ID: 1106911451

View in Genome Browser
Species Human (GRCh38)
Location 13:34467577-34467599
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106911450_1106911451 -5 Left 1106911450 13:34467559-34467581 CCTTAAATGGTCAGAGTACGGAG No data
Right 1106911451 13:34467577-34467599 CGGAGCTTTCAGCAAAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106911451 Original CRISPR CGGAGCTTTCAGCAAAACCT TGG Intergenic
No off target data available for this crispr