ID: 1106968051

View in Genome Browser
Species Human (GRCh38)
Location 13:35097189-35097211
Sequence CTAGCTCTTCCAGTTTCAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 3, 1: 0, 2: 1, 3: 7, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106968051_1106968052 16 Left 1106968051 13:35097189-35097211 CCTATTGAAACTGGAAGAGCTAG 0: 3
1: 0
2: 1
3: 7
4: 132
Right 1106968052 13:35097228-35097250 GAATAACTTCAGATTCCTTTTGG 0: 3
1: 0
2: 1
3: 24
4: 284
1106968051_1106968053 17 Left 1106968051 13:35097189-35097211 CCTATTGAAACTGGAAGAGCTAG 0: 3
1: 0
2: 1
3: 7
4: 132
Right 1106968053 13:35097229-35097251 AATAACTTCAGATTCCTTTTGGG 0: 1
1: 2
2: 4
3: 29
4: 347

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106968051 Original CRISPR CTAGCTCTTCCAGTTTCAAT AGG (reversed) Intronic
903402572 1:23066521-23066543 AAAGCTCTTCCAGTGTCAACTGG - Intronic
906120994 1:43390293-43390315 CTTTCTGTTGCAGTTTCAATGGG + Intronic
906550062 1:46657672-46657694 CTAGCTCTGCCACTATCTATAGG - Intronic
907792086 1:57676820-57676842 CTAGTTCTTGCAGGTTGAATAGG - Intronic
910422600 1:87082825-87082847 TTGGCTCTTTCAGTTTCAGTGGG + Intronic
913670315 1:121092255-121092277 TAAGATCTTCCAGTTTCCATGGG + Intronic
914022082 1:143879696-143879718 TAAGATCTTCCAGTTTCCATGGG + Intergenic
914660567 1:149787625-149787647 TAAGATCTTCCAGTTTCCATGGG + Intronic
917256635 1:173123203-173123225 CTATCTCTGCCAGTTTCTCTAGG + Intergenic
923506994 1:234612480-234612502 ATAGCCCTTCCATTTTCCATCGG - Intergenic
923836297 1:237614810-237614832 CTGGCTCTGGCAGTTTCATTTGG - Exonic
924624903 1:245689402-245689424 CTCGCCATTCCACTTTCAATGGG - Intronic
1064246823 10:13674877-13674899 CTAGCTCATCCCGTTGAAATTGG - Intronic
1065081691 10:22135805-22135827 AAAGCTCTTCAAGTTTCACTTGG + Intergenic
1068873437 10:61970669-61970691 TTAGGTCTTCCAGTTTGAAAAGG + Intronic
1070461091 10:76671324-76671346 CTAGCTCTGCCATTCTCAATAGG - Intergenic
1071746030 10:88420501-88420523 ATAGCTCTTCTAGTTTCAGATGG + Intronic
1072788458 10:98300744-98300766 CTCACTCTTCCCTTTTCAATAGG + Intergenic
1085622593 11:78048708-78048730 CTCCCTCTTCCAGTTACATTGGG - Intronic
1087669314 11:101086558-101086580 CTAGCACTTCCAGTGTTAACAGG - Intronic
1089843797 11:121442312-121442334 CTAGCTCTTCCTGTGTCCTTGGG - Intergenic
1091265200 11:134265139-134265161 CCAGCTCTTCCGGTTCCACTGGG - Exonic
1091325256 11:134682124-134682146 ATAGCTCTTTCTGTTTCATTGGG - Intergenic
1091584494 12:1808333-1808355 CTGGCTTTTCCATTTTCAAGTGG + Intronic
1096277990 12:50227157-50227179 CTAGCACTTCCAGGTAGAATTGG - Intronic
1096908156 12:54955370-54955392 CTGTCTCTTCCAGTCTCAATGGG + Intronic
1098731661 12:74043210-74043232 CTAGATCTTTAAGTTTTAATAGG + Intergenic
