ID: 1106965740

View in Genome Browser
Species Human (GRCh38)
Location 13:35064635-35064657
Sequence CTCCAAAAACAGTCAGATTA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1103
Summary {0: 1, 1: 0, 2: 45, 3: 245, 4: 812}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106965740_1106965746 22 Left 1106965740 13:35064635-35064657 CCGTAATCTGACTGTTTTTGGAG 0: 1
1: 0
2: 45
3: 245
4: 812
Right 1106965746 13:35064680-35064702 TAAGGTTAAGTGAGGTCATTTGG 0: 6
1: 36
2: 277
3: 819
4: 1699
1106965740_1106965745 14 Left 1106965740 13:35064635-35064657 CCGTAATCTGACTGTTTTTGGAG 0: 1
1: 0
2: 45
3: 245
4: 812
Right 1106965745 13:35064672-35064694 GAGGTAATTAAGGTTAAGTGAGG 0: 17
1: 180
2: 617
3: 1179
4: 2045
1106965740_1106965748 30 Left 1106965740 13:35064635-35064657 CCGTAATCTGACTGTTTTTGGAG 0: 1
1: 0
2: 45
3: 245
4: 812
Right 1106965748 13:35064688-35064710 AGTGAGGTCATTTGGTTATTGGG 0: 1
1: 0
2: 1
3: 11
4: 212
1106965740_1106965743 -5 Left 1106965740 13:35064635-35064657 CCGTAATCTGACTGTTTTTGGAG 0: 1
1: 0
2: 45
3: 245
4: 812
Right 1106965743 13:35064653-35064675 TGGAGACAGGGTCTTTAAAGAGG 0: 49
1: 237
2: 718
3: 1146
4: 1604
1106965740_1106965747 29 Left 1106965740 13:35064635-35064657 CCGTAATCTGACTGTTTTTGGAG 0: 1
1: 0
2: 45
3: 245
4: 812
Right 1106965747 13:35064687-35064709 AAGTGAGGTCATTTGGTTATTGG 0: 1
1: 0
2: 3
3: 15
4: 362
1106965740_1106965744 4 Left 1106965740 13:35064635-35064657 CCGTAATCTGACTGTTTTTGGAG 0: 1
1: 0
2: 45
3: 245
4: 812
Right 1106965744 13:35064662-35064684 GGTCTTTAAAGAGGTAATTAAGG 0: 37
1: 164
2: 395
3: 746
4: 1265

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106965740 Original CRISPR CTCCAAAAACAGTCAGATTA CGG (reversed) Intronic
900204226 1:1425091-1425113 CTCAAAAAAAAGTCAGAGTCGGG + Intergenic
900330646 1:2132932-2132954 CTCCAAATACAGCCACATTGGGG + Intronic
900709616 1:4105333-4105355 CTCTAATAACAGTCAGAGTCTGG - Intergenic
900798919 1:4725929-4725951 CTCCAAATACAGTCACATTAGGG + Intronic
900822380 1:4899539-4899561 TTCCAAATACAGTCACATTTGGG + Intergenic
900911054 1:5597288-5597310 CTCCAAATACAGTGACATTGAGG + Intergenic
901863023 1:12086897-12086919 CTCCAAATACAGTCACACTGGGG + Intronic
902087464 1:13874452-13874474 CTCCAAACACAGTCACATTGGGG + Intergenic
902703299 1:18187731-18187753 CTCCAAATACTGTCACATTAGGG + Intronic
904051525 1:27642399-27642421 CTCCAAGTATAGTCACATTAGGG + Intergenic
904352301 1:29916471-29916493 CTCCAAATACAGTCACACTGGGG + Intergenic
904820299 1:33238656-33238678 CTCCAAATCCAGTCACATTGGGG - Intergenic
904954299 1:34270104-34270126 CTCCAAATACTGTCACATTGGGG + Intergenic
904971288 1:34421276-34421298 CTCCAAATACAGTCATATTGGGG - Intergenic
905407673 1:37746493-37746515 CTCCAAATATAGTCACATTGGGG + Intronic
905507127 1:38488921-38488943 CTCCAAATACAGCCACATTCCGG + Intergenic
905749182 1:40447242-40447264 CTCCAAATACAGTCACTTTAGGG - Intergenic
906659526 1:47572691-47572713 CTCTAAAAACAGTAAGACTAAGG - Intergenic
906734434 1:48111071-48111093 CTCAAAAAAGTGCCAGATTATGG - Intergenic
906957461 1:50386976-50386998 CTCCAAATACCATCACATTAGGG + Intergenic
907066059 1:51484110-51484132 CTCAAAAAAAAGTCAGAGTCAGG + Intronic
907383172 1:54108345-54108367 CTCCAAATACAGTCACATTCTGG - Intronic
907430393 1:54407586-54407608 CTCTAAAAACAGTCTGAAAATGG - Intronic
907620878 1:55978274-55978296 CTCCAAATACAGTCACATTAAGG - Intergenic
907994983 1:59621223-59621245 CTCTAAATACAGTCACATTTGGG + Intronic
908053891 1:60261960-60261982 CTCCAAACACCATCACATTAGGG + Intergenic
908078018 1:60542539-60542561 CTCCAAATACAGTCACATCAGGG + Intergenic
908428217 1:64029758-64029780 CTCCAAATACAGTCACATCGGGG + Intronic
908964485 1:69741649-69741671 CTCCAAAAGTATTCAGAATAGGG + Intronic
909155253 1:72066512-72066534 CTCCAAATAAAGTCACATTGAGG - Intronic
909471484 1:76033845-76033867 CTCCAAATAGAGTCATATTGAGG - Intergenic
909706017 1:78585694-78585716 TTCCAAATGCAGTCAGATTCTGG + Intergenic
909845809 1:80393488-80393510 CTCCAAATATAGTCACATTGGGG - Intergenic
909870051 1:80728063-80728085 CTCCAAATACAGTCACATTAGGG + Intergenic
910078907 1:83315484-83315506 CTCCAAATACAGTCCCATTGAGG - Intergenic
910617356 1:89214089-89214111 ATCCAAAAAAAGTTAGTTTAAGG - Intergenic
911119941 1:94286276-94286298 CTAAAAATACAGTCACATTAGGG + Intergenic
911774300 1:101788091-101788113 CTTCAAATACAGTCACAATAGGG - Intergenic
911826588 1:102493968-102493990 CTTCAAATATAGTCACATTAGGG + Intergenic
911953995 1:104212929-104212951 TTCCAAATACAGTCACATTCGGG + Intergenic
911979346 1:104546498-104546520 CCCAAAAAACAGTGATATTAAGG + Intergenic
912633435 1:111269245-111269267 CTCCAAATACAGTCACACTGTGG - Intergenic
912656326 1:111489226-111489248 ATCCAAATACAGTCACATTCTGG - Intronic
912665106 1:111571722-111571744 CTCTAAAATCAGAAAGATTATGG + Intronic
912787331 1:112617452-112617474 CTCCCAAAACTCTGAGATTATGG - Intronic
913141275 1:115943577-115943599 CACCAAAAAGAGGCAGAGTAAGG - Intergenic
913339053 1:117738968-117738990 CTCCAAATACAGTCACATTGGGG + Intergenic
913596089 1:120378617-120378639 CTTCAAAAACAGTCACATCAGGG - Intergenic
914091190 1:144500359-144500381 CTTCAAAAACAGTCACATCAGGG + Intergenic
914307414 1:146433836-146433858 CTTCAAAAACAGTCACATCAGGG - Intergenic
914594693 1:149139295-149139317 CTTCAAAAACAGTCACATCAGGG + Intergenic
914839202 1:151233818-151233840 CTCCAATAGCAATCAGAGTAAGG - Intronic
915705953 1:157843967-157843989 CTCCAAACACAGTAAGTTTTAGG - Intronic
916194599 1:162211480-162211502 CTCCAAATGCAGTCACATTGGGG + Intronic
916690624 1:167186705-167186727 CTCCAGAAACCATCACATTATGG + Intergenic
917018460 1:170560725-170560747 CTCCAAATATAGTCACATTGGGG - Intergenic
917212742 1:172646696-172646718 CTTCAAATATAGTCACATTAGGG - Intergenic
917276098 1:173333477-173333499 CTCCAAAGACCATCACATTATGG - Intergenic
917355412 1:174121935-174121957 CTCAAAATACAGTCACATTGGGG + Intergenic
918192965 1:182193576-182193598 CTCCAAATACAGTCACATTGGGG + Intergenic
918283393 1:183027544-183027566 TTCTAAAAACAATTAGATTAAGG + Intronic
918586494 1:186194282-186194304 CTCCAAATGCAGTCACATTGAGG - Intergenic
918800579 1:188965194-188965216 CTCCTAATACTGTCAGATTGGGG + Intergenic
918991573 1:191703316-191703338 CTACAACCACAGTCACATTATGG - Intergenic
920930298 1:210381783-210381805 CTCCAAAAACAGTGGGACCAGGG + Intronic
921253313 1:213317558-213317580 CTCCAAATACAATCACATTAGGG + Intergenic
921337329 1:214101294-214101316 CTCCAAATACAGTCACACCAGGG + Intergenic
921483328 1:215688797-215688819 CTCCAAATACAGTCACCTTGGGG + Intronic
921791793 1:219298587-219298609 CTCCCACAACAGGCAAATTAGGG + Intergenic
922194690 1:223349899-223349921 CTCCAAATAGAGTCATATTGGGG - Intronic
922441436 1:225658330-225658352 CTCCAAAACCATTCAGGCTATGG - Intergenic
923142305 1:231171057-231171079 CTCTAAAAGCAGTCCCATTAGGG - Intronic
923330756 1:232922273-232922295 CTCAAACTACAGTCACATTAGGG + Intergenic
923545015 1:234917761-234917783 CTCCAAACACAGTCACATGGAGG + Intergenic
923681697 1:236123839-236123861 CTCCAAATACAGTCACATTCTGG - Intergenic
923748359 1:236724315-236724337 CTCCAAATACAGGCACATTAGGG + Intronic
923968244 1:239168380-239168402 CTTCAAATACAGTCACATTGAGG + Intergenic
924736792 1:246764549-246764571 CTCCAAAAACAGCCAGAGGGAGG - Intronic
924825877 1:247538501-247538523 CTCCAAATATAGTCACATTGTGG - Intronic
1063017754 10:2095552-2095574 CTCCAAACACAGTCACATTCTGG - Intergenic
1063208513 10:3857366-3857388 CTCCAAATACAGTCACATTTGGG - Intergenic
1063388203 10:5630273-5630295 CTCCAAATACAGTCACATTGAGG - Intergenic
1063674699 10:8130408-8130430 CTCAAAAAACAGTCAAAGTGAGG - Intergenic
1063796234 10:9516845-9516867 CTCCAAATACAGTCACGTTGAGG - Intergenic
1063997603 10:11635107-11635129 CTCCAAAAACAGTCATACTGAGG + Intergenic
1064168044 10:13003018-13003040 TTCCAAATACAGTCACATTAGGG + Intronic
1064513882 10:16125074-16125096 TTCCAAATACAGTCAAATTAGGG + Intergenic
1064838905 10:19567594-19567616 CTCCAGTAACAGTCCGTTTAAGG + Exonic
1064975534 10:21110783-21110805 CTTTAAGAACAGTCAGGTTAGGG + Intronic
1065500391 10:26375853-26375875 CTCCAAATATAGTCATACTAGGG - Intergenic
1065601529 10:27373774-27373796 CTCCAAAAATGCTGAGATTACGG - Intergenic
1066117080 10:32249988-32250010 CTCCAAATACAGTCACACTGGGG + Intergenic
1066505863 10:36042182-36042204 CTCTAAATACAGTCACATTGGGG - Intergenic
1067364525 10:45612756-45612778 CTCCAAATACAGCCACACTAGGG - Intergenic
1068031270 10:51708345-51708367 CTCTAAATACAGTCACATTGTGG + Intronic
1068067424 10:52149438-52149460 CTCAAAATACAGTCACATTGGGG - Intronic
1068102549 10:52573752-52573774 CCCAAAACACAGTGAGATTATGG + Intergenic
1068527318 10:58144905-58144927 CTCCAAATACAGTGACATTGGGG - Intergenic
1068789439 10:61010939-61010961 CTCCAAATACAGTCATATTTGGG - Intergenic
1068828425 10:61465889-61465911 CTCCAAATACAGTCAAGTTGTGG - Intergenic
1068939796 10:62669610-62669632 CTCCAAATACAGTCATATTGGGG + Intronic
1069213129 10:65786744-65786766 CTCCAAATACAGTTACATTGAGG + Intergenic
1069258456 10:66363293-66363315 CTCCAAATACCATCACATTAGGG - Intronic
1069273495 10:66560730-66560752 CTCCAAATACTATCACATTAGGG - Intronic
1069346292 10:67474247-67474269 CTCAAAATACAGTCACATTCTGG - Intronic
1069576893 10:69537077-69537099 CTCCAAATACAGTCACATTAGGG + Intergenic
1069681288 10:70287383-70287405 CTCCAAATACCGTCACATTGTGG - Intergenic
1070054140 10:72918386-72918408 CTTTAAAAACAGTCAGTTTAAGG - Intronic
1070074062 10:73118012-73118034 CTACAAAAACACCCAGGTTAAGG - Intronic
1070084277 10:73220610-73220632 CTCCAAATACAGTCACTTTGGGG - Intronic
1070744922 10:78927915-78927937 CTCCAAGGACAGTAAGATGAGGG + Intergenic
1070976974 10:80613419-80613441 CTACAAAAACAGTCACAATGTGG + Intronic
1071005466 10:80879381-80879403 TTCAACAAACAGTCTGATTAAGG + Intergenic
1071125306 10:82328022-82328044 CTCCAAAAACAGTCACATTGCGG + Intronic
1071184998 10:83032664-83032686 CTCCAAAAACAGTCACATTGGGG + Intergenic
1071260093 10:83911960-83911982 CTCCAAATACAGTCACATTGGGG + Intergenic
1071284422 10:84131505-84131527 CTCCAAATTCAGTCACATTGGGG + Intergenic
