ID: 1106925041

View in Genome Browser
Species Human (GRCh38)
Location 13:34605148-34605170
Sequence CTGTGCTCACAGCAAGAGTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106925039_1106925041 -3 Left 1106925039 13:34605128-34605150 CCCTTCACAGGGCTGCTTGACTG No data
Right 1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG No data
1106925040_1106925041 -4 Left 1106925040 13:34605129-34605151 CCTTCACAGGGCTGCTTGACTGT No data
Right 1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG No data
1106925034_1106925041 19 Left 1106925034 13:34605106-34605128 CCACGGTTCCTCTCCACATGAGC No data
Right 1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG No data
1106925038_1106925041 6 Left 1106925038 13:34605119-34605141 CCACATGAGCCCTTCACAGGGCT No data
Right 1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG No data
1106925035_1106925041 11 Left 1106925035 13:34605114-34605136 CCTCTCCACATGAGCCCTTCACA No data
Right 1106925041 13:34605148-34605170 CTGTGCTCACAGCAAGAGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106925041 Original CRISPR CTGTGCTCACAGCAAGAGTA AGG Intergenic
No off target data available for this crispr