1103403553 12:120659373-120659395 CCTGCTCTTCCTGTTTCATTGGG + Intronic
1104493654 12:129216535-129216557 CTACCTCTTCCAGCTTCTGTGGG - Intronic
1104674038 12:130700620-130700642 CTGCCTCTTCCAGTTTCCAGTGG - Intronic
1106968051 13:35097189-35097211 CTAGCTCTTCCAGTTTCAATAGG - Intronic
1108808151 13:54185779-54185801 TTAGCTCTTCCAATTGCAGTAGG - Intergenic
1109277720 13:60321330-60321352 CTTCCTCTTTCAGTTTAAATGGG - Intergenic
1109627786 13:64999539-64999561 CAAGTTCTTTCAGTATCAATGGG + Intergenic
1111876790 13:93907332-93907354 TTTTCTCTTCCATTTTCAATGGG + Intronic
1113248871 13:108429099-108429121 CTAGCTTTTCCAGTTTCTTTTGG - Intergenic
1117000713 14:51368408-51368430 CTGGCTCTTCTACTTTAAATGGG - Intergenic
1117241853 14:53841985-53842007 CTATCTTTTCCAGTTTCTCTGGG - Intergenic
1118038943 14:61897026-61897048 ATAGTTCTTACAGTTTCAAGTGG + Intergenic
1121714377 14:96062547-96062569 CCAGCACTGCCTGTTTCAATTGG + Intronic
1122449160 14:101790293-101790315 CTAAATTTTCCAGTTACAATGGG - Intronic
1122727090 14:103763679-103763701 CTAAATTTTCCAGTTACAATGGG - Intronic
1123484864 15:20682292-20682314 CTAGCTCTTCCAGTTTCAATAGG + Intergenic
1123537595 15:21251360-21251382 CTAGCTCTTCCAGTTTCAATAGG + Intergenic
1127886736 15:63207984-63208006 CGAGCACTTCCAGTCTCATTTGG + Intronic
1131724811 15:95209621-95209643 CTCGCTCTTTTAGTTTCACTTGG + Intergenic
1133534857 16:6691954-6691976 CTAACTTTTCCAGCTTCAAAAGG - Intronic
1139704546 16:68732249-68732271 CTAGCAATTCCAGTTTCTCTGGG + Intergenic
1141635602 16:85312395-85312417 CTGCCTCTTCCAGTTCCCATTGG + Intergenic
1143006636 17:3840154-3840176 CAAGCGCTTCCATTTTCGATCGG - Exonic
1143271763 17:5681034-5681056 CTATGTCTTCCTGTTTGAATTGG + Intergenic
1148891104 17:50807796-50807818 CTGGCTCTTCCAGCTTCTATTGG - Intergenic
1149401653 17:56302619-56302641 CTATCTCTTTAAGTTTGAATGGG - Intronic
1151940850 17:77290948-77290970 CTCGACCTCCCAGTTTCAATTGG + Intronic
1155367164 18:25060203-25060225 GTAGCTCCTCAAGTTACAATGGG - Intergenic
1156129432 18:33952578-33952600 CTAGGTCTCTCAGTTTCAAAAGG + Intronic
1156881701 18:42088153-42088175 CCAGCTATTCCAGTTGCAGTGGG - Intergenic
1157839238 18:50940299-50940321 CTAGCTCTTCATCTGTCAATTGG - Exonic
1161656263 19:5517164-5517186 CTGACTCTTCCAGTCTCAAGTGG - Intergenic
1163841859 19:19616267-19616289 CTATTTATTCCAGTTGCAATGGG - Intronic
1163995727 19:21045065-21045087 CTATCTCTTTCAGTTTCACTTGG + Intronic
1164697562 19:30257795-30257817 GCAGCTCCTCCAGTTGCAATGGG - Intronic
926835248 2:17011985-17012007 CTAACTCTTCAAGTCTCAACAGG + Intergenic
931230018 2:60366276-60366298 CTAGCTCTTCCGGTTCTAGTAGG - Intergenic
936869165 2:117111820-117111842 CTAATTGTTCCAGTTTAAATGGG + Intergenic
939953838 2:148508234-148508256 CTACCCATTCCAGTTTCAAGGGG - Intronic