1071783402 10:88872680-88872702 CTCTAAATACAGTCACATTGGGG - Intergenic
1071899168 10:90100500-90100522 CTCCAAATACTATCACATTAAGG + Intergenic
1072192903 10:93090590-93090612 CTCCAAATACAGTCACATTGGGG + Intergenic
1072690534 10:97570019-97570041 GTCCAAATACAGTCACATTGGGG + Intronic
1072758021 10:98033438-98033460 CTCCAAATGCAGTCACACTAAGG - Intergenic
1073365148 10:102934099-102934121 CTCCCAAAACACTGGGATTACGG + Intronic
1073672964 10:105612999-105613021 CTCCAAATATAGTCACATTGGGG + Intergenic
1073703778 10:105959466-105959488 CTCCAAGTACAGTCACATTGGGG - Intergenic
1073773931 10:106765536-106765558 CTCCAAAGACATTCAGAGGATGG - Intronic
1073857859 10:107697959-107697981 CTTCTAAACCAGTCATATTAGGG + Intergenic
1074194804 10:111174135-111174157 TTCCAAATACAGTCACATTGGGG + Intergenic
1074471209 10:113728451-113728473 CTCTAAACACAGTCACATTATGG + Intronic
1074509201 10:114097731-114097753 CTCCAAATATAGTCACATTGTGG - Intergenic
1074817514 10:117153789-117153811 CTCTAAATACAGTCATATTGGGG + Intergenic
1074983437 10:118637740-118637762 CTTCAAATACAGTCACATTGGGG - Intergenic
1075100653 10:119503894-119503916 CTCCAAATAAAGTCACATTCTGG + Intronic
1075200611 10:120400497-120400519 CTCCAAATACCGTCACATTGAGG - Intergenic
1075341473 10:121649812-121649834 CTCCAAATACAGTCACTTTGGGG + Intergenic
1075389247 10:122080627-122080649 CTCCAAATACAGTCACATTGGGG + Intronic
1075571044 10:123545907-123545929 CTCCAAATATAGTTATATTAGGG + Intergenic
1075820257 10:125301940-125301962 CTCCAAATACAGTCACGTTGTGG - Intergenic
1075832984 10:125427287-125427309 CTCCAAATACAGTCACATTGGGG + Intergenic
1076191802 10:128488404-128488426 CTCCAAATACCATCACATTAGGG + Intergenic
1077478357 11:2801632-2801654 CTCCAAACACAGTCACATTGGGG + Intronic
1078397564 11:10994783-10994805 CTCCAAATACAGTCACATTAGGG - Intergenic
1078464073 11:11537605-11537627 CTCCAGACCCAGTCAGCTTAGGG - Intronic
1078592659 11:12658365-12658387 CTCCAAAAACAGTCAAGTTAAGG + Intergenic
1078719279 11:13869654-13869676 TAACAAAAACAGTCAGAATATGG + Intergenic
1079142906 11:17824829-17824851 CTCCAAATACAGTCACATTGGGG + Intronic
1079358746 11:19752890-19752912 CTCCAAATACCATCAGATTGGGG - Intronic
1079699734 11:23529803-23529825 CTCCAAATACAGTCACATTGGGG + Intergenic
1080000803 11:27346775-27346797 CTCCAAATACAGTCACATTGAGG - Intronic
1080103433 11:28486021-28486043 CTCCAAATATAGACACATTAGGG + Intergenic
1080252158 11:30245607-30245629 CTCCAAATACAGTCACATTGGGG + Intergenic
1080354458 11:31425708-31425730 GTCCAAGAACAGTCAAATTATGG + Intronic
1080398034 11:31907663-31907685 CTCCTAATACAGTCACATTGGGG + Intronic
1080705331 11:34686779-34686801 CTCCAAATACGATCACATTAAGG - Intergenic
1081142164 11:39514619-39514641 CTCTAAATATAGTCACATTAGGG - Intergenic
1081303542 11:41483681-41483703 CAACAAAAACAGGCAGACTAGGG - Intergenic
1081417757 11:42836154-42836176 CTCCAAAAACAGTCACACTGGGG + Intergenic
1081803998 11:45880031-45880053 CTCCAAATACAGTCACCTTCTGG + Intronic
1082747810 11:56985053-56985075 ATCCTAAAACAGCCAGTTTAAGG + Intergenic
1082954327 11:58852788-58852810 CTCCAAATACAGTCACATTGGGG + Intronic
1083138717 11:60703961-60703983 CTCCAAACACAGTCAGATTCTGG + Intronic
1083391237 11:62352092-62352114 CTCCAAACACAGCCAGATTAGGG - Intronic
1083916523 11:65748167-65748189 CTCCAAATATAGTCACATTGGGG + Intergenic
1083958935 11:66003204-66003226 CCCAAAAAAAAGGCAGATTAGGG - Intronic
1083974697 11:66108392-66108414 CTCCAAATGCAGTCACTTTAGGG + Intronic
1084077200 11:66789026-66789048 CTCCAAACACAGTCACTTTGGGG + Intronic
1084109489 11:67004407-67004429 TTCCAAAAATAGTCACATTGGGG - Intergenic
1084511654 11:69609247-69609269 CTGCCAAAACAGACAGATCATGG - Intergenic
1084918863 11:72452728-72452750 CTCTAAATACAGTCACATTGGGG + Intergenic
1085160990 11:74344956-74344978 CTGCAAAAATGGTCAGCTTAAGG + Intronic
1085181180 11:74538045-74538067 GTCCAAAAACAGTCAGCGAAGGG + Intronic
1085366164 11:75947132-75947154 TTCCAAATATAGTCACATTAAGG + Intronic
1085536814 11:77226304-77226326 CTCCAAATACAGTCACACTGAGG - Intronic
1085598121 11:77829064-77829086 CTCTAAATACAGTCACATTAGGG - Intronic
1085617414 11:78011736-78011758 CACCCAAAACAGTTAAATTAAGG + Intergenic
1085712687 11:78844245-78844267 CTCCAAATACAGTCACATTGGGG - Intronic
1085977950 11:81682920-81682942 CTCCAAATTCAGTCACATTCTGG + Intergenic
1086219790 11:84428694-84428716 CTCCAAATACAGTCACACTGAGG + Intronic
1087215474 11:95488517-95488539 CTCCAAATACAGTCACATTAGGG - Intergenic
1087998766 11:104847651-104847673 CTCCAAACACAGCTGGATTAAGG - Intergenic
1088303349 11:108382355-108382377 CCCCAAAAAAACTGAGATTAGGG + Intronic
1088350379 11:108880349-108880371 CTCCAAATACAGCCACATTGGGG + Intronic
1088442261 11:109884553-109884575 CTCCGAATACAGTCACATTGCGG - Intergenic
1088850195 11:113697928-113697950 CTCCAAATACAGTCACATTGAGG - Intronic
1089136712 11:116255060-116255082 CTCCAAGTACAGTTACATTAGGG + Intergenic
1089860673 11:121587541-121587563 CTCCAAATACAGTCAAATTGGGG + Intronic
1089900640 11:121979942-121979964 CTCCAATTACAGTCACATTAGGG + Intergenic
1089997770 11:122925343-122925365 CTCCAAAAGGAATCAGATTTGGG - Intronic
1090181472 11:124704007-124704029 CTCCAAATACCATCATATTAGGG - Intergenic
1090591653 11:128277333-128277355 TTCCAAAAACATTCAGCCTAAGG - Intergenic
1091496677 12:979098-979120 CTCCAAATACAGGCACATTGGGG - Intronic
1092067140 12:5600139-5600161 CTCCCAATACAGTCACATTGGGG - Intronic
1092318715 12:7447758-7447780 CTTCAAATATAGTCACATTAGGG - Intronic
1092484094 12:8886812-8886834 CTCCAAATACAGTCACATTGGGG + Intronic
1092495285 12:8987230-8987252 CTCCAAATACAGTCACACTGAGG - Intronic
1093412125 12:18879502-18879524 CTCCAAATACAGTCACACTCTGG + Intergenic
1093732113 12:22576781-22576803 CTCTAAATACAGTCACATTGAGG + Intergenic
1095421848 12:42032219-42032241 CTCCAAATACCATCACATTAGGG - Intergenic
1095435018 12:42177585-42177607 CTCCAAATACAGTCACATAGGGG + Intronic
1096120313 12:49084721-49084743 CTCCAAATACAGACACAGTAGGG + Intergenic
1097133790 12:56834914-56834936 CTCCAAATCCAGTCAGGTAATGG - Intergenic
1098149898 12:67535907-67535929 TTCCAAAGACTTTCAGATTAGGG + Intergenic
1098163724 12:67672379-67672401 CTCCAAATACAGACACATTGGGG - Intergenic
1098165203 12:67689668-67689690 CTCAAAATACAGTCAAATTGGGG + Intergenic
1098165246 12:67690299-67690321 CTCAAAATACAGTCAAATTGGGG - Intergenic
1098547393 12:71726959-71726981 CTCCAAATATAGTCACATTAGGG - Intergenic
1098954262 12:76672058-76672080 CTCCAAATACAGTCACACTGAGG - Intergenic
1099070418 12:78039351-78039373 CTCCTAAATCAGACAGATTAAGG + Intronic
1099084280 12:78225757-78225779 CTCCAAATACAGTTATATTGGGG - Intergenic
1099093503 12:78342465-78342487 CTCCAAAAATAGTCACATTGGGG - Intergenic
1099476522 12:83114162-83114184 CTCCAAATACCATCACATTAGGG - Intronic
1099787844 12:87289074-87289096 CTCCAAATACAGTCACATTAGGG - Intergenic
1099806022 12:87519458-87519480 CTCCCAACACTGTCACATTAAGG + Intergenic
1099977829 12:89564753-89564775 CCCCAAATACAGTCACATTGGGG + Intergenic
1099995218 12:89770825-89770847 GCCCAACAACAGTCAGAGTAGGG - Intergenic
1100246407 12:92762216-92762238 CAACAAAAACAGCCAGAGTAGGG + Intronic
1101197212 12:102396469-102396491 ATCCAAACAAAATCAGATTAAGG + Intronic
1101400506 12:104382858-104382880 CTCCCAAAGCACTGAGATTACGG + Intergenic
1101579028 12:106025172-106025194 CTCCAAATACAGTCACATTGGGG - Intergenic
1101638347 12:106566322-106566344 CTCCAAATACAGTCACACTGGGG - Intronic
1101743764 12:107522212-107522234 CTCCAAATACTGTCACATTGAGG + Intronic
1102021551 12:109686851-109686873 CTCCCAAAGCAGTGGGATTACGG - Intergenic
1102444023 12:112987496-112987518 CTCCAAAGACAATCAGGGTATGG - Intronic
1103156729 12:118691767-118691789 CTCCAAATACAGTCACAGTGGGG + Intergenic
1103259358 12:119573135-119573157 CTCCAAATACAGTCACATTCTGG + Intergenic
1103418743 12:120762912-120762934 CTCCAAAATGACTCGGATTAAGG - Exonic
1103422110 12:120794810-120794832 ATCCAAACAAAGTCAGGTTAAGG - Intronic
1103827755 12:123753596-123753618 CTTCAAATACAGTCACATTGCGG + Intronic
1103882701 12:124178634-124178656 CTCCAAATATAGTCACATTGGGG - Intronic
1103882976 12:124180633-124180655 CTCCAAATACAGTCCCATGACGG - Intronic
1104285904 12:127424495-127424517 CTCCAAATACAGTCACATTGGGG - Intergenic
1105031115 12:132884544-132884566 TTCCAAATACAGTCACATTGGGG - Intronic
1105292133 13:19059937-19059959 CTCCTAAAACCGTCACCTTAGGG - Intergenic
1105308338 13:19184449-19184471 CCCCAAATACAGTCACATTGGGG + Intronic
1106161133 13:27202307-27202329 CTCCAAATACAGTCACATGGGGG + Intergenic
1106431413 13:29683968-29683990 CTCCAAATACAGTCACATGGGGG + Intergenic
1106501392 13:30332361-30332383 CTCCAAATACAGTCACCTTGGGG - Intergenic
1106529547 13:30576948-30576970 CTCTAAATACAGTCACATCAGGG - Intronic
1106766199 13:32916352-32916374 CTTCAGAAAGAGTTAGATTAGGG - Intergenic
1106965740 13:35064635-35064657 CTCCAAAAACAGTCAGATTACGG - Intronic
1107149475 13:37095156-37095178 CTCCAAATACAGTCACATTGGGG + Intergenic
1107410574 13:40154220-40154242 CTCCAAATACAGTCATATTGGGG + Intergenic
1107495748 13:40924133-40924155 CTCCAAACACACTTAGAATAGGG + Intergenic
1107600109 13:42004500-42004522 CTTCAAAAACCCTCACATTAGGG - Intergenic
1107879514 13:44820877-44820899 CCCCAAGCACAGTCAGATTGCGG - Intergenic
1108427684 13:50320308-50320330 CTCCAAATATAGTCACATTGGGG + Intronic
1108477823 13:50838717-50838739 CTCCAAATACAGTCACATTGGGG - Intronic
1108900079 13:55391723-55391745 CTCTAAAAACAATCATATTAGGG - Intergenic
1109009515 13:56922511-56922533 CTCCAAATACCATCACATTAGGG + Intergenic
1109056218 13:57552438-57552460 CTCCAAAAATAGCCACACTAGGG + Intergenic
1109671407 13:65613339-65613361 CTCCAAATACCATCACATTAGGG + Intergenic
1110357498 13:74584723-74584745 CTCCAAATATAGTCACATTAGGG + Intergenic
1110503149 13:76252860-76252882 CTCCAAATACAGTCACATTGGGG + Intergenic
1110727599 13:78843284-78843306 CTCCAAATACAGTCATATTAGGG + Intergenic
1110736543 13:78943565-78943587 CTCCAAACACAGTCACATTGTGG + Intergenic
1110959452 13:81602988-81603010 TTCCAAACATATTCAGATTAAGG - Intergenic
1110989050 13:82013405-82013427 CTCCAAATACCATCACATTAGGG - Intergenic
1111117765 13:83803552-83803574 CTCCCAAAACACTGGGATTATGG - Intergenic
1111758560 13:92432014-92432036 CTCCAAATACAATCACATTGGGG - Intronic
1111900832 13:94197645-94197667 CTCCAAATACAGTCAGATTGAGG + Intronic
1112094581 13:96118170-96118192 CTCCAAATAAAGTCACATTCTGG - Intronic
1112248213 13:97753905-97753927 CTCCAAATGCAGTCACATTGTGG + Intergenic
1112555121 13:100459996-100460018 CTCCAAATACTGTCACATTGAGG + Intronic
1112589499 13:100750371-100750393 CTCCAAACACAGGGGGATTAGGG - Intergenic
1112993239 13:105540073-105540095 CTAAAAATACAGTCTGATTATGG + Intergenic
1113024864 13:105929348-105929370 CTCCAAACACAGCCACATTGGGG - Intergenic
1113059223 13:106303248-106303270 CTACAAATACAGTCACATTCTGG - Intergenic
1113162367 13:107396247-107396269 CTCCAAATATAGTCAGATTGGGG + Intronic
1113176102 13:107565777-107565799 ATTCAAGAACAATCAGATTAAGG - Intronic
1113285661 13:108845609-108845631 CTCCAAATACAGTTGCATTAGGG + Intronic
1113360946 13:109630981-109631003 TTCCAAATACAGTCACATTGAGG - Intergenic
1114218890 14:20679620-20679642 CTCCAAATACAGTTACATTCTGG - Intergenic
1114247706 14:20929885-20929907 CTCCAAATACAGTGAGACTGGGG + Intergenic
1114394246 14:22342523-22342545 CTTCAAATACAGTCACATTGGGG + Intergenic
1115342500 14:32307571-32307593 CTCCAAATACAGTTATATTGGGG + Intergenic
1115375650 14:32672626-32672648 CTCCAAATATAGTCACATTGGGG + Intronic
1115702127 14:35963990-35964012 TTCCAAATACAGTCACATTGGGG + Intergenic
1116072136 14:40060567-40060589 CTCCAAATACCATCACATTAGGG + Intergenic
1116189966 14:41652033-41652055 TTCCAAATACAGTCACATTCTGG + Intronic
1116331996 14:43608946-43608968 CTCCAAATACTATCACATTAAGG + Intergenic
1116412931 14:44646947-44646969 CTCTAAATACAGTCACATTTGGG + Intergenic
1116429423 14:44828791-44828813 TTCCAAATACCGTCATATTAGGG - Intergenic
1116811893 14:49547356-49547378 CTCCAAATACAGTCACATGGGGG - Intergenic
1116849887 14:49897813-49897835 CTCCATCACCATTCAGATTATGG - Intergenic
1117211455 14:53504995-53505017 CTCCAAATACAGTCACATTGAGG + Intergenic
1117508768 14:56428016-56428038 CTCCAAATACAGTCACATCAGGG - Intergenic
1118074073 14:62279593-62279615 CTCCAAATACAATCACATTGAGG + Intergenic
1118085591 14:62412389-62412411 CTCCAAAGACAATCAAACTAGGG - Intergenic
1118501032 14:66362882-66362904 CTCCAAATAAAGTCATATTCTGG + Intergenic
1118556058 14:67023851-67023873 TTGCAAAAACAATTAGATTAAGG - Intronic
1118838967 14:69496944-69496966 CTCCAAATACAGTCACATGTGGG + Intronic
1118889198 14:69893801-69893823 CTCCAAATACAATCACATTCTGG - Intronic
1119167053 14:72503221-72503243 CTCCCAAAACCATCACATTAGGG + Intronic
1119616360 14:76101447-76101469 CTCCAAATATAGTCACATTCTGG - Intergenic
1119724138 14:76911864-76911886 CTCCAAATATAGTCACATTGGGG - Intergenic
1119942458 14:78656035-78656057 CTCCTAAAACTGTCACATTGTGG + Intronic
1120024828 14:79571002-79571024 CTCCAAATTCAGCCATATTAGGG + Intronic
1120126554 14:80750863-80750885 CTCCAAATACAGTCACACTTGGG - Intronic
1120468378 14:84890800-84890822 CTCCAAACACCGTCACAGTAGGG + Intergenic
1120468747 14:84895772-84895794 CTCCAAATACAGTCACATTGGGG + Intergenic
1120483573 14:85082907-85082929 CTCCAAATACAGTCACCTTCTGG + Intergenic
1120613757 14:86675848-86675870 CTCCAAATACAGTCCCATTGAGG - Intergenic
1120637785 14:86973438-86973460 CTCCAAACACAGTTACATTGTGG + Intergenic
1120703292 14:87722206-87722228 CTCCAAATACAATCACATTGAGG + Intergenic
1120710621 14:87789486-87789508 CTCCAAATACAGTCACGTTGCGG + Intergenic
1120934835 14:89884770-89884792 CTCCAAATACTGTCACATTGTGG - Intronic
1121214179 14:92234449-92234471 CTCCAAATACAGTAACATTGAGG - Intergenic
1121246060 14:92461660-92461682 CTCCAAATACAGTTACATTGGGG + Intronic
1121566945 14:94917072-94917094 CTCCAAATATAGTCACATTGGGG - Intergenic
1122057376 14:99111609-99111631 CTCCAAATATAGTCACATTGAGG - Intergenic
1122160402 14:99780212-99780234 CTCTAAATACAGTCACATTGGGG + Intronic
1123971463 15:25511739-25511761 CTCCTAAAACCATCACATTAGGG - Intergenic
1123986425 15:25650361-25650383 CTCCAAATACTGTCACATTGGGG + Intergenic
1124078255 15:26466746-26466768 CACCAATAACAGTCAGGTCAAGG + Intergenic
1124154117 15:27210033-27210055 CTCCAAAATCAGTCACTTTGGGG + Intronic
1124851247 15:33340753-33340775 CTCCAAATAGAGTCACATTTCGG + Intronic
1125049472 15:35279846-35279868 CTCCAAATACAGTCACGTTGAGG - Intronic
1125057160 15:35374897-35374919 ATGGAAAAACAGTAAGATTAGGG - Intronic
1125120691 15:36155362-36155384 CTCCAAATACAGTCACAATGGGG + Intergenic
1125396575 15:39255283-39255305 CTCCAAATACAGTTACATTGTGG - Intergenic
1125885219 15:43224313-43224335 CTCCAAATACAGTCACATTGGGG + Intergenic
1126789323 15:52206431-52206453 CTCCAAATACAGCCACACTAGGG - Intronic
1126796320 15:52262881-52262903 CTCCAAATACGGTCACATTGGGG - Intronic
1126915534 15:53461934-53461956 CTGCAAATACAGTCACATTAGGG + Intergenic
1127110720 15:55666353-55666375 CTCCAAACAGAGTCACATTTAGG + Intronic
1127311961 15:57760286-57760308 CTCCAAACATAGTCACCTTAGGG + Intronic
1127321232 15:57848434-57848456 CTCCAAATAGAGTCACATTTGGG + Intergenic
1127484064 15:59403257-59403279 CTCCAAATACAGTCATATTGGGG - Intronic
1127571790 15:60250762-60250784 CTCCAAACACAGTCACATTAAGG + Intergenic
1127591293 15:60426153-60426175 TTCCAAATACAGTCACATTTTGG + Intronic
1128486968 15:68101991-68102013 CTACCAAAACACTGAGATTATGG + Intronic
1129654378 15:77514080-77514102 CTCCAAATACAGACACATTAGGG + Intergenic
1130162841 15:81418810-81418832 CTCCAAATACAGTCATATTGTGG - Intergenic
1131539415 15:93263609-93263631 CTCCAAATACAGTCTTATTAGGG + Intergenic
1131994700 15:98122891-98122913 CTCCAAACACAGTCACATATGGG + Intergenic
1132800061 16:1747613-1747635 CTCCAAATACAGTCATGCTAGGG + Intronic
1133023001 16:2975048-2975070 CTCCATTTACAGCCAGATTAAGG - Intronic
1133561523 16:6954971-6954993 CTCCCAAAGTACTCAGATTATGG - Intronic
1133694665 16:8250455-8250477 CTCCAAATACAGTCACATTCTGG + Intergenic
1135292480 16:21251824-21251846 TTCCAATTACAGTCACATTAGGG - Exonic
1136014445 16:27386400-27386422 CTCCAAATACAGCCACATTGTGG + Intergenic
1137309891 16:47244721-47244743 CTCCAAGAACAGCCACATTGGGG - Intronic
1137466348 16:48713307-48713329 CTCCAGATACAGTCACATTGGGG - Intergenic
1137527678 16:49250438-49250460 CTCCAAATACAGTCACGTTGGGG - Intergenic
1137539181 16:49350285-49350307 CTCCAAACACAGTCACATTGGGG - Intergenic
1138142624 16:54581950-54581972 CTCCAAATACAATCATATTAGGG + Intergenic
1138231173 16:55337559-55337581 CTCCAAATACAGTCACATTAGGG + Intergenic
1138310214 16:56017149-56017171 CTCCAAATATAGTCACATTGGGG - Intergenic
1138854358 16:60670405-60670427 CTCCAAATACAGTCACATTGAGG + Intergenic
1138903580 16:61303224-61303246 CTCCAAATTCAGTCAGATTGAGG - Intergenic
1139120358 16:64009086-64009108 CTCCAAAAACCATCACATTAGGG - Intergenic
1140232975 16:73133191-73133213 CTCTAAATACAGTCACATTCTGG - Intronic
1140275050 16:73501489-73501511 CTCAAAACACATTCAGAGTAGGG - Intergenic
1140596408 16:76419968-76419990 TTCCAAATACAGTCACATTGTGG + Intronic
1140710156 16:77670273-77670295 CTCCAAATACAGTCACAGTGGGG - Intergenic
1141062331 16:80884903-80884925 CTCCAAATGCAGTCACATTGAGG + Intergenic
1141558557 16:84852207-84852229 CTCCAAGTACAGTCACATTGTGG + Intronic
1141906232 16:87028809-87028831 CTGCAAAACCAGTCTGACTACGG + Intergenic
1142163076 16:88569451-88569473 CTGCAAACACAGTCACATTGGGG + Intergenic
1143194420 17:5064642-5064664 CTCTAAATACAGTCACATTTGGG - Intergenic
1143272522 17:5686324-5686346 CTCCAAATACCATCACATTAGGG - Intergenic
1143790897 17:9294745-9294767 CTCCAAATACAGTTACATTGAGG - Intronic
1143957235 17:10680627-10680649 GGCTAATAACAGTCAGATTAGGG - Exonic
1144274208 17:13649380-13649402 CTCCAAATACGGTCACATTTAGG + Intergenic
1144552183 17:16250443-16250465 CTCCAAATACAGTCACATTTTGG + Intronic
1145238817 17:21227529-21227551 CTCCACACCCAGTGAGATTAAGG - Intergenic
1146280424 17:31540998-31541020 CTCCAAATACAGTCACACTGGGG + Intergenic
1146297246 17:31659512-31659534 TTCCAAATACAGTCACATTAAGG + Intergenic
1148019720 17:44545600-44545622 CTCCAAATACAATCACATTGAGG - Intergenic
1148478422 17:47944359-47944381 CTCCAAATACAGTCACATTGGGG + Intronic
1150052825 17:61981331-61981353 CTTAAAAAACAATCAGAATAAGG + Intronic
1150088990 17:62303486-62303508 CTCTAAATACAGTCACATTGGGG + Intergenic
1150110252 17:62492838-62492860 CTCCCAAAATAGTGAAATTATGG - Intronic
1150457607 17:65320103-65320125 CTTCAAATACAGTCACATTAGGG + Intergenic
1150511463 17:65756937-65756959 CTCCAAATACAGTCAAATTGGGG - Intronic
1150864958 17:68839984-68840006 CTCCAAATACAGTCACATCGGGG - Intergenic
1151331538 17:73412522-73412544 CTCCAAATACAGTCACATTCTGG - Intronic
1152771139 17:82170122-82170144 CTCCAAATACAGTCATGTTCGGG - Intronic
1152869922 17:82747887-82747909 CTCCAAATACAGGTATATTAGGG + Intronic
1153076712 18:1170538-1170560 ATCCAAAAACATTCAGAGTGTGG + Intergenic
1153762610 18:8346522-8346544 CTCCAAATACAGTCACACTTGGG + Intronic
1154057042 18:11022657-11022679 CTCCAAATACAGTCACATTGTGG + Intronic
1154273318 18:12938537-12938559 CTCCAAACATAGTCAGATTAGGG - Intergenic
1155028353 18:21962455-21962477 CTCCAAATACAGTCACATTGGGG + Intergenic
1155233409 18:23795875-23795897 CTCCAAATACAGTCACACTGGGG - Intronic
1155939709 18:31791059-31791081 CTCCAAATACAGTCACATTAGGG - Intergenic
1156260874 18:35444182-35444204 CTCCAAATACAGTCACATTTGGG + Intronic
1156592646 18:38509073-38509095 TTCCAAATACAGTCACATTGGGG + Intergenic
1156700533 18:39819317-39819339 CTGCAAAAACTGCCAGAGTAAGG - Intergenic
1157348592 18:46863817-46863839 CTCCAAATACAGTCACATTGGGG - Intronic
1157634076 18:49131610-49131632 CTCCAAACACAGTCTTATTGGGG + Intronic
1157840867 18:50957136-50957158 CTCCAAATACAGTCACATTGAGG + Intergenic
1157870010 18:51221377-51221399 CTCCAAATACCATCACATTAAGG + Intergenic
1157887106 18:51379436-51379458 CTCCAAATATAGTCAAATTGAGG - Intergenic
1157894542 18:51452466-51452488 CTCCAAACATAGTCACATTGAGG - Intergenic
1158028613 18:52934663-52934685 CTCCAAATACAGTCACATTGGGG - Intronic
1158041304 18:53097932-53097954 CTCTAAATACAGTCACATTGGGG + Intronic
1158226899 18:55210822-55210844 CTCCAAATACAGTTACATTGGGG - Intergenic
1158303121 18:56075183-56075205 CTCCAAATACAGTTACATTAGGG + Intergenic
1158799870 18:60893750-60893772 CTCCAAATACAGTCACATTGTGG - Intergenic
1158871110 18:61689095-61689117 CTCCAAATACCATCACATTAGGG - Intergenic
1159150578 18:64518252-64518274 CTCCAAATGCAGTCACATTCTGG + Intergenic
1159232669 18:65629341-65629363 TTCCAAATATAGTCACATTAAGG - Intergenic
1159276060 18:66222972-66222994 GTCCAAAAACAGTTAAAGTATGG - Intergenic
1159280291 18:66276220-66276242 CTCCAGATATAGTCACATTAGGG - Intergenic
1159325470 18:66910236-66910258 CTTCAAAACCAGTCACATTTGGG + Intergenic
1159449225 18:68578298-68578320 CTCCAAATACAGTCACATCAGGG - Intergenic
1159579487 18:70219056-70219078 CTCCAAATACAGTAACATTGAGG + Intergenic
1159611947 18:70535563-70535585 CTCCAACTATAGTCACATTAGGG + Intergenic
1160052268 18:75445167-75445189 CTCCAAAAACAATCTGCTGACGG - Intergenic
1160621682 18:80175539-80175561 CTCCAGATACAGTCAGACTGAGG + Intronic
1161233436 19:3186721-3186743 CTCCAAACGCAGTCAGCTAAAGG - Intronic
1161340919 19:3741709-3741731 CTCCCAAACCATTGAGATTACGG - Intronic
1161361161 19:3850485-3850507 CTCCAAATACAGTCACATGGGGG - Intronic
1161950564 19:7465367-7465389 CTCCCAAAACACTGGGATTATGG - Intronic
1163304382 19:16468644-16468666 CTCCAAAAGAACTCAGTTTATGG - Intronic
1163864831 19:19764095-19764117 CTCCAATTACAGTCACATTGAGG + Intergenic
1164427298 19:28153000-28153022 CTCTAAGTACAGTCACATTAGGG - Intergenic
1164427748 19:28157551-28157573 CTTCAAATACAGTCACATTGGGG - Intergenic
1164961548 19:32435279-32435301 CTCCAAGAACAGTCATATTAGGG + Intronic
1165080815 19:33304994-33305016 CTCCAAATACAGTCACATGGGGG - Intergenic
1165171715 19:33897031-33897053 CTCCAAATACAGTCACACTGGGG - Intergenic
1166896808 19:46028248-46028270 CTCCAAAAATGGTGAGATTATGG + Intergenic
1168521630 19:57055742-57055764 CTCCAAATACAGTCACATTGGGG + Intergenic
925043283 2:750773-750795 CTCCAAAAGCCCTGAGATTACGG + Intergenic
925273271 2:2630517-2630539 CTCCAAATACAATCATATTGAGG - Intergenic
925504342 2:4544020-4544042 CTCCAAATACCCTCAGATTGTGG + Intergenic
925509852 2:4613297-4613319 CTTCAAATACAGTCATATTTTGG + Intergenic
925604771 2:5647962-5647984 CTTCAGAAACAGTCACATGAGGG - Intergenic
925822900 2:7817988-7818010 CTCCAAATACAGTCACATTAGGG + Intergenic
926352161 2:12005683-12005705 CTTCAAATACAGTCACATTAGGG + Intergenic
926352467 2:12008765-12008787 CTCCAAACACAGTCACATTGGGG + Intergenic
926384643 2:12324114-12324136 CTCCAAATACAGTCACACTGGGG + Intergenic
926392270 2:12405566-12405588 CTCCAAATACAGTCATATCGGGG - Intergenic
926553598 2:14330843-14330865 TACCAAATACAGTCACATTAGGG - Intergenic
927189116 2:20504524-20504546 CTCCAAATACAATCACATTAGGG + Intergenic
927196010 2:20547298-20547320 CTCCAAATACCTTCACATTAGGG - Intergenic
927245875 2:20956823-20956845 CTCCAAATACAGTCACATTCTGG - Intergenic
927327374 2:21820645-21820667 CTCCAAATATAGTCACATTAGGG + Intergenic
927365247 2:22287358-22287380 CTCCAAATACAGTCACATTGGGG + Intergenic
927423403 2:22955890-22955912 CTCCAAATACAGTCATAGTGGGG + Intergenic
927450206 2:23202822-23202844 CTCCAAATACTGTCATGTTAGGG + Intergenic
928035566 2:27819388-27819410 CTCCAAATACAGTCACATTGGGG + Intronic
928275448 2:29896384-29896406 CTCCAAATGCAGTCACATTGGGG - Intronic
928406120 2:31016355-31016377 CTCCAAATACAGTCACATGGGGG + Intronic
928660002 2:33492493-33492515 CTTCAAACACAGTCATATTGGGG - Intronic
928693999 2:33830304-33830326 CTCCAAATACCATCACATTAAGG - Intergenic
928702068 2:33909137-33909159 CTCAAAATCCAGTCACATTAGGG + Intergenic
929034902 2:37681290-37681312 CTCCAAATACAGTCATTTTAAGG - Intronic
929538656 2:42802190-42802212 CTCCCAAAACACTGGGATTACGG - Intergenic
930542007 2:52718390-52718412 CTCCCTAAACAGACACATTAAGG + Intergenic
930697590 2:54427646-54427668 CTCCAAATACAGTCACTTTTGGG + Intergenic
930706588 2:54510345-54510367 CTCCGAATACAATCACATTAGGG + Intronic
931157488 2:59652059-59652081 CTCCAAATATAGTCACATTGAGG - Intergenic
931382631 2:61767562-61767584 TTCCAAATACAGTCACATTGGGG + Intergenic
931447057 2:62335599-62335621 CTCCAAATACAGTCGAATTAGGG - Intergenic
931927167 2:67086244-67086266 CTCCAAATACAGTTACATTAAGG - Intergenic
931927344 2:67087544-67087566 CTCCAAATACAGTTACATTAAGG + Intergenic
931985358 2:67736474-67736496 CTCCAAATACAGTCACATTCTGG + Intergenic
932020314 2:68077937-68077959 CTCCAAATGCAGTCACATTGAGG + Intronic
932314745 2:70772419-70772441 CTCCAAATACAGTCACATTGTGG - Intergenic
932323844 2:70841622-70841644 CTCCAGACACAGTCATATTGAGG + Intergenic
932600941 2:73125087-73125109 CTCCAAGTACAGTCACATTCTGG + Intronic
932825487 2:74935126-74935148 CTCCAAATACAGTCATATTGGGG - Intergenic
932889293 2:75578105-75578127 CTCCAAATACTCTCACATTAGGG - Intergenic
933100175 2:78245786-78245808 CTCCAAGTACAGTCACATTTGGG + Intergenic
933184331 2:79261746-79261768 CTCCAAATGCAGTCACATCAGGG + Intronic
933972095 2:87478341-87478363 GTCCAAATACAGTCACATTCTGG + Intergenic
934517446 2:94997749-94997771 CTCCAAATACAGTTATATTGGGG - Intergenic
934546218 2:95218899-95218921 CTCCAAATATAGTCACATTGAGG + Intronic
934569871 2:95362499-95362521 CTCCAAATACAGTCACACTGGGG + Intronic
934901867 2:98166005-98166027 CTCCAAATACAGTCTCATGATGG - Intronic
934940572 2:98498687-98498709 CTCCAAATACGGTCACATTGGGG - Intronic
935004721 2:99061789-99061811 CTCCAAATATAGTCACACTAGGG - Intronic
935154215 2:100468224-100468246 TTCCAAATACAGTCACATTGGGG + Intergenic
935160204 2:100523469-100523491 CTCCAAATACTGTCACATTCAGG + Intergenic
935301031 2:101694157-101694179 CTCCAAACACAGCCACACTAGGG - Intergenic
935423705 2:102897512-102897534 CTACAAATACAGTCACATTCTGG + Intergenic
935563201 2:104579190-104579212 CTCCAAATACAGTCACAATGGGG + Intergenic
935660795 2:105465243-105465265 CTCCAAATACAGTCATACTGGGG + Intergenic
935691036 2:105732739-105732761 CTCCAAATACACTCACATTGAGG - Intergenic
935716130 2:105940482-105940504 TGCCAAACACAGTCACATTAGGG + Intergenic
935802789 2:106715201-106715223 CTGCAAATACAGTAAGATTAGGG + Intergenic
935985884 2:108672692-108672714 CTTAAAAATCAGTCATATTAGGG + Intronic
936138315 2:109916319-109916341 CTTAAAAATCAGTCATATTAGGG + Intergenic
936206381 2:110455166-110455188 CTTAAAAATCAGTCATATTAGGG - Intronic
936321633 2:111471856-111471878 GTCCAAATACAGTCACATTCTGG - Intergenic
936976429 2:118225806-118225828 CTCCAGAAACACACAGATAAAGG - Intergenic
937080015 2:119134193-119134215 CTCCAACTACAGTCACATTGGGG + Intergenic
937749408 2:125456542-125456564 CTTCAAATAAAGTCAGATTTTGG + Intergenic
938060050 2:128246706-128246728 CTCCCAAAACTGTCACATTGGGG + Intronic
938579809 2:132635741-132635763 CCCCAAATACAGTCAGATTTGGG - Intronic
938626090 2:133111086-133111108 CTCCAAATACAGTCACATCAGGG + Intronic
939256575 2:139751247-139751269 CTCCAAATACAGTCACATTGTGG + Intergenic
939260714 2:139805415-139805437 AGCCAAAAACAGTCATTTTAAGG + Intergenic
939332991 2:140788789-140788811 CTCCAAATACAGTCACACTGAGG - Intronic
939444932 2:142296988-142297010 CTCCAAATACAGTCACAGTGGGG + Intergenic
939956299 2:148530309-148530331 GTCTAAAAACAGTCACATTGGGG - Intergenic
940210462 2:151251619-151251641 TTCCAAAAACAGAAAGATCAAGG + Exonic
940418322 2:153448849-153448871 CTCCAAATACAGTTATATTTAGG - Intergenic
941142507 2:161802918-161802940 CTCTAAATACAGTCACATTTGGG + Intronic
941360573 2:164546634-164546656 CACCAGAAAAAGTGAGATTAAGG + Intronic
941548361 2:166883134-166883156 TTCCAAGAACAGTCATATTGAGG + Intergenic
941644383 2:168024408-168024430 CTCCCAACACAGTCACATCAGGG - Intronic
941687137 2:168458127-168458149 CTCCAAAAACAAGCAGACTCAGG + Intronic
942497099 2:176551233-176551255 CTCCAAATACAGTCACATTGGGG + Intergenic
943168294 2:184361426-184361448 CCTGAGAAACAGTCAGATTAAGG - Intergenic
943259631 2:185642498-185642520 CTCCAAATAAAGTCATATAATGG + Intergenic
943489295 2:188530470-188530492 CTTCAAATATAGTCATATTAGGG - Intronic
943784409 2:191861272-191861294 CTCCAAATACAGTCACCTTGGGG + Intergenic
943992350 2:194712923-194712945 CTCCCAAAACAGTAGAATTACGG - Intergenic
944233197 2:197416378-197416400 CTCCAAATACAGTCACACTGGGG - Intronic
944901411 2:204220307-204220329 CTCCAAGTACAGTCACATTGGGG + Intergenic
945065049 2:205941230-205941252 CTCCAAATACCATCACATTAGGG + Intergenic
945259413 2:207830271-207830293 CTCCAAATATAGTCACATTGTGG - Intronic
945300670 2:208213277-208213299 CTCAAAAAACAAGCAGATCAGGG - Intergenic
945323424 2:208454319-208454341 CTCCAAATAGAGTCACATTGGGG - Intronic
945496640 2:210515233-210515255 CTCCAAAAACAGAAAGAGGAAGG - Intronic
945558189 2:211305125-211305147 CTCCAAATACAGTCACACTGGGG + Intergenic
945899282 2:215519670-215519692 CTCCAAATACAGTCACATGAAGG + Intergenic
946467579 2:219925691-219925713 CTCCAAATACAGTCACATTTGGG - Intergenic
946533732 2:220604592-220604614 CTCCATATACAGTCACATTGGGG + Intergenic
946619365 2:221544724-221544746 CTCCAAATATAGTCACATTGTGG - Intronic
946667781 2:222068748-222068770 CTCCAAATACAGCCACATTGGGG + Intergenic
946821358 2:223633184-223633206 CTCCAAATACAATCACATTGAGG + Intergenic
946858670 2:223978836-223978858 CTCCAAATACAGTTACGTTAGGG - Intronic
946866622 2:224046678-224046700 CTTCAAATACAGTCACATTAGGG + Intergenic
947133726 2:226955862-226955884 CTCCAAATACAGTCACATTGGGG + Intronic
947216413 2:227754092-227754114 CTCCAAATATAGTCACATTAGGG + Intergenic
947462174 2:230313133-230313155 CTCCGAGAAGAGTCAGATGATGG - Exonic
947995422 2:234523316-234523338 CTCAAAATACAGCCACATTAAGG - Intergenic
948102964 2:235390042-235390064 CTCCAAATGCAGTCACATCAGGG + Intergenic
948112824 2:235470771-235470793 CTCCAAATACAATCAGATTGGGG + Intergenic
948790267 2:240373154-240373176 CTCCTAAAACCGTCATATTGGGG + Intergenic
1168745507 20:236333-236355 CTCCAAATACAGTGACATTGTGG - Intergenic
1169094057 20:2880761-2880783 CTCCCAAAACAGTGGGATTATGG - Intronic
1169163372 20:3401948-3401970 CTAGCAAAACAGTCTGATTAAGG - Intronic
1169451216 20:5713239-5713261 CTCCAAACACAGTCATATTGTGG - Intergenic
