ID: 1106921998

View in Genome Browser
Species Human (GRCh38)
Location 13:34574043-34574065
Sequence CTGCCTGATGGTATGAAGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106921996_1106921998 0 Left 1106921996 13:34574020-34574042 CCTTACAGAGAGGGTTAAGAAAG No data
Right 1106921998 13:34574043-34574065 CTGCCTGATGGTATGAAGCCAGG No data
1106921991_1106921998 25 Left 1106921991 13:34573995-34574017 CCTGGGAGGGAGGTAGCAGTGTT No data
Right 1106921998 13:34574043-34574065 CTGCCTGATGGTATGAAGCCAGG No data
1106921994_1106921998 2 Left 1106921994 13:34574018-34574040 CCCCTTACAGAGAGGGTTAAGAA No data
Right 1106921998 13:34574043-34574065 CTGCCTGATGGTATGAAGCCAGG No data
1106921995_1106921998 1 Left 1106921995 13:34574019-34574041 CCCTTACAGAGAGGGTTAAGAAA No data
Right 1106921998 13:34574043-34574065 CTGCCTGATGGTATGAAGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106921998 Original CRISPR CTGCCTGATGGTATGAAGCC AGG Intergenic
No off target data available for this crispr