941286004 2:163612855-163612877 CTAACTCTTTCAATTTCTATAGG + Intronic
947246644 2:228055852-228055874 ATTGCTCCTCCAGTTTCATTGGG + Intronic
948392639 2:237624081-237624103 CTTGCTCTTCCAGTTCCCAGAGG - Intergenic
1175244426 20:57573066-57573088 CGAGCTCTTCCAGCTTCCACTGG - Intergenic
1180280643 22:10690573-10690595 TTAGCTCTTCCAGCTTCTGTTGG + Intergenic
1182847209 22:33441413-33441435 CTAGCTCTTCTATATTTAATAGG + Intronic
951245506 3:20336738-20336760 CCAACTCTTCCATTTTCAACTGG - Intergenic
951983989 3:28597692-28597714 CTAGCTTTGCCAGCTTCAACAGG + Intergenic
952521632 3:34165266-34165288 ATAGCTCTTCCAATTTTTATTGG + Intergenic
953098436 3:39802157-39802179 GTACCTCTTCCAATTTCAAGTGG + Intergenic
953254519 3:41277038-41277060 CTAGTTCTTCCTGATTCAAGAGG - Intronic
954763623 3:52895740-52895762 CTAGCTCTGGCTGTTTCCATAGG - Intronic
956244873 3:67171808-67171830 TTATCTCTTCCAGTTTCTGTGGG + Intergenic
956574222 3:70733646-70733668 CAAGCTCTTCCAGTATGGATGGG + Intergenic
957432389 3:80127814-80127836 CTAGCTCTTACATTTTGATTTGG + Intergenic
958580912 3:96021374-96021396 CTGGATCTTCAAGTTGCAATGGG + Intergenic
958887409 3:99741840-99741862 TAAGCTCTCCCAGATTCAATGGG + Intronic
959333269 3:105033798-105033820 CTATCTCCTCAATTTTCAATTGG - Intergenic
960100051 3:113732331-113732353 TTGGCTCTTCCAGCTTCTATAGG - Intronic
964950025 3:162279225-162279247 CTAGCTCTTCTTCTTTCAGTTGG - Intergenic
965142748 3:164861038-164861060 CTAGCTCTTAAAGTTTCTACTGG - Intergenic
966567419 3:181398433-181398455 CTAGCTCTTCCACTGTCTTTAGG - Intergenic
970478805 4:16452144-16452166 CTAATTTTTCCAGTTTTAATAGG + Intergenic
971023014 4:22557428-22557450 CTATATCTTCCTTTTTCAATTGG + Intergenic
971043166 4:22777535-22777557 CTAGCTCCTGCAATTTAAATGGG + Intergenic
975542395 4:75528118-75528140 GTGGCTCTTCCAGTTGAAATAGG + Exonic
977204522 4:94154324-94154346 CTTGGCCTTCCAGTTTCAGTAGG + Intergenic
978036964 4:104007231-104007253 CCAGCTTTTCCGGTTTCACTTGG + Intergenic
978154080 4:105470314-105470336 CTAGGTCTTAAAGTTTTAATGGG - Intronic
978359135 4:107909569-107909591 CTAGCTCTTTAAGTTTCAATGGG - Intronic
978942688 4:114456527-114456549 CTAACTTTTCCAGTTTAAGTAGG - Intergenic
984840035 4:184059949-184059971 CTAGGTCTTCAAGCTTCACTTGG - Intergenic
984961858 4:185105108-185105130 CTTGCTCATCCACTTTCACTTGG + Intergenic
985482959 5:128870-128892 CTCGTTCTTCCAGTTTCTTTGGG - Intergenic
985616484 5:925810-925832 CTATCTCTACCATTTTCTATCGG + Intergenic
985762395 5:1756740-1756762 CTCGGTCTTCCAGTTTGATTTGG - Intergenic
989352672 5:40504425-40504447 CTAGCTCTTACAGTTGCTCTAGG - Intergenic
991513640 5:67409163-67409185 ATAGATCTACCAGTTTCAAGTGG - Intergenic
