ID: 1106951470

View in Genome Browser
Species Human (GRCh38)
Location 13:34889219-34889241
Sequence TTGTGTAAGTTCAGGAATCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106951470_1106951473 25 Left 1106951470 13:34889219-34889241 CCTAGATTCCTGAACTTACACAA No data
Right 1106951473 13:34889267-34889289 CGAAGCAAGATTCAAGAGGTAGG No data
1106951470_1106951472 21 Left 1106951470 13:34889219-34889241 CCTAGATTCCTGAACTTACACAA No data
Right 1106951472 13:34889263-34889285 TATTCGAAGCAAGATTCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106951470 Original CRISPR TTGTGTAAGTTCAGGAATCT AGG (reversed) Intergenic
No off target data available for this crispr