ID: 1106913889

View in Genome Browser
Species Human (GRCh38)
Location 13:34490864-34490886
Sequence CCAGGTAAAGAGAAAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106913889_1106913894 1 Left 1106913889 13:34490864-34490886 CCTTCCTCTTTCTCTTTACCTGG No data
Right 1106913894 13:34490888-34490910 CATGAATTCATGTCCTTACCTGG No data
1106913889_1106913897 22 Left 1106913889 13:34490864-34490886 CCTTCCTCTTTCTCTTTACCTGG No data
Right 1106913897 13:34490909-34490931 GGCCACAGATCTGCTGTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106913889 Original CRISPR CCAGGTAAAGAGAAAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr