ID: 1106985920

View in Genome Browser
Species Human (GRCh38)
Location 13:35349798-35349820
Sequence CCTCATCAAAACTAGAATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 307
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 292}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106985920_1106985922 28 Left 1106985920 13:35349798-35349820 CCACAATTCTAGTTTTGATGAGG 0: 1
1: 0
2: 0
3: 14
4: 292
Right 1106985922 13:35349849-35349871 GTCATACAAGTTGATAGACTAGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106985920 Original CRISPR CCTCATCAAAACTAGAATTG TGG (reversed) Intronic
906501438 1:46343928-46343950 CCTCACCATAACAAGAAATGAGG + Intronic
907003567 1:50887642-50887664 CCTGATAAAAACAAGAAATGGGG - Intronic
907005203 1:50906143-50906165 CCTGATAAAAACAAGAAATGGGG - Intronic
908102367 1:60804783-60804805 CCTCACAAAAACAAGAAATGGGG - Intergenic
909260853 1:73487563-73487585 CCTGATAAAAACAAGAAATGGGG - Intergenic
909328736 1:74386601-74386623 CTTCTTCAAAATTAGAATTGTGG + Intronic
909436202 1:75645896-75645918 CCTGACCAAAACAAGAAATGGGG - Intergenic
909441612 1:75702385-75702407 CCTGATAAAAACAAGAAATGGGG + Intergenic
910416977 1:87011619-87011641 ACTCATCAATAATAGAATTAGGG + Intronic
910628147 1:89330312-89330334 CCTGATAAAAACAAGAAATGGGG + Intergenic
910924339 1:92383033-92383055 CCTGACCAAAACAAGAAATGGGG - Intronic
912311140 1:108622528-108622550 AGTCACCAAAACTAGAATTACGG - Intronic
916460258 1:165016634-165016656 CCTGATAAAAACAAGAAATGCGG - Intergenic
916769761 1:167896649-167896671 ATTCATCAAAATTAAAATTGGGG + Exonic
917172375 1:172191280-172191302 CCTCACAAAAACAAGAAATGGGG - Intronic
917207467 1:172592541-172592563 CCTGACCAAAACAAGAAATGGGG - Intronic
918160306 1:181892376-181892398 CCTGATGAAAACAAGAAATGGGG + Intergenic
919355230 1:196514040-196514062 CCTCATCAAGAGTTGATTTGAGG + Intronic
919603602 1:199652185-199652207 CCTGACAAAAACAAGAATTGGGG + Intergenic
921550295 1:216527259-216527281 CCTAACCAAAACTGGAATGGAGG - Intronic
1063309458 10:4938559-4938581 CCTCATGGAAACTAGAAGTTTGG + Intronic
1065157368 10:22884324-22884346 CCTGATAAAAACAAGAAATGGGG + Intergenic
1067933904 10:50591801-50591823 CAGCATCAAAACTACAGTTGGGG + Intronic
1068195010 10:53705094-53705116 CCTGATGAAAACAAGAAATGGGG - Intergenic
1068467774 10:57417303-57417325 CCTTATTAAAACAAGAAATGGGG + Intergenic
1068599541 10:58941995-58942017 CATCCTCAAAACTTGAATGGGGG + Intergenic
1069050641 10:63788895-63788917 CCTGATAAAAACAAGAAATGGGG + Intergenic
1069354085 10:67563368-67563390 CCTGAGAAAAACTAGAAATGAGG + Intronic
1069393573 10:67963889-67963911 CCTCAGCAAGACTTGAACTGAGG - Intronic
1070157926 10:73847768-73847790 CTTCTTCATAACTAAAATTGAGG - Intronic
1070211049 10:74322603-74322625 ACACATCAAAAATATAATTGAGG - Intronic
