCCATATTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106905871_1106905877 30 Left 1106905871 13:34408318-34408340 CCATCTCTGTAATCACATTGGCT No data
Right 1106905877 13:34408371-34408393 GGGACCTAACCCATATTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106905877 Original CRISPR GGGACCTAACCCATATTTCA GGG Intergenic
No off target data available for this crispr