ID: 1106909591

View in Genome Browser
Species Human (GRCh38)
Location 13:34449245-34449267
Sequence GGCAGTAGCCCTTTAGCATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106909586_1106909591 23 Left 1106909586 13:34449199-34449221 CCAGTGTTGCGGGGAGCTGATAC No data
Right 1106909591 13:34449245-34449267 GGCAGTAGCCCTTTAGCATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106909591 Original CRISPR GGCAGTAGCCCTTTAGCATA AGG Intergenic
No off target data available for this crispr