1071749528 10:88458801-88458823 CCAAAGCAAAACTAGAATTGAGG - Intronic
1072477265 10:95774595-95774617 CCTGATAAAAACAAGAAATGGGG - Intronic
1078032779 11:7770079-7770101 CCTGATAAAAACAAGAAATGGGG + Intergenic
1079870960 11:25797385-25797407 CATCATCAAGAATAGACTTGTGG - Intergenic
1081561879 11:44225211-44225233 CCTCATGAAAAATAGTATTTGGG + Intronic
1083165748 11:60885935-60885957 CCTGATAAAAACAAGAAATGGGG + Intergenic
1085248432 11:75124183-75124205 CCTGATAAAAACAAGAAATGGGG + Intronic
1085733733 11:79021176-79021198 CCTCATCACAACTAAACTTGAGG + Intronic
1086612437 11:88773716-88773738 CCTGATAAAAACAAGAAATGGGG - Intronic
1087835236 11:102867310-102867332 CAGCATCAAAACTCAAATTGGGG + Exonic
1088005248 11:104931943-104931965 CCTCATAAAAACAAGGAATGGGG + Intergenic
1088679165 11:112224595-112224617 CCTGATAAAAACAAGAAATGGGG + Intronic
1090729283 11:129555713-129555735 TCTCATCTAAACCAGATTTGGGG - Intergenic
1092828471 12:12420310-12420332 CCTGATAAAAACAAGAAATGGGG - Intronic
1093518690 12:20022172-20022194 CATCATCATAACTAGAAGTCTGG + Intergenic
1095772534 12:45977209-45977231 CCTCATCAAAACAAAAACTATGG + Intronic
1095827065 12:46541203-46541225 CCTGATAAAAACAAGAAATGTGG - Intergenic
1098689294 12:73466420-73466442 CCTTATCTAAACCAGTATTGTGG + Intergenic
1099511607 12:83545635-83545657 CCTGATAAAAACAAGAAATGGGG - Intergenic
1099744493 12:86685300-86685322 CCTGATAAAAACAAGAAATGGGG - Intronic
1106985920 13:35349798-35349820 CCTCATCAAAACTAGAATTGTGG - Intronic
1108737247 13:53297104-53297126 CCTGATGAAAACAAGAAATGGGG + Intergenic
1109449957 13:62499234-62499256 CCTCATCAAAATTAAAACTTTGG - Intergenic
1109780590 13:67106516-67106538 CCATATTAAAATTAGAATTGTGG - Intronic
1109975935 13:69831916-69831938 CCTCAGCAAAACTGGCATAGAGG + Intronic
1110906218 13:80893594-80893616 TCTCAAGAAAACCAGAATTGTGG - Intergenic
1112336961 13:98523991-98524013 CCTCAGCTCAACAAGAATTGTGG - Intronic
1112401634 13:99083834-99083856 ACTCATCAATACTTGAAGTGTGG + Intronic
1112493570 13:99887767-99887789 CCTTGTCAAAAGTAGAATGGTGG + Intronic
1114144836 14:19963038-19963060 CCTGATAAAAACAAGAAATGGGG + Intergenic
1114574962 14:23704519-23704541 CCTCACAAAAACAAGAAATGGGG + Intergenic
1114580834 14:23757980-23758002 CCTCACAAAAACAAGAAATGGGG - Intergenic
1114711855 14:24786788-24786810 ATCCATCCAAACTAGAATTGTGG + Intergenic
1115720662 14:36157656-36157678 CTTCATCAAAACAAGCAATGGGG - Intergenic
1122317137 14:100832685-100832707 CATCACCAAAATTAGAAGTGTGG - Intergenic
1122584711 14:102797325-102797347 CCTCATCATATATAGAATTGGGG - Intronic
1124569554 15:30849868-30849890 CCTGATGAAAACAAGAAATGGGG - Intergenic
1126064186 15:44812481-44812503 GCTCATCAAAGCTAGAGTTCAGG + Intergenic
1127125473 15:55807501-55807523 CCTGATGAAAACAAGAAATGGGG + Intergenic
