ID: 1106909716

View in Genome Browser
Species Human (GRCh38)
Location 13:34450562-34450584
Sequence GAGAGTAAACAGGCGGGTGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106909716_1106909722 5 Left 1106909716 13:34450562-34450584 CCACCACCCGCCTGTTTACTCTC No data
Right 1106909722 13:34450590-34450612 TCTTGCTGACTTCATCACTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106909716 Original CRISPR GAGAGTAAACAGGCGGGTGG TGG (reversed) Intergenic
No off target data available for this crispr