ID: 1106950817

View in Genome Browser
Species Human (GRCh38)
Location 13:34881524-34881546
Sequence ATTCCTCACACAGTTTCCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106950811_1106950817 28 Left 1106950811 13:34881473-34881495 CCTACCCTTCCTAGGTTGTAACA No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data
1106950809_1106950817 30 Left 1106950809 13:34881471-34881493 CCCCTACCCTTCCTAGGTTGTAA No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data
1106950814_1106950817 19 Left 1106950814 13:34881482-34881504 CCTAGGTTGTAACAACACGTTTG No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data
1106950813_1106950817 23 Left 1106950813 13:34881478-34881500 CCTTCCTAGGTTGTAACAACACG No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data
1106950812_1106950817 24 Left 1106950812 13:34881477-34881499 CCCTTCCTAGGTTGTAACAACAC No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data
1106950810_1106950817 29 Left 1106950810 13:34881472-34881494 CCCTACCCTTCCTAGGTTGTAAC No data
Right 1106950817 13:34881524-34881546 ATTCCTCACACAGTTTCCTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106950817 Original CRISPR ATTCCTCACACAGTTTCCTA TGG Intergenic
No off target data available for this crispr