1127212541 15:56788812-56788834 CCTGATAAAAACAAGAAATGGGG + Intronic
1131203101 15:90417472-90417494 CCTGACCAAAACAAGAAATGGGG - Intronic
1131297522 15:91164028-91164050 CCTGATAAAAACAAGAAATGGGG - Intronic
1132978677 16:2723221-2723243 TCCCTTCAAAAATAGAATTGGGG + Intergenic
1134744414 16:16576595-16576617 CCTGATGAAAACAAGAAATGGGG + Intergenic
1135191808 16:20360579-20360601 CCACATCAAAACTAAGATTGAGG - Exonic
1135195758 16:20393200-20393222 CCTCATCCACACTAGAATTCAGG - Intronic
1136173820 16:28504175-28504197 CCTCCTCAAAACCACAATGGAGG + Intronic
1136659857 16:31748255-31748277 CCTGACAAAAACTAGAAATGGGG - Intronic
1138087088 16:54142954-54142976 CCTAATCAAATCAAGAATTTGGG - Intergenic
1138163191 16:54775467-54775489 CCTCCTCAATAGTAGAGTTGAGG + Intergenic
1139075624 16:63443630-63443652 CCTGATAAAAACAAGAAATGGGG + Intergenic
1139800297 16:69517157-69517179 CCTGATAAAAACAAGAAATGGGG + Intergenic
1139886349 16:70210447-70210469 CCTGACAAAAACTAGAAATGTGG + Intergenic
1141170769 16:81689919-81689941 CCTGATAAAAACAAGAAATGGGG - Intronic
1144042613 17:11426281-11426303 GCTCATGAATGCTAGAATTGTGG - Intronic
1145789433 17:27616867-27616889 CCTCAGCATTACTAGAATGGCGG - Intronic
1145809240 17:27754879-27754901 TCTCATCAAAACGGGGATTGAGG - Intergenic
1146089775 17:29865009-29865031 CTGCATTAAAACTAGAATGGTGG + Intronic
1146754244 17:35412891-35412913 CCTTAGAAAAACTAAAATTGAGG + Intronic
1148724266 17:49777298-49777320 CCTCATGGAAACTAGGCTTGGGG - Intronic
1148870475 17:50656373-50656395 CCTCATTAAAACCAGAATGCTGG - Intronic
1149980113 17:61304020-61304042 TATCAACAAAACTAGAAATGGGG + Intronic
1152164835 17:78696240-78696262 CCTCATCAAGGCAAGATTTGAGG + Intronic
1153511864 18:5863537-5863559 CCTGACCAAAACAAGAAATGGGG + Intergenic
1154364500 18:13694593-13694615 CCTGACAAAAACTAGAAATGGGG + Intronic
1155681317 18:28490362-28490384 CCTGATAAAAACAAGAAATGGGG + Intergenic
1156115861 18:33786551-33786573 CCTCACAAAAACAAGAAATGGGG + Intergenic
1157008422 18:43616304-43616326 CCTGACAAAAACTAGAAATGTGG - Intergenic
1158043389 18:53125213-53125235 CCTCATGAAAACTATTATTTCGG - Intronic
1158365141 18:56725919-56725941 CCTCACAAAAACAAGAAATGGGG - Intronic
1158560588 18:58510149-58510171 CCTCACAAAAACAAGAAATGGGG - Intronic
1162628937 19:11910547-11910569 CCTGATAAAAACAAGAAATGGGG + Intronic
1164453938 19:28391392-28391414 TCACATCAAAACTAAAAATGAGG + Intergenic
1167512111 19:49900881-49900903 CCTCATCGAAACCATCATTGTGG - Intronic
925672744 2:6328747-6328769 CCTCATAAAAACAAGAAATGGGG - Intergenic
927024781 2:19055434-19055456 CCTCAGCAAAATTAGCATAGAGG - Intergenic
928480602 2:31679354-31679376 CCTGATAAAAACAAGAAATGGGG - Intergenic
929367539 2:41178305-41178327 CCTTATCAAAACAAGCAATGGGG - Intergenic
931558209 2:63528481-63528503 CCTGATAAAAACAAGAACTGGGG - Intronic
