ID: 1106984992

View in Genome Browser
Species Human (GRCh38)
Location 13:35336009-35336031
Sequence TTCCTAAGGAACTCTGTGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 126}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106984992_1106984997 3 Left 1106984992 13:35336009-35336031 CCTTACACAGAGTTCCTTAGGAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1106984997 13:35336035-35336057 CTGGGAGGTTTTTTCTATCCAGG 0: 1
1: 0
2: 1
3: 17
4: 241
1106984992_1106984998 12 Left 1106984992 13:35336009-35336031 CCTTACACAGAGTTCCTTAGGAA 0: 1
1: 0
2: 0
3: 11
4: 126
Right 1106984998 13:35336044-35336066 TTTTTCTATCCAGGAATTTAAGG 0: 1
1: 0
2: 1
3: 27
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106984992 Original CRISPR TTCCTAAGGAACTCTGTGTA AGG (reversed) Intronic
900866119 1:5269777-5269799 TTTTTAAGGCACTCAGTGTATGG + Intergenic
903546652 1:24128212-24128234 GTGCCAAGGAACTCTGTGTCAGG + Exonic
905057202 1:35106295-35106317 TTTTTAAGGAAGTCTGTATAGGG - Intronic
905534963 1:38714114-38714136 ATCCTAAGGAGCTAAGTGTATGG + Intergenic
910300304 1:85698885-85698907 TTCCTAAGGATTTCAGTGAAGGG + Intronic
910382259 1:86640795-86640817 TTCTTGAGGAACTCAGTTTACGG + Intergenic
913450379 1:118988830-118988852 TTTCTAAGCAAATCTGGGTAAGG + Intronic
915288333 1:154867024-154867046 TTCCTTAAGAACTCTGACTACGG + Intronic
1065045887 10:21747445-21747467 CTCCTTAGGAACTCTGAGTCGGG - Intergenic
1067964977 10:50901249-50901271 TTCCTCTGGACCTCTGTATAAGG - Intergenic
1068305415 10:55201102-55201124 TTTCTAAGGAACTCATTGTTTGG - Intronic
1073345074 10:102776823-102776845 TTCTGAAGGGACTCTGTGTTGGG + Intronic
1073475960 10:103753796-103753818 TTTCTAAGGAACTTTGTGTGAGG - Intronic
1073874228 10:107902605-107902627 TTTATAAGGCACTCTGTCTATGG + Intergenic
1075493546 10:122897011-122897033 TTCCTAAGGTACTAGGTTTAGGG - Intergenic
1077181081 11:1217003-1217025 TTCCAAAGGAAATGTGTGAATGG + Intergenic
1079214347 11:18494684-18494706 TCCCAAAGGAAGTCTGTGAAAGG + Intronic
1079519707 11:21312121-21312143 TTTGTAAGTTACTCTGTGTATGG + Intronic
1081284791 11:41254651-41254673 CTCCTGAGGAACAATGTGTAAGG + Intronic
1084598681 11:70132287-70132309 TTCCTAAGGGACTCTTTGCTGGG - Intronic
1086797114 11:91119835-91119857 TTGCTAAGGGACTCTGTGTTGGG + Intergenic
1089948787 11:122506238-122506260 ATCCTAAAGAACTCTGTCTGTGG - Intergenic
1090129141 11:124121327-124121349 TACTTAAGGAACTCAGTTTAGGG - Intronic
1091169336 11:133506535-133506557 TCCCTCAGGAAATCTGTGAATGG + Intronic
1095538844 12:43284770-43284792 TTCCCAAAGAATTCTCTGTAAGG + Intergenic
1096242218 12:49965550-49965572 TTCCTAAGGAGCTCTGGGGAGGG - Exonic