1169713256 20:8588458-8588480 CTCCAAATAAAGTCACATTAGGG - Intronic
1169938750 20:10914230-10914252 CTCCAAATACAGTCACACTGAGG - Intergenic
1170343761 20:15359423-15359445 CTCCCAAAGTAGTCAGCTTAAGG + Intronic
1170504332 20:17009132-17009154 CTCCAAATGCAGTCACATTAGGG + Intergenic
1170658081 20:18309202-18309224 CTCCAAATACAGTCACATTAGGG + Intronic
1170671662 20:18439923-18439945 CTCCAAATACAATCACATTGGGG - Intronic
1171022582 20:21599812-21599834 TTCCAAAAGCCCTCAGATTAGGG - Intergenic
1171188273 20:23138985-23139007 CTCCAAAAGCTGTCTGATCAAGG + Intergenic
1171967498 20:31541583-31541605 GACCAAAAACTGTCAGATGAAGG + Intronic
1172950163 20:38718332-38718354 CTCCAAATACAGTCACATTGAGG + Intergenic
1172998226 20:39086531-39086553 CTCCAAATACAGTCACATTGAGG - Intergenic
1173234192 20:41228682-41228704 CTCCTAAGACAATCACATTAGGG + Intronic
1173296968 20:41768227-41768249 TTCCAAAAAGAGTCAGCCTAGGG + Intergenic
1173472919 20:43337550-43337572 CTCTAAAAAAAGTCATGTTAAGG - Intergenic
1173525988 20:43733051-43733073 CTCCAAAATCAGTCACATTGAGG - Intergenic
1174533650 20:51234243-51234265 CTCCAAATACAGTCACATTCTGG + Intergenic
1174971638 20:55282463-55282485 CTCCAAATACAGTCACTCTAGGG + Intergenic
1175053311 20:56175102-56175124 CTCTAAACACAGTCATATTGAGG - Intergenic
1175446948 20:59027963-59027985 CTCCAAAAACAGTTAAAATCAGG + Exonic
1176425265 21:6544789-6544811 CTCCAAATACAGTCACACTGGGG + Intergenic
1176925824 21:14747394-14747416 CTCCAAATATAGTCACATTAGGG + Intergenic
1176960088 21:15149605-15149627 CTCCCAACACAATCAGATGATGG + Intergenic
1177022887 21:15885073-15885095 CTCCAAACACAGTCATGTTAGGG + Intergenic
1177264737 21:18767493-18767515 TTCCAAAAACAGTCACATTGTGG + Intergenic
1177298061 21:19202687-19202709 TTCCAAAGACAGTCACATTCTGG - Intergenic
1177476563 21:21631675-21631697 GCCCAAAAAAAGTCAAATTAAGG + Intergenic
1177521477 21:22233377-22233399 CTCCAAATATAGTCATATTAGGG - Intergenic
1177774559 21:25553615-25553637 CTCCAAATACAATCATATTGGGG - Intergenic
1177872936 21:26595366-26595388 CTCCAAATACAATCACATTGAGG + Intergenic
1178223374 21:30686213-30686235 CTCCAAATACAGTCATATTAGGG + Intergenic
1178308545 21:31510423-31510445 CTCCAAATACAATCACATTCTGG + Intronic
1178523991 21:33309910-33309932 CTTCAAATACAGTCACATTGGGG - Intergenic
1179241379 21:39596133-39596155 CTCCAAATACAGTCACATTGGGG - Intronic
1179244480 21:39619402-39619424 CTCCAAATACAGTCACATTGGGG + Intronic
1179357255 21:40672178-40672200 TTCCAAATACAGTCACATTGGGG + Intronic
1179446628 21:41436347-41436369 CTTCAAATACAGTCCCATTAGGG + Intronic
1179700756 21:43153106-43153128 CTCCAAATACAGTCACACTGGGG + Intergenic
1179835276 21:44027752-44027774 CTCCCAAAACCATCACATTAGGG - Intronic
1180050540 21:45329158-45329180 CTCCAAATACAGTCACCTTCTGG + Intergenic
1180122990 21:45766310-45766332 CTCCAAAAGCAGTCATACTAGGG - Intronic
1180154075 21:45969548-45969570 CTCCAAATGCACTCACATTAGGG - Intergenic
1180255951 21:46627627-46627649 CTTCAAATACAGTCACATTGGGG - Intergenic
1180641408 22:17302379-17302401 CTCCAAATGCAGTCACATTGAGG - Intergenic
1180698263 22:17768081-17768103 CTCCATAGACAGAAAGATTAGGG + Intronic
1181361657 22:22342595-22342617 CTCCAAATACAGTAATATTGGGG - Intergenic
1181389158 22:22566998-22567020 CTCCAAATACCATCACATTAGGG + Intergenic
1182384380 22:29923802-29923824 CTTCAAATACAGTCATATCAGGG + Intronic
1182902260 22:33908271-33908293 CTAGCAAAACAGTCAGGTTACGG + Intronic
1183046246 22:35222771-35222793 CTCCAAATACAGTCACATTAGGG - Intergenic
1184526605 22:45027574-45027596 ATCTAAAAACAGTCACATTGAGG - Intergenic
1184622620 22:45693678-45693700 CTCCAAATTCAGTCACATTCTGG - Intronic
1185022402 22:48385810-48385832 TTCCAAATACAGTCACATCATGG + Intergenic
1185086041 22:48741537-48741559 CTCCAAATACATTCAGACTGGGG - Intronic
1185163891 22:49245862-49245884 CTCCAAATACAGTCAAACTGGGG + Intergenic
949091538 3:34990-35012 CTCCAAATACAGTCATATTGGGG - Intergenic
949255817 3:2044610-2044632 CTCCAAATACTGCCACATTAAGG - Intergenic
949542635 3:5045757-5045779 CTCCAAATACAGACACATTCTGG - Intergenic
949627856 3:5888087-5888109 CTCCAAATACCATCACATTAAGG - Intergenic
949762677 3:7488393-7488415 CTCCCAACACTGTCACATTAGGG - Intronic
949769186 3:7560012-7560034 TTCCAAATACAGTCATATTGGGG + Intronic
949798030 3:7872249-7872271 CTCCAAATACAGTCACATTGGGG - Intergenic
949880032 3:8654289-8654311 CTCCAAATACTATCACATTAGGG + Intronic
950795141 3:15504556-15504578 CTCCAAATATAGTCACATTCTGG + Intronic
950884772 3:16353620-16353642 CTCCAAATACAGCCAAACTAGGG - Intronic
950885547 3:16359374-16359396 CTCCAAATATAGTCACATTGTGG - Intronic
951148216 3:19254991-19255013 CTCCAAATACAATCATATTGGGG - Intronic
951745237 3:25970912-25970934 CTCCAAATACAGCCACATTGAGG - Intergenic
951936800 3:28031315-28031337 CTCCAATTACAATCACATTAGGG - Intergenic
951953601 3:28229174-28229196 CTCCAAACACAGTCACATCGAGG - Intergenic
951955632 3:28250094-28250116 CTCCACATACAGTCACATTGAGG + Intronic
952135592 3:30415657-30415679 CTCCAAATATAGTCATATTTGGG - Intergenic
952255732 3:31694025-31694047 CTCCAAAAGCACTGGGATTACGG + Intronic
952333737 3:32387249-32387271 CTCCAAATACAGTCACACTTGGG - Intergenic
952448161 3:33403986-33404008 CTCCCAAAGCACTGAGATTAGGG - Intronic
952585868 3:34891238-34891260 CTCAAAAAACAGTCACATTGGGG + Intergenic
953509104 3:43517430-43517452 CTCCAAATACAGCCACATTGGGG - Intronic
953592174 3:44268776-44268798 CTCCAAATATAGTCATATTGAGG + Intronic
953628458 3:44590527-44590549 CTCCAAATACAGTCACATTGGGG + Intronic
954806126 3:53221929-53221951 CTCCAAATACAGTCACATTAGGG - Intergenic
955293811 3:57717020-57717042 CTCCAAATACAGTCACATTGGGG + Intergenic
955455575 3:59117493-59117515 CTCCAAATATAGTCACATTGGGG - Intergenic
955459229 3:59162103-59162125 CTCCAAATACAGTCATATTAGGG - Intergenic
955615873 3:60805899-60805921 CTCCAAATACAGTCACATTAGGG + Intronic
955679003 3:61480801-61480823 CTCCATAAACAGTGAGAAAATGG + Intergenic
955979761 3:64512961-64512983 CTCCAAATACAGTCACATTAGGG - Intergenic
956060665 3:65345038-65345060 CTCCAAATACAGTCACATTGGGG - Intergenic
956133641 3:66077667-66077689 CTCCAAGTACAATCATATTAGGG - Intergenic
956144692 3:66180833-66180855 CTCCAAATACAGTCACACTGGGG - Intronic
956460959 3:69472169-69472191 TTCCAAAAACAGAAAGATCAAGG + Intronic
956734235 3:72225051-72225073 ATCCAAAACCAGACACATTATGG - Intergenic
956850475 3:73223982-73224004 CATCAAAATCAGTCAGATTTGGG + Intergenic
957155868 3:76543259-76543281 CTTCAAATACAGTCACATTGTGG - Intronic
957290316 3:78270342-78270364 CTCCAAATACCTTCACATTAGGG - Intergenic
957432074 3:80123733-80123755 TTCCAAATACAGTCATATTGGGG + Intergenic
957655225 3:83065275-83065297 CTCCAAATACAGTCACACTGGGG + Intergenic
957679635 3:83417368-83417390 CTCCAAATACAGTCACACTGGGG - Intergenic
957918681 3:86720351-86720373 CTCCAAATACAGTCACATTGGGG - Intergenic
958052903 3:88370765-88370787 CTCCAAATACAGTCACATTGGGG - Intergenic
958135590 3:89485604-89485626 TTCCACAAAGACTCAGATTAAGG - Intergenic
958583571 3:96057459-96057481 CTCCAAATACAGTCACATGGGGG - Intergenic
958682118 3:97344357-97344379 CTCCAAATACCATCACATTAGGG - Intronic
960137105 3:114116533-114116555 CTCCAAATACAGTCACATTGGGG + Intergenic
960543004 3:118881454-118881476 CTCCAAATACAGTCACATTTCGG - Intergenic
960572653 3:119200308-119200330 CTCCCAAAACACTGGGATTATGG + Intronic
961317942 3:126053154-126053176 CTCCAAATACAGTCATGTTTTGG - Intronic
962203830 3:133419236-133419258 CTCCAAATACAGTCACATTCTGG + Intronic
962602125 3:137000422-137000444 TTTCAAAAACAGTAAGACTATGG + Intronic
962682052 3:137810516-137810538 CTCCAAATACAGTCACACTGGGG - Intergenic
962902730 3:139775280-139775302 CTCCAAATATAGTCATATTGGGG - Intergenic
963329506 3:143898540-143898562 CTTCAAAAACAGTCACATTGAGG - Intergenic
963526724 3:146424367-146424389 CTCCAAATACAGTCACATTGCGG + Intronic
963877909 3:150497478-150497500 CTCAAAATACAGTCACATTGGGG - Intergenic
963943545 3:151119564-151119586 CTCCAAATATAGTCACATTGAGG + Intronic
963999031 3:151745827-151745849 ATCCAGAAATAGTCACATTAAGG - Intronic
964634570 3:158845104-158845126 CTCCAAATACAGTCACGTTGGGG - Intergenic
964639305 3:158891666-158891688 CTCCAAATACTGTCACATTGGGG + Intergenic
964858560 3:161173860-161173882 CTCCAAATATAGTCACATTTCGG + Intronic
965122233 3:164575531-164575553 CTCCACAAATTGTCAAATTAAGG + Intergenic
965708965 3:171537294-171537316 CTCCAAATACAGTCACACTGGGG + Intergenic
965836888 3:172862752-172862774 TTCCAAATATAGTCAGATTGGGG - Intergenic
965967401 3:174509821-174509843 CTCCAAATACAGTCAGATTGAGG + Intronic
966042124 3:175504419-175504441 CTCCAGAAAGAGTCACATTAGGG - Intronic
966282338 3:178246414-178246436 CTTCAAATACAGTCATATTGGGG + Intergenic
966535877 3:181033082-181033104 CTCCAAATACAGTCATATTGGGG + Intergenic
966655882 3:182358355-182358377 CTTCAAATACAGTCACATTCTGG - Intergenic
966774507 3:183532093-183532115 CTCCTAATACATTCACATTAGGG - Intronic
966823735 3:183945804-183945826 CTCCAAGAGGAGTCAGATCACGG + Intronic
967138698 3:186534371-186534393 CTGTAAAAACAGTGAGATTGGGG - Intergenic
968395513 4:233081-233103 CTCCAAAATGAGACAGATAAAGG + Intergenic
968414338 4:417211-417233 CTCCAAAATGAGACAGATAAGGG + Intergenic
968906160 4:3451848-3451870 CTCCAAATACAGTCACATGCTGG - Intergenic
969040455 4:4291461-4291483 CTCCAAATACAATCACATTCTGG + Intronic
969044728 4:4328337-4328359 CTCCAAATACAGTCACCTTTGGG - Intergenic
969331585 4:6476339-6476361 CTCCTAAAACCATCACATTAGGG - Intronic
969854960 4:9991612-9991634 CCCCAAATGCAGTCACATTAGGG - Intronic
969916881 4:10499947-10499969 CTTCAAATACAGTCACATTCTGG + Intronic
970094973 4:12453097-12453119 GTCCAAAAACACTCAGAGCAGGG - Intergenic
970295392 4:14624257-14624279 CTCCAAAAACCATCACATTGGGG + Intergenic
970378562 4:15482640-15482662 CTCTAAATGCAGTCAGATTGGGG + Intronic
970385696 4:15554413-15554435 CTCCCAAAATAGTCGGATAATGG - Intronic
970725255 4:19036378-19036400 CTCCAAATACAATCACTTTAGGG - Intergenic
970770543 4:19607032-19607054 CTCCAAATACAGTCACATTGGGG + Intergenic