932392174 2:71404276-71404298 TGTCATCTAAACTAGAATTCTGG + Intronic
932662241 2:73665761-73665783 CCTGATAAAAACAAGAAATGGGG - Intergenic
933410376 2:81917888-81917910 CCTGACCAAAACAAGAAATGAGG - Intergenic
933461214 2:82588170-82588192 CATGGTGAAAACTAGAATTGAGG + Intergenic
935447398 2:103171144-103171166 CCTCATCAAAGTTACACTTGAGG + Intergenic
936438041 2:112525055-112525077 CCTGATAAAAACAAGAAATGAGG - Intronic
938249721 2:129805280-129805302 CCTCATCCAAACTGGCAGTGGGG + Intergenic
940731564 2:157398863-157398885 CCTGATGAAAACAAGAAATGGGG - Intergenic
941429781 2:165399906-165399928 CATGATTAAAACTAGAACTGGGG - Intergenic
941816065 2:169797336-169797358 CTTGATCAAAACAAGAATTAAGG + Intronic
942412671 2:175727503-175727525 CCTCAGCAAAAGTAGTAATGTGG + Intergenic
943634907 2:190295819-190295841 ACTCATCAAAAGAAGAATTAAGG + Intronic
943687224 2:190831315-190831337 CATCATCTAAACTATACTTGGGG + Intergenic
944955308 2:204800976-204800998 CCTGATAAAAACAAGAAATGGGG - Intronic
946293935 2:218767929-218767951 CCTGATAAAAACAAGAAATGGGG - Intergenic
946765655 2:223037638-223037660 CCTTTGCAAAACTATAATTGAGG - Intergenic
947213969 2:227733389-227733411 CCTGATGAAAACAAGAAATGGGG + Intergenic
947238198 2:227965996-227966018 CCTGACCAAAACAAGAAATGGGG - Intergenic
947241793 2:228002832-228002854 CCTGATGAAAACAAGAAATGGGG - Intronic
947275487 2:228386978-228387000 CCTGACCAAAACAAGAAATGGGG - Intergenic
947701911 2:232241431-232241453 CCTTATCTAAACTCTAATTGGGG + Intronic
1170270038 20:14516566-14516588 CCTGACAAAAACAAGAATTGGGG - Intronic
1174903577 20:54526172-54526194 CCTCATCAAACCTAAAAGAGAGG - Intronic
1177294028 21:19151948-19151970 CCTGACCAAAACAAGAAATGGGG + Intergenic
1177571754 21:22895862-22895884 CCTGATAAAAACAAGAAATGGGG - Intergenic
1178760906 21:35401825-35401847 CCTAATCAATACTAGCAGTGGGG + Intronic
1181996400 22:26886155-26886177 CTTCATTAAAAATAGATTTGTGG + Intergenic
1182168028 22:28196163-28196185 CCTGACAAAAACAAGAATTGGGG + Intronic
1182271468 22:29156591-29156613 CCTCTTCAAAACTCTAAATGAGG + Intronic
1184147767 22:42621565-42621587 CCTCAACTAATCTTGAATTGTGG + Intronic
949277050 3:2295942-2295964 CCTGATAAAAACAAGAAATGCGG - Intronic
949280239 3:2337536-2337558 CCACTTTAAAAATAGAATTGAGG + Intronic
951036751 3:17940938-17940960 CCTCCTCAATACAAGAATTTTGG - Intronic
951202018 3:19885823-19885845 CCTCACCAAAAGTAGAAATCTGG + Intronic
951434838 3:22649843-22649865 CCTGATTTAAACTAGAAGTGTGG + Intergenic
951815159 3:26745986-26746008 CCTCACGAAAACAAGAAATGGGG - Intergenic
951885432 3:27519626-27519648 AGTAATCAAAACTAGCATTGTGG - Intergenic
955786439 3:62545247-62545269 CCTAATCCAAATGAGAATTGAGG + Intronic
956220653 3:66899017-66899039 CCTGATAAAAACAAGAAATGGGG + Intergenic