1100366139 12:93922492-93922514 TGCCTAACAATCTCTGTGTATGG + Intergenic
1100846386 12:98662691-98662713 TTCCTAAGGAACTCTCCACAGGG - Exonic
1101757305 12:107630920-107630942 ACCCTAAGGAACTCTGAATAAGG - Intronic
1105741811 13:23333046-23333068 TTGCTAAGGAAATCAGTGTGAGG - Exonic
1106984992 13:35336009-35336031 TTCCTAAGGAACTCTGTGTAAGG - Intronic
1107256936 13:38439093-38439115 TTCATAAATTACTCTGTGTAAGG - Intergenic
1108211153 13:48141195-48141217 TTCCTAATAAGCTCTGTGTCTGG - Intergenic
1108936756 13:55891334-55891356 CCCATGAGGAACTCTGTGTAGGG + Intergenic
1111718242 13:91908826-91908848 TTCCTAAGCAAAACTTTGTATGG + Intronic
1113447618 13:110381386-110381408 TTCCTAAAGAAATCTGGCTACGG - Intronic
1114423200 14:22601847-22601869 TTCCTAATTAACAGTGTGTATGG + Intronic
1119862189 14:77944153-77944175 TTTCTAGGGAAATCTTTGTAAGG + Intergenic
1121589254 14:95088724-95088746 TTTCTAAGGAACCCTGAGTGAGG - Exonic
1121939268 14:98054207-98054229 TTCCTCAGGCACACTGTCTACGG + Intergenic
1124994536 15:34709969-34709991 TTGGTAAGAAACTCTGTTTAGGG - Intergenic
1126584974 15:50275971-50275993 TGCCTAACGAACTCAGTGTCTGG + Intronic
1127334485 15:57970217-57970239 TTCATAAGGAGCTCTGGGCAGGG - Intronic
1128081142 15:64857615-64857637 CTCCTAAGGAACCCTGTATCTGG - Intronic
1129267254 15:74400352-74400374 GTGCTAATGGACTCTGTGTAGGG + Intergenic
1136010199 16:27358624-27358646 CTCCTCAGGAACTCTGTGCTGGG + Intronic
1136708589 16:32212590-32212612 TTCCTAAGCAAAACTTTGTATGG - Intergenic
1136759317 16:32716822-32716844 TTCCTAAGCAAAACTTTGTATGG + Intergenic
1136808790 16:33153564-33153586 TTCCTAAGCAAAACTTTGTATGG - Intergenic
1139875180 16:70140408-70140430 TTCCAAAGTAACTATGGGTAGGG - Intronic
1140800659 16:78485367-78485389 TCCCTAAGGAACCCTGTTTTGGG + Intronic
1203061473 16_KI270728v1_random:977131-977153 TTCCTAAGCAAAACTTTGTATGG + Intergenic
1143952098 17:10641227-10641249 TTTTTAAGAAATTCTGTGTAAGG - Intronic
1145024784 17:19460031-19460053 TTCATAAAGGAATCTGTGTATGG - Intergenic
1146771008 17:35568660-35568682 TTCTTTAGGAACTCTGTGATTGG + Intergenic
1153848300 18:9069585-9069607 TTCTTAAAGAACGCTGTGAATGG + Intergenic
1155588086 18:27391078-27391100 TTCCTACTGATCTCTCTGTAAGG + Intergenic
1158380258 18:56921853-56921875 TTCCTAAGGGCCTCTGTGTTGGG - Intronic
1158816143 18:61099306-61099328 TCTCTAAGGAGCTCTATGTATGG - Intergenic
1159405313 18:67994669-67994691 TTCCTAAAGAACTCTCTGATAGG + Intergenic
1161129523 19:2579764-2579786 TTTCCCAGGAACTCTGTGGATGG + Intronic
1161197076 19:2992873-2992895 TTTCTAATGATCTCTGTGTTTGG - Intronic
1161456970 19:4374508-4374530 ACCCTAAGGAACCCTGTGCAGGG + Intronic
