ID: 1106928985

View in Genome Browser
Species Human (GRCh38)
Location 13:34643391-34643413
Sequence GTCTGTCAGCACCACTGGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106928983_1106928985 -6 Left 1106928983 13:34643374-34643396 CCATTCATAGTTACTGTGTCTGT No data
Right 1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG No data
1106928979_1106928985 15 Left 1106928979 13:34643353-34643375 CCTATTCCCCTGCACAGGAAACC No data
Right 1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG No data
1106928980_1106928985 9 Left 1106928980 13:34643359-34643381 CCCCTGCACAGGAAACCATTCAT No data
Right 1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG No data
1106928982_1106928985 7 Left 1106928982 13:34643361-34643383 CCTGCACAGGAAACCATTCATAG No data
Right 1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG No data
1106928981_1106928985 8 Left 1106928981 13:34643360-34643382 CCCTGCACAGGAAACCATTCATA No data
Right 1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG No data
1106928978_1106928985 16 Left 1106928978 13:34643352-34643374 CCCTATTCCCCTGCACAGGAAAC No data
Right 1106928985 13:34643391-34643413 GTCTGTCAGCACCACTGGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106928985 Original CRISPR GTCTGTCAGCACCACTGGTC TGG Intergenic
No off target data available for this crispr