958107332 3:89092863-89092885 CCTCACAAAAACAAGAAATGGGG - Intergenic
958553971 3:95649941-95649963 CCTGATGAAAACAAGAAATGGGG + Intergenic
960502097 3:118450252-118450274 CCTCAACAAAACAAGCAATGGGG - Intergenic
961402553 3:126657408-126657430 CCCCAGCAAAACCAGAACTGGGG + Intergenic
961527608 3:127516428-127516450 CCTGATAAAAACAAGAAATGGGG + Intergenic
962171676 3:133107846-133107868 CCTCCTCAAAACTTGGATTTAGG - Intronic
964187538 3:153964764-153964786 CCTCACAAAAACAAGAAATGGGG + Intergenic
964680824 3:159336608-159336630 CCTGATAAAAACAAGAAATGGGG - Intronic
965494144 3:169377054-169377076 CCTGATAAAAACAAGAAATGGGG + Intronic
966487697 3:180489566-180489588 CCTCACAAAAACAAGAAATGGGG + Intergenic
967045124 3:185729430-185729452 CCTCTTAAGAACTAGAATTTTGG + Intronic
967747197 3:193070510-193070532 CCTGACCAAAACAAGAAATGGGG - Intergenic
968277426 3:197451231-197451253 CATCATCAGAACTAGAATCCTGG + Intergenic
971023222 4:22560053-22560075 CCTCATAAAAAGGAGAATTTGGG - Intergenic
971706324 4:30048112-30048134 CCTGATAAAAACAAGAAATGGGG + Intergenic
972984321 4:44745253-44745275 CCTGACCAAAACAAGAAATGGGG - Intergenic
973875185 4:55210657-55210679 CCTGATAAAAACAAGAAATGGGG + Intergenic
974344521 4:60661924-60661946 CCTCATCAAACTTACAATTATGG - Intergenic
975304760 4:72836762-72836784 CCTGATGAAAACCAGAAATGGGG - Intergenic
975765275 4:77661118-77661140 CCTCATAAAAACTAAAAGAGTGG + Intergenic
976515895 4:85965920-85965942 GCTCACCAAAAGTAGACTTGGGG + Intronic
977538185 4:98280874-98280896 CCTCAGAAAAACAAGAAATGGGG - Intronic
978221428 4:106279978-106280000 CCTCAACAAAACTAAAAATAAGG - Intronic
979462269 4:120997318-120997340 CCTGACCAAAACAAGAAATGTGG - Intergenic
980307499 4:131082280-131082302 TTTCATCAACACTAGAATAGAGG + Intergenic
980681886 4:136173175-136173197 TCTAATCTGAACTAGAATTGTGG + Intergenic
983444613 4:167833813-167833835 CCTCTTCAGAACTCGAGTTGAGG - Intergenic
983776364 4:171612263-171612285 CCTCAACAAAACAGGAATAGTGG + Intergenic
983828620 4:172297616-172297638 CCTGATAAAAACAAGAAATGGGG - Intronic
987427846 5:17793936-17793958 CCTCAGCCAAATTCGAATTGAGG + Intergenic
988122779 5:26989454-26989476 TATCATGAAAACTAGAATTAGGG + Intronic
988213502 5:28240975-28240997 CCTCAGGAAAATTAGAATTATGG + Intergenic
989357645 5:40562650-40562672 CCTCACAAAAACAAGAAATGGGG - Intergenic
989463413 5:41726943-41726965 CCTGAACAGAACTAGATTTGTGG - Intergenic
990229872 5:53701450-53701472 CCTGACAAAAACAAGAATTGGGG - Intergenic
990679058 5:58220755-58220777 CCTGATAAAAACAAGAAATGGGG + Intergenic
990924608 5:61006206-61006228 CCTGATAAAAACAAGAAATGGGG - Intronic
991576333 5:68107451-68107473 CCTGATGAAAACAAGAAATGGGG + Intergenic
992554556 5:77890601-77890623 CCTAATCAAAAGCAGAATTTGGG + Intergenic
992814377 5:80421559-80421581 CCTGATAAAAACAAGAAATGGGG - Intronic