970775051 4:19663751-19663773 CTCCAAATACCATCACATTAGGG - Intergenic
971118728 4:23680043-23680065 CTACAAAAACATTCAGTCTAAGG - Intergenic
971145949 4:23976573-23976595 CTCCAGATATAGTCACATTAGGG - Intergenic
971222070 4:24717425-24717447 CTCTAAAGTCAGTCACATTAGGG - Intergenic
971554351 4:27994315-27994337 CTCCAAATACAGTCACATTCTGG + Intergenic
972174656 4:36388701-36388723 CTCCACACACAGTCACATTGAGG + Intergenic
972220265 4:36947346-36947368 CTCCAAATATAGTCACATTGGGG - Intergenic
972638742 4:40907225-40907247 CTCCAAATACAGTCACATTGGGG - Intronic
972864306 4:43211493-43211515 CTCCAGAAACAGTAAAACTAAGG + Intergenic
973242906 4:47977152-47977174 CTCCAAAAACCGTCACATTCTGG - Intronic
973800076 4:54468998-54469020 CTCCAAACACAGTCCCATTGGGG + Intergenic
973962266 4:56123525-56123547 CTCCAAATACAGTCACGTTGAGG + Intergenic
974079452 4:57197140-57197162 CTCCAAATACCATCACATTAGGG - Intergenic
974116824 4:57589311-57589333 CTCAAAATATAGTCAGATTAGGG - Intergenic
974693138 4:65327547-65327569 TTTCAAAAACTGTCAAATTAAGG + Intronic
975312534 4:72918583-72918605 TTCCAAAGACAGTCACACTAGGG - Intergenic
975661962 4:76697183-76697205 CTCCCAAAACACTGGGATTAAGG + Intronic
975994669 4:80300743-80300765 CTCCAAATACAGTTATATTAGGG - Intronic
976007802 4:80451364-80451386 CTCCAAGTACAGTCACATTTTGG + Intronic
976188590 4:82467795-82467817 CTCCAAATATAGTCACATTGGGG - Intergenic
976391279 4:84506819-84506841 CTACAAATACAGGCTGATTAGGG + Intergenic
977552641 4:98458248-98458270 CTCCAAATACCATCACATTAGGG + Intergenic
978025980 4:103874838-103874860 CTCCAAATAAAGTCACATTGGGG + Intergenic
978199079 4:106004174-106004196 CTCCAAACACAGTCACATTTGGG - Intergenic
979173759 4:117636144-117636166 CTCCTAATACCGTCACATTAGGG - Intergenic
979480499 4:121210819-121210841 CTCCAAATGCAGTCACATTGGGG + Intronic
979545587 4:121936588-121936610 CTCCAAATACTATCACATTAAGG - Intronic
979672086 4:123370750-123370772 CTCCAAATACAGTCATATTGGGG - Intergenic
979704300 4:123703278-123703300 CTCCAAATACAGTCATATTGGGG - Intergenic
979729552 4:124007845-124007867 CTCCAAATATAGTCATATTGTGG - Intergenic
980012985 4:127617304-127617326 CTCCAAATACAGTCACATCCAGG + Intergenic
980440092 4:132831293-132831315 CTCCAAATACAATCATATTGGGG + Intergenic
980531058 4:134055173-134055195 CTCCAAATAAAGTCATATTGAGG - Intergenic
980847445 4:138341117-138341139 CTCCAAATACAGTCAGTCTGAGG + Intergenic
980975207 4:139604572-139604594 CTCCAACTACAGTCACACTAGGG - Intronic
981028757 4:140102622-140102644 CTCCAAATACAGTCACATTGAGG + Intronic
981095138 4:140771532-140771554 CTACAAAAACAGTGAAATGATGG + Intergenic
981286159 4:143021192-143021214 CTCCCAAAACACTGGGATTAAGG - Intergenic
981305888 4:143246791-143246813 CTCCAAATATAGTCACATTAGGG + Intergenic
981362260 4:143860857-143860879 CTCCAAATACAGCCACATCATGG - Intergenic
981372990 4:143981637-143981659 CTCCAAATACAGCCACATCATGG - Intergenic
981382087 4:144084918-144084940 CTCCAAATACAGCCACATCATGG - Intergenic
981498879 4:145425048-145425070 CTCCAAATACAGCCACATTGGGG - Intergenic
981564863 4:146089387-146089409 CTCCAAATACAGTCATGTTGGGG + Intergenic
981788268 4:148505217-148505239 CTCCAAATACAGTCACAATGGGG - Intergenic
982089354 4:151867050-151867072 CTCCAAATACAGTCACTTTCAGG + Intergenic
982381459 4:154753708-154753730 CTCCAAAAGCACTAGGATTATGG + Intergenic
982463774 4:155704837-155704859 CTCCCAAAAAACTGAGATTAAGG + Intronic
982509459 4:156262881-156262903 CTCCATATACAGTCACATTGGGG + Intergenic
982808960 4:159802551-159802573 CTCCAAATACAGTCACACTGGGG - Intergenic
982954963 4:161752760-161752782 CTCCAAATATAGTCACATTGAGG - Intronic
983052531 4:163065518-163065540 CTCCAAATACTGTCACATTGGGG - Intergenic
983126676 4:163961111-163961133 CTCCAAAGATAGTCACATTAGGG + Intronic
983142219 4:164165229-164165251 CTCCAAATATAGTCACATTGGGG - Intronic
983162047 4:164428344-164428366 CTCCAAATACTATCACATTAGGG + Intergenic
983454048 4:167940521-167940543 CACCAAAAACAGTAACATTTTGG + Intergenic
983867931 4:172790296-172790318 CTCCAAGTACAGTCACATTGGGG - Intronic
984437977 4:179727994-179728016 GTCCAAAAATAGTCAGCTAAGGG - Intergenic
984539429 4:181019355-181019377 CTCCAAATACAGTTACTTTAGGG + Intergenic
985130337 4:186732688-186732710 TTCCAAATACAGTCACATTGAGG + Intergenic
985518983 5:362039-362061 CTCCAAATACAGCCAAACTAGGG - Intronic
985771560 5:1815034-1815056 CTCCAAATACAGTCACATCGGGG + Intronic
986274445 5:6261193-6261215 CTCCAAATACAGTCATAGTCTGG + Intergenic
986420209 5:7572905-7572927 CTCCAAATATAGTCCTATTATGG - Intronic
986463108 5:7993441-7993463 CTCCAAATATAGTCATATTAGGG + Intergenic
986647393 5:9930699-9930721 CTCCAAATACAGTCACACTAGGG + Intergenic
986713304 5:10503262-10503284 CTCCAAATACAGTCACATTGGGG + Intergenic
986980107 5:13437584-13437606 CTCCAAATGCAGTCACATTATGG + Intergenic
987107020 5:14649502-14649524 CTCCAAATACAGTCACATTGGGG - Intergenic
987107708 5:14656774-14656796 CTCCAAATATAGTCACATTGGGG + Intergenic
987165442 5:15193548-15193570 CCCCAAATACAGTCACATTGGGG - Intergenic
987449174 5:18060768-18060790 CTCCAAACACACTCAGAGTAGGG - Intergenic
987824397 5:23009859-23009881 CTCCCAAAGCATTGAGATTATGG + Intergenic
987888156 5:23837934-23837956 CTCCAAATACAGTCACATTAGGG - Intergenic
988146808 5:27319732-27319754 CTCCAAAAATGGTAAAATTAGGG + Intergenic
988227944 5:28437795-28437817 CTCCAAATACAGACACATTGTGG + Intergenic
988307067 5:29506138-29506160 CTCCCAATACCGTCAGATTAGGG + Intergenic
988329032 5:29810996-29811018 CTCCAAATACAGACACATTGGGG - Intergenic
988634683 5:32970132-32970154 CTCCAAATACAATCACATTGGGG + Intergenic
988713163 5:33798826-33798848 CTCCAAATATAGTCACATTGGGG + Intronic
988833912 5:35013236-35013258 CTCCAAATACAGTCTTATTCAGG - Intronic
988865920 5:35334916-35334938 TTCCAAAGACAGTAAAATTAAGG + Intergenic
988993669 5:36694342-36694364 CTCCAAATATAGTCACATTGGGG - Intergenic
989232192 5:39099413-39099435 CTCCAAATACCATCACATTAAGG - Intergenic
989439751 5:41456620-41456642 CTCCAAATACCCTCACATTAGGG - Intronic
989724350 5:44570339-44570361 CTCCAAATACAGTCATATGGGGG + Intergenic
989756238 5:44958954-44958976 CTCCAAATGCAGTCATATTGAGG - Intergenic
990167252 5:53008396-53008418 CTCCAAATACAATCACATTGAGG + Intronic
990320054 5:54620967-54620989 CTCCAAATCCATTCACATTAGGG + Intergenic
990433790 5:55766821-55766843 TTCCAAAAAAAGTCACATTTGGG - Intronic
990649556 5:57882901-57882923 CTCCAAAAATCATCATATTAGGG - Intergenic
990849250 5:60182965-60182987 CTCCAAAAACCATCACATTGGGG - Intronic
991042046 5:62186314-62186336 CACAAAAAACATTCAGAATAAGG + Intergenic
991566491 5:68010362-68010384 CTCCAAATACAGTCACGTTGGGG + Intergenic
991636687 5:68713006-68713028 CTCCAAATACAGTCACATTCTGG + Intergenic
992093768 5:73341634-73341656 CTCCAAATACAGTCACAGTGTGG + Intergenic
992110595 5:73488930-73488952 CTCCTAATACAGTCACATTGAGG + Intergenic
992200227 5:74376307-74376329 CTCCAAATACAGTCACATTGGGG - Intergenic
992955660 5:81905797-81905819 CTCCCAAAGCACTGAGATTACGG - Intergenic
993154091 5:84199633-84199655 TTTTAAAAACAGTCATATTAAGG + Intronic
993239995 5:85370129-85370151 CTCCAACTACAGTCATATTGGGG - Intergenic
993390039 5:87308568-87308590 TACCAAGAACAGTGAGATTATGG - Intronic
993631392 5:90290141-90290163 CTCCAAACACAGTCACATTAGGG + Intergenic
995209029 5:109515788-109515810 CTCCAAATATAGTCATATTGGGG + Intergenic
995322446 5:110851782-110851804 CACCAAATACAGTCATATTGGGG - Intergenic
996058640 5:119008313-119008335 CTCCAAACACCGTCACATTAGGG + Intergenic
996081206 5:119260306-119260328 CTCCAAATACAGTCACAGTGGGG - Intergenic
996219305 5:120910121-120910143 CTCCAAATACAGTCACATTGTGG + Intergenic
996446417 5:123557817-123557839 CTCCAAAAAGACTAAGAATATGG - Intronic
996488103 5:124060084-124060106 CCCCAAATACAGTCACATTGGGG + Intergenic
996523663 5:124453946-124453968 CTCCAAATATAGTCACATTGGGG + Intergenic
997230693 5:132240168-132240190 CTCCAAATGCAGTCACATTTAGG - Intronic
997628650 5:135349350-135349372 CTCCAAAGTCAGGCAGCTTAAGG - Intronic
997666452 5:135633330-135633352 CTCCAAATACAGTTACATTTGGG - Intergenic
997786972 5:136722465-136722487 CTCCAAATACAGTCACACTAGGG + Intergenic
997806877 5:136926948-136926970 CTCCAAATACAGTCATATTGGGG - Intergenic
998555913 5:143123592-143123614 CTCCCAAAACACTGGGATTACGG - Intronic
998638541 5:143983994-143984016 CTCCAAAGACAGTCACACTGGGG + Intergenic
998700753 5:144696840-144696862 CTCCTAAAACAGTTACATTGGGG - Intergenic
999019834 5:148153175-148153197 CTCCAAATACAGTCACATTAGGG + Intergenic
999130104 5:149275899-149275921 CTCCAAATACAGTCACACTTGGG + Intronic
999469473 5:151839592-151839614 CTCCAAATACAGTCATAATGGGG - Intronic
999640042 5:153663191-153663213 CTCCAAGAAAAGTAAGATTCTGG + Intronic
999840360 5:155418496-155418518 CTCCAAATACAGTCACATTAAGG + Intergenic
999878072 5:155830437-155830459 CTCCAAATGCAGTCATTTTATGG + Intergenic
999902566 5:156100939-156100961 CTCCAAATACCATCATATTAGGG - Intronic
1000053458 5:157581798-157581820 CTCCAAATCCAGTCACATTGGGG + Intergenic
1000097565 5:157985214-157985236 CTCCAAATACAGTCACATTGGGG - Intergenic
1000261973 5:159596860-159596882 CTCAAAAATCAGTTAGATTCAGG + Intergenic
1000662732 5:163956252-163956274 CTCCAAATAGAGTCATATTGGGG - Intergenic
1000683511 5:164218068-164218090 TTCCAAAGACAGTCATATTCTGG - Intergenic
1001821258 5:174712211-174712233 CTCCCAAAGCGGTGAGATTACGG + Intergenic
1001833583 5:174810652-174810674 CTCCAAACACAGTCACATTAGGG + Intergenic
1001864770 5:175093887-175093909 CTCCAAACACAGTCACGTTGGGG + Intergenic
1002458264 5:179358451-179358473 CTCCAGATACAGTCCCATTAGGG - Intergenic
1002583311 5:180223968-180223990 CTCCAAATACAGTCACATTGAGG + Intergenic
1002833312 6:843795-843817 CTCCAAATACAGTCACATTAGGG + Intergenic
1003265597 6:4562627-4562649 CTGCAAATACAGTCACATTCTGG - Intergenic
1003428560 6:6017544-6017566 CTCCAAATACTATCACATTAGGG - Intergenic
1003617543 6:7669246-7669268 CTCCAAACACAGTCACATTGCGG + Intergenic
1003674947 6:8194421-8194443 CTCCAAAATCAGCCAGCTTCTGG - Intergenic
1003875769 6:10434914-10434936 CTCCAAATATAGTCACATTGAGG + Intergenic
