ID: 1106906354

View in Genome Browser
Species Human (GRCh38)
Location 13:34413617-34413639
Sequence CTGCTCACTGCCAAGGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106906345_1106906354 19 Left 1106906345 13:34413575-34413597 CCAGGATAAAAGCTTTCAGAGGG No data
Right 1106906354 13:34413617-34413639 CTGCTCACTGCCAAGGTGGAGGG No data
1106906342_1106906354 21 Left 1106906342 13:34413573-34413595 CCCCAGGATAAAAGCTTTCAGAG No data
Right 1106906354 13:34413617-34413639 CTGCTCACTGCCAAGGTGGAGGG No data
1106906343_1106906354 20 Left 1106906343 13:34413574-34413596 CCCAGGATAAAAGCTTTCAGAGG No data
Right 1106906354 13:34413617-34413639 CTGCTCACTGCCAAGGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106906354 Original CRISPR CTGCTCACTGCCAAGGTGGA GGG Intergenic
No off target data available for this crispr