993433905 5:87867229-87867251 CCTCAGTTAAACTAGAATTGTGG - Intergenic
993517681 5:88857748-88857770 CCTCAGGAAACTTAGAATTGTGG - Intronic
994224390 5:97235524-97235546 CCTGACCAAAACAAGAAATGGGG - Intergenic
994488675 5:100412736-100412758 AATCATAAAAACTAGATTTGAGG + Intergenic
995000141 5:107118179-107118201 GCTCATAAAAACTAGAAAAGTGG + Intergenic
995003449 5:107162670-107162692 CCTCATAAAAACAAGCAATGGGG + Intergenic
996359688 5:122632062-122632084 CCTGATAAAAACAAGAAATGGGG - Intergenic
996495435 5:124149522-124149544 CCTCAGCAAAATTAGAATAAGGG + Intergenic
996936731 5:128957974-128957996 CCTGATGAAAACAAGAAATGGGG - Intronic
997827585 5:137120637-137120659 CCTCAAGAAAAGTAGGATTGAGG + Intronic
998159829 5:139807068-139807090 CAGCACCAAAGCTAGAATTGTGG - Intronic
998931417 5:147185632-147185654 CCTGATAAAAACAAGAAATGGGG + Intergenic
1000061808 5:157664320-157664342 CCTGACAAAAACTAGAAATGGGG + Intronic
1000592041 5:163169922-163169944 CCTGATAAAAACAAGAAATGGGG + Intergenic
1000631185 5:163592571-163592593 CCTGATAAAAACAAGAAATGGGG - Intergenic
1000647625 5:163777902-163777924 CCTGATAAAAACAAGAAATGGGG - Intergenic
1002777303 6:340188-340210 CAACATTAAAAATAGAATTGGGG - Intronic
1004029662 6:11854002-11854024 TCTCAGCAAAAATAGAATTTAGG + Intergenic
1005174034 6:23023753-23023775 CCTCATCAAACCTCTAAATGTGG - Intergenic
1005558584 6:27013284-27013306 CCTCACAAAAACAAGAAATGGGG + Intergenic
1006279327 6:33036107-33036129 CCTCATCAAAACTTATTTTGAGG - Intergenic
1007187425 6:39984190-39984212 GCTCATCAGAGCTAGAACTGAGG - Intergenic
1008184692 6:48374238-48374260 CCTCAAAAAAACTTGAATTTTGG + Intergenic
1008349034 6:50466302-50466324 CCTAATCAAAACTAGTGTGGTGG - Intergenic
1008467809 6:51850158-51850180 CCTCATAAAAACAAGCAATGGGG - Intronic
1008521925 6:52370001-52370023 CTTCATCAAACCAAGATTTGCGG - Intronic
1008978169 6:57453050-57453072 CCTGATAAAAACAAGAAATGGGG - Intronic
1009166319 6:60346010-60346032 CCTGATAAAAACAAGAAATGGGG - Intergenic
1009239289 6:61164229-61164251 CCTGATAAAAACAAGAAATGGGG - Intergenic
1009482144 6:64172407-64172429 ACTCATAAAAAATAGAATGGTGG - Intronic
1009585373 6:65594928-65594950 CCTGACCAAAACAAGAAATGGGG - Intronic
1009597416 6:65753481-65753503 CCTCACAAAAACAAGAAATGGGG + Intergenic
1010130946 6:72492948-72492970 CCTGATAAAAACAAGAAATGGGG + Intergenic
1010334503 6:74664873-74664895 CCTGATAAAAACAAGAAATGGGG + Intergenic
1010662058 6:78583206-78583228 CCTCCTAAAAACTAGGCTTGGGG - Intergenic
1011782983 6:90811252-90811274 ACTCATAAAAACAAGAAATGAGG - Intergenic
1011889209 6:92135736-92135758 CCTCAGCAAACTTAAAATTGTGG - Intergenic
1011953787 6:93000035-93000057 CCTGATGAAAACAAGAAATGGGG + Intergenic
1013386802 6:109639913-109639935 CCTAACCAAAACAAGAAATGGGG - Intronic