1004038623 6:11951191-11951213 CTCCAAATACAGTCACACTGGGG + Intergenic
1004158292 6:13190419-13190441 CTCCAAATACAGTCACATTGGGG + Intronic
1004300640 6:14454269-14454291 CTCCAAATATAGTCATATTGGGG + Intergenic
1004323512 6:14652230-14652252 CTCCAAATAAAGTTAGATTCAGG - Intergenic
1004368639 6:15033392-15033414 CTCCAAACACAGCCACATTGAGG + Intergenic
1004604266 6:17179104-17179126 CTCCAAATATAGTCACATTGAGG - Intergenic
1004761563 6:18672300-18672322 CTCCAAACACAGTCACATTGGGG + Intergenic
1004981404 6:21028651-21028673 CTCCAAATACAGTCACACTGGGG + Intronic
1005106819 6:22232753-22232775 CTCCAAATACGGTCACATTGAGG - Intergenic
1005179232 6:23084734-23084756 CTCCGAACACAGTCACATTGGGG + Intergenic
1005736005 6:28747086-28747108 CTCCAAACACAGACAGACAAAGG - Intergenic
1006345609 6:33479389-33479411 CTCTAAAATCAGTCACATTGAGG + Intergenic
1007859433 6:44892187-44892209 CTCCAAATATAGTCACATTGGGG - Intronic
1007964113 6:45987852-45987874 CTCCAGATACAGTCACATTGAGG + Intronic
1008166050 6:48139680-48139702 CTCCAAATACAATCACATTAGGG + Intergenic
1008529079 6:52437828-52437850 CTCCAAATATAGTCACATTGAGG + Intronic
1008779574 6:55086698-55086720 CTCCAAATACAGTCACATTAGGG - Intergenic
1009381529 6:63036406-63036428 CTCCAAATATAGTCACATTGGGG + Intergenic
1009496845 6:64359823-64359845 TTCCAAATACAGTCACATTGGGG + Intronic
1009584421 6:65579756-65579778 CTCCAAATATAGTCACACTAAGG + Intronic
1009630301 6:66190276-66190298 CACAAAATACAGTCATATTAAGG + Intergenic
1009729031 6:67575150-67575172 CTCCAAATACAGTCACATTGGGG + Intergenic
1010862154 6:80926284-80926306 CTCCAAATGCAGTCATATTAGGG - Intergenic
1010870719 6:81034842-81034864 CTCCAAATACGGTCACATTAAGG - Intergenic
1011080811 6:83488831-83488853 CTACAAATACAGTTAGATTGTGG + Intergenic
1011138423 6:84125504-84125526 CTCCACATACAGTCACATTAAGG - Intronic
1011324977 6:86140663-86140685 CTCCAAATGCAGTCATATTGGGG + Intergenic
1011388006 6:86818401-86818423 CTCCAAATACAGTTACATTGGGG + Intergenic
1011995128 6:93577099-93577121 ATCCAAAGACAGTCAGCTGAAGG - Intergenic
1012039553 6:94186510-94186532 CTCCAAAATCACTCAGCTAAAGG - Intergenic
1012059210 6:94456142-94456164 CTCCAAATACAGCCAAATTGGGG - Intergenic
1012071949 6:94632905-94632927 CTCCAAGAACAGGGAGGTTAGGG - Intergenic
1012160975 6:95885799-95885821 CTCCAAATACAGCCACATTGGGG + Intergenic
1012236859 6:96828370-96828392 CTCCAAATATAGTCATATTGGGG + Intronic
1012457523 6:99424014-99424036 CTCCAAATACAGTCACGTTCTGG + Intronic
1012599700 6:101079880-101079902 CTGCATAAACAGTCAGATGAGGG - Intergenic
1012617137 6:101291130-101291152 CTCCAAATACAGTCACATTCTGG - Intergenic
1012695780 6:102381650-102381672 CTCCAAACACAGTCACACTGGGG - Intergenic
1012768568 6:103399968-103399990 CTCTAAATACAGTCACATTATGG - Intergenic
1013552005 6:111217094-111217116 CTCCAATAGCAGTCAGGCTAGGG - Intronic
1013607653 6:111765255-111765277 CTCCAAATACAGTTACATTGGGG - Intronic
1013655155 6:112238969-112238991 CTCCAAATACAGTCACATTAGGG - Intronic
1014060284 6:117063897-117063919 CTTCAAATACAGTCACATTGTGG - Intergenic
1014121846 6:117734935-117734957 CTCCAAATACAGTCACATTTGGG + Intergenic
1014253325 6:119137508-119137530 TTCCAAATACAGTCACATTGGGG + Intronic
1014273930 6:119365551-119365573 CTCCAAATACAGTCACATGGAGG + Intergenic
1014356277 6:120414255-120414277 CTCCAAATACAGTCACATTGCGG + Intergenic
1014823813 6:126024627-126024649 CTTCAAATACAGTCATATTGAGG + Intronic
1014994919 6:128130797-128130819 CTCTGAAAACAGACACATTAAGG + Intronic
1015022274 6:128490992-128491014 CTCCAAATACAATCACATTGGGG + Intronic
1015793249 6:136985463-136985485 CTCCAAATACAGTCACATTAAGG - Intergenic
1016150872 6:140741152-140741174 CCCCAAACACAATCACATTAGGG + Intergenic
1016301323 6:142635072-142635094 CTCCAAATACAGTCACATTGTGG + Intergenic
1016431964 6:143994741-143994763 CTCCAAATACAGTCACATTAGGG - Intronic
1017064510 6:150517115-150517137 CTCCAAATATAGTCAGATTGGGG - Intergenic
1017084924 6:150705015-150705037 CTCCAAATACAGTCACTTTGGGG + Intronic
1017328944 6:153173113-153173135 CTCCAAGCACAGTCAGGTAATGG + Intergenic
1017343043 6:153348303-153348325 CTCCAAATACACTCACATTGGGG - Intergenic
1017436149 6:154417609-154417631 CTCCTAATACAGTCACATTCTGG - Intronic
1017864842 6:158434181-158434203 CTCCAAAAATAGTCACATTTGGG + Intronic
1018040578 6:159918342-159918364 CTCCAAATACCGTCACATGAAGG - Intergenic
1019231793 6:170572064-170572086 CACCATACCCAGTCAGATTAAGG - Intronic
1020876406 7:13700165-13700187 CTTCAAATACAGTCACATTGAGG + Intergenic
1021650859 7:22831644-22831666 CTCCAAATACTGTCACATTGGGG - Intergenic
1022062334 7:26810076-26810098 CTTCCAAAACACTGAGATTACGG - Intronic
1022866311 7:34425244-34425266 CTCCAAATACAGTCACATTCTGG + Intergenic
1022907098 7:34867998-34868020 CCCCAAAAACAATGACATTAGGG + Intronic
1024027438 7:45424621-45424643 CTCCAAATACAGTGAGACTGGGG + Intergenic
1024210266 7:47197323-47197345 CTCCAAATATAGTTATATTAGGG - Intergenic
1024441340 7:49421896-49421918 CTCCAAATACAGTCATCTTGAGG - Intergenic
1024582201 7:50809329-50809351 CTTCAAATACAGTCACATTGGGG + Intergenic
1025105210 7:56165263-56165285 CTCCAAAAGCACTGGGATTATGG - Intergenic
1026742219 7:72985980-72986002 CTCCCAAAGTACTCAGATTACGG + Intergenic
1027028342 7:74870719-74870741 CTCCCAAAGCACTCAGATTATGG + Intergenic
1027101516 7:75379098-75379120 CTCCCAAAGTACTCAGATTACGG - Intergenic
1027296682 7:76780759-76780781 CTCCAAATACAGTCCCATTGAGG - Intergenic
1027515653 7:79138605-79138627 CTCCAAGACCAGTCACATTGGGG - Intronic
1027673849 7:81134698-81134720 CTCCAAATACAGTCACAGTGGGG + Intergenic
1028010181 7:85632901-85632923 CTCCAAATAAAGTCACATTTTGG - Intergenic
1028202321 7:87976271-87976293 CTCCAAACACAGTCATGTTGGGG - Intronic
1028340459 7:89712975-89712997 CTCCAAACACAGTCAAGTTCTGG - Intergenic
1028403912 7:90455986-90456008 CTCCAAATATAGCCACATTAGGG - Intronic
1028892284 7:96001803-96001825 TTCCAAATACAGTCACATTGAGG + Intronic
1028978049 7:96935928-96935950 CTCCAAATACAGTCACATTTGGG - Intergenic
1029007423 7:97225409-97225431 CTCCAAAGACAGTCACACTGGGG + Intergenic
1029181868 7:98708007-98708029 AGCCAAACACAGTCACATTAGGG + Intergenic
1029955483 7:104634467-104634489 CTCCAAATACAGTCACATTAGGG + Intronic
1029982937 7:104896147-104896169 CTCCAAATACAGTCGTATTGGGG + Intronic
1029989751 7:104952400-104952422 TTCCAAATACAGTCACATTGGGG + Intergenic
1030061426 7:105624349-105624371 CTCAGAAAACAGCCTGATTAAGG + Intronic
1030177204 7:106666947-106666969 CTCCAAATACAGTCACACTGGGG - Intergenic
1030188150 7:106784178-106784200 TTCCAAATATAGTCACATTAAGG - Intergenic
1030452750 7:109733137-109733159 TTCCAAATATAGTCACATTAAGG - Intergenic
1030561634 7:111094138-111094160 CCCCAAAAAAATTCAGATTCGGG - Intronic
1030635532 7:111944081-111944103 CTCTAAAAACAGGCATTTTATGG - Intronic
1030938499 7:115616175-115616197 CTTCAAATACAGTCACATTGGGG - Intergenic
1031062019 7:117062253-117062275 CTCCAAATACCATCACATTAGGG + Intronic
1031130099 7:117823580-117823602 CTCCACAAACATTCAGAGTCAGG + Intronic
1031196720 7:118624361-118624383 CTCCTTATACAGTCAAATTATGG + Intergenic
1031199666 7:118664378-118664400 CTCCAAATACAGTCATGTTGCGG + Intergenic
1031576823 7:123424423-123424445 CTCCAAATATAGTCATATTAGGG + Intergenic
1031814156 7:126411767-126411789 TTCCAAAAATATTCAGATTAGGG - Intergenic
1032039271 7:128545152-128545174 CTCCCAAAATAGTGAAATTATGG - Intergenic
1032244371 7:130196564-130196586 CTTCAAAAACAGCCACATTGGGG - Intronic
1032892019 7:136207185-136207207 CCCCAAAAACATAGAGATTATGG - Intergenic
1033138058 7:138801090-138801112 CTCCAAATACAATCACATTGGGG + Intronic
1033310978 7:140261570-140261592 CTCCAAATACAGTCACATCGGGG - Intergenic
1033848796 7:145469248-145469270 CTCCAAATACTGTCACATTGCGG - Intergenic
1034288518 7:149907987-149908009 CTCCAAATACAGTCACATTGAGG - Intergenic
1034662555 7:152784880-152784902 CTCCAAATACAGTCACATTGAGG + Intronic
1034686383 7:152974912-152974934 CAGCAAAAACAGTTAGATTTAGG + Intergenic
1034992160 7:155554801-155554823 CTTCACACACAGTCACATTAGGG + Intergenic
1035003721 7:155639031-155639053 CTCCAAATACTGTCACATTTGGG + Intronic
1035116902 7:156532453-156532475 CTCCAAACACAGTCACATTGGGG + Intergenic
1035298730 7:157883060-157883082 CTCCAACAACAGTCATTTTGAGG - Intronic
1035522983 8:290372-290394 TTCCAAAGACAGCCACATTAAGG - Intergenic
1035825435 8:2639809-2639831 CTCCAAAACCAGTCAGACTGGGG - Intergenic
1036081036 8:5555620-5555642 CTCCAAATACAGCCACATTGCGG + Intergenic
1036190662 8:6667074-6667096 CTCCACATACAGTCACACTAGGG + Intergenic
1036584395 8:10109860-10109882 GTCCAAAACCAGTCTGAATATGG + Intronic
1036792214 8:11728669-11728691 CTCCAAAAATGGTGAGATTATGG + Intronic
1036828040 8:11994315-11994337 CTCTAAAGACAGTCACATCAGGG - Intronic
1037021299 8:13974907-13974929 CTCTAAATACAGTCACATTGGGG - Intergenic
1037602262 8:20407062-20407084 CTTCAAATACAGTCACATCAGGG - Intergenic
1037607619 8:20450646-20450668 CTCCAAACACCATCACATTAAGG - Intergenic
1037611766 8:20481846-20481868 CTCCAAATACAGTCACAATGGGG - Intergenic
1037660831 8:20925423-20925445 CTCCAAATACAGTCATATTTTGG + Intergenic
1037677547 8:21064764-21064786 CTCCAAATAGAGTCAGACTGGGG - Intergenic
1037737642 8:21580214-21580236 CTCTAAATACAGTCACATTGGGG - Intergenic
1037865149 8:22437422-22437444 CTCAAGAAACAGGCAGAGTACGG + Intergenic
1038485621 8:27933026-27933048 CTCCAAATACAGTCACATTGGGG + Intronic
1038529294 8:28304662-28304684 CTCCAAACACAGTCACACTAGGG + Intergenic
1038546230 8:28427598-28427620 CTCCAAATACAGTCACATTCTGG - Intronic
1038714316 8:29978279-29978301 CTTCAAAAACATTCAGAGAATGG + Intergenic
1039460925 8:37743539-37743561 CTCCAAATACAGTCACATTGGGG + Intronic
1039631695 8:39119818-39119840 CTCCAAATATAGTCACATTAGGG - Intronic
1039858155 8:41434293-41434315 CTCTAAAAACAATCATATTTTGG + Intergenic
1039932240 8:42003713-42003735 CTCCAAATAGAGTCACATTGAGG - Intronic
1041324534 8:56650889-56650911 CTCCAAATACCATCATATTAGGG + Intergenic
1041522271 8:58769648-58769670 CTCCAAATACAGTCACACTGGGG + Intergenic
1041567070 8:59290681-59290703 CTCCAAATACAGTCACATTGGGG + Intergenic
