ID: 1106950813

View in Genome Browser
Species Human (GRCh38)
Location 13:34881478-34881500
Sequence CGTGTTGTTACAACCTAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106950813_1106950817 23 Left 1106950813 13:34881478-34881500 CCTTCCTAGGTTGTAACAACACG No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106950813 Original CRISPR CGTGTTGTTACAACCTAGGA AGG (reversed) Intergenic
No off target data available for this crispr