1013672030 6:112414694-112414716 CATCATCAAAACCCGAATTAGGG + Intergenic
1013683524 6:112551866-112551888 CCTGATGAAAACAAGAAATGGGG - Intergenic
1014092356 6:117417903-117417925 CATCATCAGAACCAGAATTGTGG - Intronic
1014343966 6:120244153-120244175 CCTGATAAAAACAAGAAATGAGG - Intergenic
1015176940 6:130320217-130320239 CCTCTTCAAAAAAAGAAATGGGG + Intronic
1016725566 6:147361782-147361804 CCTCATCAAAACTTTAAAGGCGG + Intronic
1022994471 7:35740464-35740486 CCTGATAAAAACAAGAATCGGGG - Intergenic
1024856352 7:53785062-53785084 CCTCACAAAAACAAGAAATGGGG + Intergenic
1025219186 7:57090988-57091010 CCTGATAAAAACAAGAAATGGGG - Intergenic
1025579756 7:62697172-62697194 CCTGACAAAAACAAGAATTGGGG + Intergenic
1026781231 7:73268901-73268923 CTTCATTAAAACTTGAATTGGGG - Intergenic
1027022086 7:74822349-74822371 CTTCATTAAAACTTGAATTGGGG - Intronic
1027065932 7:75123572-75123594 CTTCATTAAAACTTGAATTGGGG + Intronic
1027403004 7:77827942-77827964 CATCATCAAAAATACTATTGAGG - Intronic
1027531916 7:79345211-79345233 CCTTATGAAAACGAGAAATGTGG + Intronic
1027636605 7:80684244-80684266 CCTGATGAAAACAAGAAATGTGG - Intergenic
1027997376 7:85441368-85441390 CTTCAACAAAACTATAATGGAGG + Intergenic
1028379682 7:90185532-90185554 CCTGATAAAAACAAGAAATGGGG + Intronic
1028692893 7:93673902-93673924 CCTCACAAAAACAAGAAATGGGG + Intronic
1028836852 7:95384080-95384102 CCTGATAAAAACAAGAAATGGGG + Intronic
1029805090 7:102987749-102987771 TGTCATCCAAATTAGAATTGTGG - Intronic
1029887055 7:103884158-103884180 CCTGATAAAAACAAGAAATGGGG + Intronic
1030181511 7:106714290-106714312 CCTGAACAAAACGAGAAATGGGG + Intergenic
1030942167 7:115666343-115666365 CCCCATCAAATATAGAATTATGG - Intergenic
1032401602 7:131628109-131628131 CCTCATTAAGACCAGAATTCAGG + Intergenic
1032947742 7:136871210-136871232 CCTGAGGAAAACTGGAATTGGGG + Intronic
1035410537 7:158637255-158637277 CCTGATTAAAACTAGCATAGTGG + Intronic
1035773332 8:2167775-2167797 CCTGATAAAAACAAGAAATGGGG - Intergenic
1037422446 8:18717650-18717672 CTTCATCAAAGCCAGTATTGTGG - Intronic
1038973354 8:32662870-32662892 TCTTATCAAAATTAGAACTGTGG + Intronic
1039158324 8:34588314-34588336 CCTGATAAAAACAAGAAATGGGG - Intergenic
1040127309 8:43752594-43752616 CCTGATTAAAACTAGAAAGGAGG + Intergenic
1040630151 8:49200785-49200807 CCTGACAAAAACAAGAATTGGGG + Intergenic
1040766470 8:50917191-50917213 CCTGACAAAAACTAGAAATGGGG - Intergenic
1041409834 8:57541255-57541277 CCTCCTCAAACCTGGAAGTGTGG + Intergenic
1042371509 8:67996602-67996624 CCCCATCAAAAATACAATTAAGG - Intronic
1043288649 8:78568454-78568476 TCTTATCAGAACCAGAATTGCGG - Intronic
1045391062 8:101715205-101715227 CCTCACAAAAACAAGAAATGGGG + Intronic
1045734905 8:105283623-105283645 CCTCATAAATATTAAAATTGTGG + Intronic
1046410200 8:113831857-113831879 CCTGACCAAAACAAGAAATGGGG - Intergenic