1041627264 8:60044795-60044817 CTCCAAATACAGTCACACTGGGG - Intergenic
1042455840 8:69001617-69001639 TCCCAAATACAGTCACATTAGGG + Intergenic
1042579889 8:70265115-70265137 CTCCAAATACTATCACATTAGGG - Intronic
1042653105 8:71065212-71065234 CTCCAAATGCAGTCACATTGGGG - Intergenic
1042702038 8:71625900-71625922 CACCAAAAACAGTCACACTGGGG - Intergenic
1043052129 8:75397188-75397210 CTCCAAATACAGTCATGCTAAGG + Intergenic
1043141262 8:76593138-76593160 CTCCAAATACAGTCATATTGGGG + Intergenic
1043197511 8:77316293-77316315 CTCCAAATATAGTCACATTCAGG - Intergenic
1043356943 8:79424886-79424908 TTCCAAATACAGTCACATTGGGG - Intergenic
1043984597 8:86679398-86679420 CTCCAAATTCAGTCACATTAGGG - Intronic
1044079561 8:87867031-87867053 TTCCAAATACAGTCACATTGGGG - Intergenic
1044547591 8:93476905-93476927 CTCCAACTACAGTCACATTAGGG - Intergenic
1044642357 8:94396761-94396783 CTCCAAAAACAGTCACATTGGGG - Intronic
1044740401 8:95320863-95320885 CTCCAAATATAGTCACATTGGGG - Intergenic
1044771987 8:95645752-95645774 TTCCAAATACAGTCACATTGGGG + Intergenic
1044790721 8:95844264-95844286 CTCCAAATACAGTCACATTCTGG + Intergenic
1045498076 8:102725295-102725317 CTCCAAATACAATCACATTGGGG + Intergenic
1045680357 8:104653127-104653149 CTCCAAATACCATCACATTAGGG + Intronic
1045793868 8:106020104-106020126 CTCCAAATACAGTCATATTGGGG - Intergenic
1046120680 8:109842555-109842577 CTCCAAATTCAGTCACACTAGGG - Intergenic
1046304692 8:112349908-112349930 CTCCAAATACAGTCACATTAGGG - Intronic
1046495065 8:115003392-115003414 CTGCAGAATCTGTCAGATTATGG - Intergenic
1046615940 8:116477420-116477442 CTCCAAATACAGTCACACTGGGG - Intergenic
1047184997 8:122624837-122624859 CTCCAAATACAATCACATTAGGG + Intergenic
1047574753 8:126140548-126140570 CTCCAAATACAGTCACATTGAGG + Intergenic
1047850157 8:128848392-128848414 CTCCAAATATAGTCTCATTAAGG - Intergenic
1048027372 8:130599042-130599064 CTCCAAATACAGTCACATTCTGG - Intergenic
1048117750 8:131544474-131544496 CTCTAAACACAGTCACATTGGGG - Intergenic
1048128816 8:131668868-131668890 CTCCAAATACAGTCATACTGGGG + Intergenic
1048335952 8:133502325-133502347 CTCCAAATACAGTCATCTTGAGG - Intronic
1048382621 8:133880718-133880740 CTCCTAATACCATCAGATTAAGG - Intergenic
1048577327 8:135703321-135703343 CTCCAAATACAGTCACATTGAGG - Intergenic
1048823729 8:138402849-138402871 CTCCAAAAACCATCACATCAGGG - Intronic
1049158190 8:141080033-141080055 CTCCAAATACAGTCACTTTGGGG - Intergenic
1050032874 9:1404856-1404878 CTCCATATACAGTCATATTCTGG + Intergenic
1050114047 9:2244753-2244775 CTCCAAATACAGTCACATTAGGG - Intergenic
1050385751 9:5088886-5088908 CTCCAAATACAGTCATATTGGGG + Intronic
1050511090 9:6396616-6396638 CTCCAAATATAGTCACATTGAGG - Intergenic
1051007795 9:12368860-12368882 GACCAAAAACAGTCAGAGAAGGG + Intergenic
1051109173 9:13616063-13616085 CTCTAAAAACAGTCACATTTGGG - Intergenic
1051288148 9:15517220-15517242 CTCCCAAAACTGTAGGATTATGG + Intergenic
1051496664 9:17731277-17731299 CTCCAAATACCATCACATTAGGG - Intronic
1051788404 9:20771985-20772007 CTCCAAATACAGTCACTTGAGGG + Intronic
1052295838 9:26895264-26895286 CTCCAAATTCAGTCACATTGGGG - Intergenic
1052644374 9:31214096-31214118 CTCCAAAGACAGTCACATTGAGG + Intergenic
1052649531 9:31283578-31283600 CTCCAAATACAGTCACATTAAGG - Intergenic
1052675488 9:31617124-31617146 CTCTAAATACAGTCACATTGGGG - Intergenic
1052783501 9:32805725-32805747 CTCTAAATACAGTCACATTGGGG - Intergenic
1052871527 9:33511933-33511955 CTCCAAACACACTTAGAATAGGG + Intergenic
1052891933 9:33709510-33709532 CTCCAAATATAGTCACATTATGG - Intergenic
1053449248 9:38179629-38179651 CTCCAAATACAGTCACATTCTGG + Intergenic
1055183275 9:73417050-73417072 CTCCCAAAACAGTCACATGGTGG - Intergenic
1055361905 9:75500574-75500596 CTCCAAATGCAGTCACATTTGGG + Intergenic
1056184537 9:84120728-84120750 TTCCAAATACAGTCACATTGGGG + Intergenic
1056277925 9:85011415-85011437 CTCCAAATAGAGTCATACTAAGG - Intronic
1056604965 9:88077988-88078010 CTCCAAATGCAGTCACACTAGGG + Intergenic
1056744749 9:89290672-89290694 CTCCAAACACAGTCACATTGGGG + Intergenic
1057159091 9:92873031-92873053 CTCCAAATACAGTTACATTAGGG - Intronic
1057334381 9:94144297-94144319 CTGCAAAAACAGGCAGACAAGGG - Intergenic
1057464864 9:95303753-95303775 CTCCAAATACAGTCCCATTGGGG + Intronic
1057589646 9:96361290-96361312 CTCCAAATACAGTCACATTGGGG - Intronic
1057686077 9:97236021-97236043 CTCCAAACACACTTAGAATAGGG - Intergenic
1058383263 9:104403325-104403347 CTCCAAATACAGCCACATTAGGG + Intergenic
1058652845 9:107193254-107193276 CTCCAAATACAGTCACATCGTGG - Intergenic
1059461984 9:114437516-114437538 CTTCAAATACAATCAGATTCAGG - Intronic
1059496975 9:114718015-114718037 CTCCAAATACAGTCACCTTGGGG - Intergenic
1059753953 9:117274893-117274915 CTCCTAATACAGTCACGTTAGGG + Intronic
1059754065 9:117275929-117275951 CTCCTAATACAGTCACATTAGGG + Intronic
1060345054 9:122808656-122808678 CTCCAAATACAGTCACTTTGGGG + Intronic
1062147885 9:135000173-135000195 CTCCAAATCCAGTCAGATAATGG + Intergenic
1185887494 X:3796048-3796070 CTCCAAATACAGCCACATTAGGG + Intergenic
1185952878 X:4455841-4455863 CTCCAAACACAGTCACATTCTGG + Intergenic
1186148874 X:6653403-6653425 CTCCAAATACAGTCTCATTGGGG - Intergenic
1186155326 X:6719364-6719386 CTCCAAATACAGTCACATTGCGG + Intergenic
1186187821 X:7039421-7039443 CTCCAAATACAATCACATTCCGG - Intergenic
1186188629 X:7046179-7046201 CTCCAAATACAGACACATTACGG - Intergenic
1186305190 X:8248893-8248915 CTCCAAAAAACGTGAGATTCTGG - Intergenic
1186685556 X:11921435-11921457 CTCCAAATACAATCACATTGGGG + Intergenic
1187223410 X:17352842-17352864 CTCCAAATACAATCACATTGGGG - Intergenic
1187306146 X:18097020-18097042 CTCCAAATGCAGTCACATTCGGG + Intergenic
1187495932 X:19795667-19795689 CTCCAAAAAGAGTCTGCCTATGG + Intronic
1187581918 X:20616315-20616337 CTCCACATACAGTCACATTGGGG + Intergenic
1187582326 X:20621289-20621311 CTCCAAATACAGTCACATTGGGG + Intergenic
1188189124 X:27152507-27152529 CTCCAAATACAGTCACACTGAGG + Intergenic
1188287004 X:28339343-28339365 CTCCAAATACAGTCACATTGGGG + Intergenic
1188481208 X:30638681-30638703 CTCCTAATACAGTCAGGCTACGG + Intergenic
1189343684 X:40223860-40223882 CTCCAAATGCAGTCACATTGGGG + Intergenic
1189420188 X:40850494-40850516 CTCCAAATACAGTCACATTGAGG + Intergenic
1189545868 X:42042182-42042204 CTCCAGATACAGTCACATTGGGG + Intergenic
1189629953 X:42942442-42942464 CTCCAAATATAGTCACATTGGGG - Intergenic
1189867188 X:45343179-45343201 CTTGAAAAAAAGTCAGAGTATGG + Intergenic
1190033985 X:47003384-47003406 CTCCAAATACAGTCACATTGGGG + Intronic
1190034749 X:47011101-47011123 CTCCAAATAAAGTCACATCATGG + Intronic
1190217569 X:48490164-48490186 CTCCAAATACAGTCACATTGAGG - Intergenic
1190372502 X:49756393-49756415 CTCCAAATACAGTCGTATTGGGG + Intergenic
1190857992 X:54316161-54316183 CTCCAAATACAGTCACATTGGGG - Intronic
1191168955 X:57421655-57421677 CTCTAGATACAGTCACATTAAGG + Intronic
1191752320 X:64556293-64556315 CTCCAAATACAGTCAGATTGGGG - Intergenic
1192251211 X:69415374-69415396 CTCCAAATACAGTCACATTGGGG + Intergenic
1192594173 X:72388694-72388716 CTCCAAATGCAGCCACATTAGGG - Intronic
1192622266 X:72690379-72690401 CTCCAAATATAGTCATATTAGGG - Intronic
1192632030 X:72784625-72784647 CTCCAGATACAGTCCCATTAGGG - Intronic
1192649679 X:72936176-72936198 CTCCAGATACAGTCCCATTAGGG + Intronic
1193238186 X:79134164-79134186 CTCCAAATACAGTCACATTGAGG + Intergenic
1193368470 X:80663477-80663499 CTTCAAACACAGTCATATTGGGG - Intergenic
1193781083 X:85701977-85701999 CTTCAAATACAGTCACATTGGGG - Intergenic
1194197895 X:90918121-90918143 CTCCAAATACACTCATATTGTGG + Intergenic
1194454792 X:94089526-94089548 CTCCAAATACCATCACATTAGGG + Intergenic
1194594997 X:95847047-95847069 CTCCAAATACAGTCACATTGGGG + Intergenic
1194602992 X:95946622-95946644 CTCCAAATGCAGTCACATTAGGG - Intergenic
1194649252 X:96496390-96496412 CTCCAAATACAGTCACATGGGGG - Intergenic
1194819406 X:98487717-98487739 CTCCAAATACAGTCACATTGGGG + Intergenic
1194868347 X:99097248-99097270 CTCCAAAGACAATCACATTAGGG + Intergenic
1195091959 X:101469045-101469067 CTGCAAAATCAGTAAGATAAAGG + Intronic
1195326282 X:103761241-103761263 ATCCGAAAAGAGTCAGATAAGGG + Intergenic
1195536967 X:106020020-106020042 CTCCAAATACAGTCACTTTGGGG - Intergenic
1195765012 X:108286827-108286849 CTCCCAAAACACTGGGATTAAGG + Intronic
1196215012 X:113040057-113040079 CTCCAAATACTGTCACATTGGGG - Intergenic
1196871806 X:120119749-120119771 CTCCAACAAAAGTCAGATTTTGG + Intergenic
1197103016 X:122678773-122678795 CTCAAAATACAGTCACATTGGGG + Intergenic
1197387219 X:125816240-125816262 CTCCAAATACAATCACATTGGGG - Intergenic
1197546552 X:127832331-127832353 CTCCAAATACCATCACATTAGGG - Intergenic
1197589770 X:128394073-128394095 CTCTAAATATAGTCATATTATGG - Intergenic
1197895291 X:131306634-131306656 CTCAAAATACAGTCACATTGGGG - Intronic
1198062046 X:133055920-133055942 CTCCAAATACAGTCGTATTGGGG + Intronic
1198078840 X:133219577-133219599 CTCCAGATACAGTCAAATTGGGG + Intergenic
1198420670 X:136468485-136468507 CTCCAAATATAGTCACATTAGGG - Intergenic
1198586793 X:138130600-138130622 CTCCAAATACAGTCACATTATGG - Intergenic
1198640247 X:138748274-138748296 CTTCAAATACAGTCACATTGGGG - Intronic
1198935739 X:141901508-141901530 CTTCAAATACAGTCACATTCTGG + Intergenic
1198960800 X:142180956-142180978 CTTCAAATACAGTCACATTCTGG - Intergenic
1199180312 X:144846828-144846850 CTCCAAATACTATCACATTAGGG - Intergenic
1199181894 X:144867077-144867099 CTCCAAATACCCTCATATTAGGG - Intergenic
1199276611 X:145951248-145951270 CTCCAAAAACCATCAAATTGGGG - Intergenic
1199688552 X:150287429-150287451 CTCCAAATACAGCCAAATTTGGG - Intergenic
1199695097 X:150338327-150338349 CTCCAAATACAATCACATTGGGG + Intergenic
1200543843 Y:4494701-4494723 CTCCAAATACACTCATATTGTGG - Intergenic
1200774857 Y:7161037-7161059 CTCCAAATACAGCCACATTAGGG - Intergenic
1200833944 Y:7714435-7714457 CTCCAAATATAGTCACATTGGGG - Intergenic
1201598009 Y:15693897-15693919 CTCCAAATAAAGTCACAATATGG - Intergenic