1163297010 19:16418919-16418941 TTTCTAAGCCACTCTGTCTATGG + Intronic
1165253966 19:34561804-34561826 TTCATAAGCAACTCAGTTTATGG - Intergenic
1165312121 19:35034700-35034722 TCACTAAGGGACTCCGTGTAAGG - Intronic
1168473536 19:56660094-56660116 TATCTAGGGAACACTGTGTAGGG + Intergenic
925641210 2:5987219-5987241 TTCCTCGGGAACTCTATGAATGG + Intergenic
927736655 2:25529542-25529564 GTGCTATGGAACACTGTGTAGGG + Intronic
928192506 2:29185589-29185611 TTCCTAATGAAATTTGTGTATGG + Intronic
931134292 2:59378569-59378591 TTCCTATGGAAATCTGAGGAGGG + Intergenic
933281031 2:80332994-80333016 TTCCAACGAAACTTTGTGTATGG - Intronic
940390833 2:153130711-153130733 TTTCTAGGGATCTTTGTGTAGGG - Intergenic
942509219 2:176678515-176678537 TTCCAAAGGAATTCTGTTCAGGG + Intergenic
946805519 2:223467323-223467345 TTTTTAAGGAACTGTGTGGAAGG + Intergenic
947051705 2:226051613-226051635 TTTCTAAGGCTATCTGTGTAGGG - Intergenic
947071103 2:226288800-226288822 TTCCAAGGGAACTCTGAGTATGG - Intergenic
948585225 2:239015091-239015113 TACCTGAGGAACTCGGTGTGGGG + Intergenic
1170925439 20:20718762-20718784 TTTCTAAAGAACTCTGATTATGG - Intergenic
1172775652 20:37405192-37405214 TGCCTAAGGCCCTTTGTGTAAGG + Exonic
1174654266 20:52157293-52157315 TTCCAAAAGAACTGTGGGTATGG + Intronic
1178660812 21:34506090-34506112 TTCCCAAGGAATTCTCTGTAGGG - Intergenic
1178906393 21:36640675-36640697 ATCCCAAGAAACTCTGTTTATGG - Intergenic
1180865172 22:19114532-19114554 TACCTACAGAACTCTGTCTATGG - Intronic
1182187907 22:28426568-28426590 TTCCTAAGGAACTAGGAATAAGG + Intronic
1182785531 22:32904428-32904450 TTCCTGAGGAACTCTGAAGAAGG + Intronic
953376827 3:42435891-42435913 TTCCTTAGTAGGTCTGTGTATGG - Intergenic
957158465 3:76577381-76577403 TTCCAAGGGAAAGCTGTGTAAGG - Intronic
961071288 3:123929962-123929984 TTCTTATGGAAGTCTTTGTAAGG - Intronic
962028591 3:131574594-131574616 TGCCTAATGAACTGTTTGTATGG + Intronic
964630749 3:158807649-158807671 GTCCTAATCAACTCTGTGTGGGG + Intronic
967041993 3:185702439-185702461 TTCCTAAGTTACTGTGTGTTTGG - Intronic
967748282 3:193084033-193084055 TTCCCTGGGGACTCTGTGTAAGG - Intergenic
972411832 4:38802694-38802716 TTCTTAATAAACTCTCTGTAAGG + Intronic
974977609 4:68909949-68909971 TACCTAAGAAACTTTGTGGAAGG - Intergenic
974987671 4:69049696-69049718 TACCTAAGAAACTCTGTGGAAGG + Intronic
974993178 4:69119746-69119768 TACCTAAGAAACTCTGTGGAAGG + Intronic
981159550 4:141481695-141481717 TGCCCAAGGAACTTTGTGAAAGG + Intergenic
981344050 4:143654693-143654715 TTCCTAAGCAACTCTGAATAAGG + Intronic
982843303 4:160219824-160219846 TTCATCAGGGACTCCGTGTAGGG + Intergenic
984844317 4:184097186-184097208 TTCCCAAGGAAGTGTCTGTAAGG - Intronic