1046926841 8:119800408-119800430 CCTGATAAAAACAAGAAATGGGG - Intronic
1047129746 8:122005953-122005975 CCTGATGAAAACAAGAAATGGGG + Intergenic
1052479869 9:29009906-29009928 CCTGACAAAAACTAGAAATGGGG + Intergenic
1055034278 9:71801340-71801362 CCTCATCAAAGCTAGAAGATGGG - Intronic
1055936553 9:81609678-81609700 ACTCATCAAAACTTTACTTGGGG + Intronic
1055946102 9:81692418-81692440 CCTCATGAAATCTATAATTTTGG + Intergenic
1056861707 9:90190835-90190857 CCTGATCAAAACAAGCAATGGGG - Intergenic
1057060333 9:91998488-91998510 CTTCATCTCAACTAGAATTAAGG - Intergenic
1057242265 9:93421926-93421948 TCTCATCTAAAAAAGAATTGTGG - Intergenic
1057580890 9:96286989-96287011 CCTCATCAAAGAAAGAATTCAGG - Intronic
1062063006 9:134507517-134507539 CCTGATGAAAACAAGAAATGGGG - Intergenic
1062705384 9:137936744-137936766 CCTGATAAAAACAAGAAATGGGG - Intronic
1186029939 X:5357045-5357067 CCTATTCAAAACTATATTTGAGG + Intergenic
1186605464 X:11085421-11085443 CCTCATGCAAACAAGAATTCTGG - Intergenic
1188001048 X:24982187-24982209 CAGCATCAAAAGTAGAATGGTGG - Intronic
1188052228 X:25502089-25502111 CCTCACAAAAACAAGAAATGGGG - Intergenic
1188296929 X:28461053-28461075 CCTGATAAAAACAAGAAATGGGG - Intergenic
1188634113 X:32406851-32406873 CCTCACAAAAACAAGAAATGGGG + Intronic
1188851636 X:35139703-35139725 CCTGATAAAAACAAGAAATGGGG + Intergenic
1190623085 X:52308192-52308214 CCTGACAAAAACTAGAAATGGGG + Intergenic
1191051611 X:56198966-56198988 CCTCACCAAAACAAGAAATGGGG + Intergenic
1191181408 X:57567661-57567683 CCTGATAAAAACAAGAAATGGGG + Intergenic
1191238938 X:58163609-58163631 CATAATAAAAACTAGAAATGAGG + Intergenic
1191628397 X:63293854-63293876 CCTCATAACAACTAGCAGTGAGG + Intergenic
1191765232 X:64691229-64691251 CCTCACAAAAACGAGAAATGGGG - Intergenic
1191803203 X:65104145-65104167 CCTCACAAAAACAAGAAATGAGG + Intergenic
1191882004 X:65851956-65851978 CCTGATGAAAACAAGAAATGGGG - Intergenic
1191956330 X:66646095-66646117 CCTGATAAAAACAAGAAATGGGG - Intergenic
1192998342 X:76536454-76536476 CCTGACAAAAACTAGAAATGGGG - Intergenic
1193072768 X:77323744-77323766 CCTGACAAAAACTAGAAATGGGG + Intergenic
1193189961 X:78559083-78559105 CCTGACAAAAACTAGAAATGGGG - Intergenic
1193316838 X:80074889-80074911 CCTGACAAAAACTAGAAATGGGG + Intergenic
1193590334 X:83381835-83381857 CCTGATAAAAACAAGAAATGGGG + Intergenic
1193835219 X:86335023-86335045 CCTGATCAAAACAAGCAATGGGG - Intronic
1195827208 X:109015239-109015261 CCTCACCAAAACAAGAAATGGGG + Intergenic
1196459417 X:115914862-115914884 CCTGATAAAAACAAGAAATGGGG + Intergenic
1196592615 X:117504824-117504846 CCTGATAAAAACAAGAAATGGGG + Intergenic
1201676428 Y:16590433-16590455 CCTGACCAAAACAAGAAATGGGG + Intergenic
1202065841 Y:20939065-20939087 CCTGACCAAAACAAGAAATGGGG - Intergenic