996000161 5:118351408-118351430 CTTGCTTTTCCAGCTTCAACAGG + Intergenic
996780482 5:127181424-127181446 CCAGCTCTTACAATTTCATTAGG - Intergenic
997857429 5:137384668-137384690 TTACCTCTTCCAGTTTCTAGTGG + Intronic
1002035919 5:176469565-176469587 CCAGCCCTTCCAGTGTAAATTGG + Intronic
1002085444 5:176772186-176772208 CTGCCTCTTCCAGCTTCCATTGG - Intergenic
1004756177 6:18613028-18613050 CTTGGTCTTCCACTTTCAATGGG + Intergenic
1007389063 6:41539443-41539465 CCAGGTCTTCCAGGTTCCATGGG + Intergenic
1010425625 6:75725941-75725963 CTTGCTCTATCAGTGTCAATAGG + Intergenic
1011997510 6:93611495-93611517 CAATCTCTTCAAGTTTTAATGGG + Intergenic
1014260254 6:119208273-119208295 CTACTTCTTCCATTTTAAATTGG + Intronic
1019513161 7:1428550-1428572 CTCGATATTGCAGTTTCAATTGG + Intronic
1021131833 7:16921204-16921226 CTGGCTCTTCCAGGTTCTAGAGG + Intergenic
1023357844 7:39385623-39385645 CAAGTTCCTCCAGTCTCAATGGG - Intronic
1024339796 7:48245567-48245589 CATCCTTTTCCAGTTTCAATTGG - Exonic
1030968308 7:116021833-116021855 TTAGCTCTTCCTGTTTTAGTAGG + Intronic
1032282764 7:130518003-130518025 CTAGCTCTTCAAGTCTTGATGGG + Intronic
1032381977 7:131494312-131494334 AAAGCTCTGCCAGTTGCAATGGG - Exonic
1037929081 8:22866887-22866909 CTAGCTCCTCCACTTCCACTAGG - Intronic
1038781932 8:30575516-30575538 CTAGCTCTTTGAGTTTCCAGCGG + Intergenic
1042515195 8:69651994-69652016 CTTGCTTTTCCAGTTTCTAGAGG + Intronic
1042841337 8:73126926-73126948 TTACCTTTTCCAGTTTCCATAGG + Intergenic
1043073674 8:75668703-75668725 ATAGCTCTTCCACTATGAATAGG + Intergenic
1044809447 8:96043106-96043128 ATAGTTCTTCCTTTTTCAATAGG + Intergenic
1046279915 8:112013262-112013284 CTAGCTTTTACAGTTTCTAAAGG - Intergenic
1047494082 8:125397288-125397310 CTGGCTCTTCCAGCTTCTAGTGG + Intergenic
1047677900 8:127223070-127223092 CTAGCTCTTCCACCCTCAAATGG + Intergenic
1050697545 9:8295675-8295697 CTAGCTTAACCAGTTTCAAAGGG + Intergenic
1051657520 9:19397160-19397182 CGAGCTCTTCCAGTTCCACATGG - Intergenic
1053837432 9:42155326-42155348 CTAGCTCTTCCTTTCTCAAGTGG + Intergenic
1057574833 9:96234031-96234053 CAAGCCCTCCCAGATTCAATGGG - Intergenic
1058195409 9:101968555-101968577 TTAGCACCTCCAGTTTCAGTGGG + Intergenic
1059771589 9:117431508-117431530 CTAACTCTTGCAGTTTTAAGGGG + Intergenic
1187228578 X:17398586-17398608 GTAGCTCTTCTAGTTTCAGCTGG + Intronic
1190526937 X:51337728-51337750 CTAGCTTTTCCTATTTCAATGGG - Intergenic
1190578480 X:51867023-51867045 CTACATCTTTCAATTTCAATTGG - Intronic
1193963633 X:87955614-87955636 CTTGCTCTTCTAGTTTCCTTAGG - Intergenic
1199052214 X:143249389-143249411 CCAGCTCTGCCATTTTCAACAGG - Intergenic
1200908875 Y:8513841-8513863 CTGGCTCTTCCAGATTCCAGGGG + Intergenic
1201521448 Y:14878834-14878856 CTAGATGATACAGTTTCAATTGG + Intergenic