ID: 1106924358

View in Genome Browser
Species Human (GRCh38)
Location 13:34598500-34598522
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106924358_1106924361 22 Left 1106924358 13:34598500-34598522 CCAACTGTGGGAACACTATTTGG No data
Right 1106924361 13:34598545-34598567 ATTCCACAATTCTGAAGAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106924358 Original CRISPR CCAAATAGTGTTCCCACAGT TGG (reversed) Intergenic
No off target data available for this crispr