987926067 5:24343422-24343444 TTCCAGAGGCACTCTGTGAACGG + Intergenic
993164876 5:84339513-84339535 CTCTTAAGGAAGTTTGTGTAAGG + Intronic
995250027 5:109982750-109982772 TTCCTAAGTAACCCTGTTAAGGG + Intergenic
996063152 5:119053625-119053647 TTTCTAAAAAACTCTATGTAAGG + Intronic
1000669164 5:164039344-164039366 TTTCTAAGGCACTCTGTCTATGG - Intergenic
1004263588 6:14129952-14129974 TTAGGAAGGAACTCAGTGTAGGG - Intronic
1006068604 6:31480541-31480563 CTTCCATGGAACTCTGTGTAAGG + Intergenic
1006294310 6:33163196-33163218 TTCCTCAGTGACTGTGTGTAGGG - Exonic
1010400986 6:75445483-75445505 TTCCTAAGGAAATCAGGGAAGGG - Intronic
1017624992 6:156339061-156339083 ATCATATGGAACTCTGTGTTAGG - Intergenic
1017673678 6:156792850-156792872 GTCCTTAGGATGTCTGTGTAGGG + Intronic
1017854940 6:158342274-158342296 TTACTCAGGAAATCTTTGTAAGG + Intronic
1019404942 7:878000-878022 TTCCTACGGAGCCCGGTGTAGGG - Intronic
1020988528 7:15166755-15166777 TTCCTAATGAATTCAGTGTGGGG + Intergenic
1022320826 7:29286227-29286249 TTCCCAAGGGAATCTGAGTAAGG - Intronic
1022986431 7:35659407-35659429 TTTATAAGCATCTCTGTGTATGG - Intronic
1024992957 7:55250786-55250808 CTCCTAAGAATCTCTGTGTCTGG - Intronic
1032225935 7:130031850-130031872 TTGCCAAGGAGCTCTGTGTGTGG - Intronic
1032858232 7:135854594-135854616 GTACTAAGGAGCTCTGTGTCAGG + Intergenic
1036109086 8:5877973-5877995 TTCCTAAGGAACTGGATATAGGG + Intergenic
1036222233 8:6930463-6930485 TTCATAAGCAACTCAGTTTATGG + Intergenic
1036616818 8:10394348-10394370 TGGCTAGGGAACTCTGTTTATGG - Intronic
1036690884 8:10944027-10944049 TTCCTAAGGGACTGGGTGCAGGG - Intronic
1036734279 8:11295902-11295924 TCTCTAAGGAACTCTGTAGAGGG - Intronic
1043917532 8:85939893-85939915 ATCCAAACAAACTCTGTGTAAGG - Intergenic
1046679557 8:117153341-117153363 AGCCTCAGGGACTCTGTGTATGG + Intronic
1048621597 8:136139353-136139375 TTTCTAAGGCTCTCTGTGAAAGG + Intergenic
1048998777 8:139810855-139810877 TCCCTAATGAACTCTGGGTGGGG + Intronic
1049057592 8:140251100-140251122 TTCCTGAGGAACAGTGTGGAAGG - Intronic
1051357842 9:16255688-16255710 CTCCTAAAGAGCTTTGTGTAGGG - Intronic
1052566240 9:30156226-30156248 TTCATAAGGGACTGTGTGTTGGG - Intergenic
1059107209 9:111522063-111522085 TTCCTCCCCAACTCTGTGTACGG + Intergenic
1060352837 9:122874054-122874076 TGCCTAGGGAAGTCTGTGGAGGG + Intronic
1188967606 X:36574325-36574347 TTTCTAAGGAAATTTGTGTGGGG - Intergenic
1189372603 X:40440981-40441003 TTGCTAAGAAGCTCTCTGTATGG + Intergenic
1195835353 X:109108848-109108870 TTCATAAGGAATTCATTGTATGG + Intergenic
1197279811 X:124522074-124522096 TTCCTAATGACATCTGTGAAGGG + Intronic