ID: 1106909586

View in Genome Browser
Species Human (GRCh38)
Location 13:34449199-34449221
Sequence GTATCAGCTCCCCGCAACAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106909586_1106909590 2 Left 1106909586 13:34449199-34449221 CCAGTGTTGCGGGGAGCTGATAC No data
Right 1106909590 13:34449224-34449246 GGACTCAGGTTGCTTGATTAAGG No data
1106909586_1106909591 23 Left 1106909586 13:34449199-34449221 CCAGTGTTGCGGGGAGCTGATAC No data
Right 1106909591 13:34449245-34449267 GGCAGTAGCCCTTTAGCATAAGG No data
1106909586_1106909592 24 Left 1106909586 13:34449199-34449221 CCAGTGTTGCGGGGAGCTGATAC No data
Right 1106909592 13:34449246-34449268 GCAGTAGCCCTTTAGCATAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106909586 Original CRISPR GTATCAGCTCCCCGCAACAC TGG (reversed) Intergenic
No off target data available for this crispr