ID: 1106986998

View in Genome Browser
Species Human (GRCh38)
Location 13:35364960-35364982
Sequence CCCTGATAGAACTCTAATAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 66
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 58}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106986996_1106986998 -5 Left 1106986996 13:35364942-35364964 CCAGTCAAAATTCTTTGACCCTG 0: 1
1: 0
2: 3
3: 19
4: 150
Right 1106986998 13:35364960-35364982 CCCTGATAGAACTCTAATACAGG 0: 1
1: 0
2: 0
3: 7
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106986998 Original CRISPR CCCTGATAGAACTCTAATAC AGG Intronic
914348475 1:146819862-146819884 CAGTGATAGAAAACTAATACAGG - Intergenic
917463678 1:175255303-175255325 CCCTGACAAAACTCTATTAAAGG + Intergenic
918381299 1:183958308-183958330 GCCTGATAAAACCCTAATCCTGG + Intronic
919119463 1:193321108-193321130 TACTGTTAGAACTCTGATACGGG - Intergenic
1069329373 10:67273065-67273087 AAATGATAGAACTCTGATACAGG - Intronic
1074982491 10:118630881-118630903 CTCTAAGAGAACCCTAATACAGG - Intergenic
1081750138 11:45504623-45504645 TCTTTAGAGAACTCTAATACAGG - Intergenic
1083034616 11:59625138-59625160 CACTTAATGAACTCTAATACAGG + Intergenic
1091825972 12:3513041-3513063 CCCTGAGAGAACTGCAACACCGG + Intronic
1093031444 12:14292852-14292874 CTCTAAGAGAATTCTAATACAGG - Intergenic
1096399094 12:51290524-51290546 CCCTTATAGAAGTCAATTACTGG + Intronic
1102894231 12:116585852-116585874 CACTGATTGAACTCCAAAACTGG + Intergenic
1106986998 13:35364960-35364982 CCCTGATAGAACTCTAATACAGG + Intronic
1108768867 13:53671055-53671077 TCCTTATAGAAGTCTCATACAGG - Intergenic
1113252529 13:108470260-108470282 CTCTTATATAACTTTAATACAGG + Intergenic
1118692695 14:68354969-68354991 CTCGGATAGTACCCTAATACTGG - Intronic
1119579344 14:75762580-75762602 CCCTCATAGAACTATTATTCTGG + Intronic
1131314508 15:91321790-91321812 CCCTTAGACAAGTCTAATACTGG - Intergenic
1133487693 16:6236229-6236251 CCCTGATTGAATTCAAATCCTGG + Intronic
1139611860 16:68064848-68064870 CCCTGATAGGCCTCCACTACTGG + Intronic
1139985560 16:70895686-70895708 CAGTGATAGAAAACTAATACAGG + Intronic
1141419173 16:83900764-83900786 CCATTTAAGAACTCTAATACTGG + Intronic
1141825940 16:86480491-86480513 CCCTGTTAGAAGTCAAATAAAGG + Intergenic
1143065801 17:4246130-4246152 CCCTGAGAGCACTCTGATAGGGG + Intronic
1153682512 18:7513970-7513992 CCTTGAGAGAACTCTGATCCTGG - Intergenic
1153903249 18:9637570-9637592 CCCTTACAGAACACTAATACTGG - Intergenic
1155690338 18:28614115-28614137 CCTTGATAGAACTGTATTTCTGG + Intergenic
1156842964 18:41631017-41631039 CCCTGATATAACCCACATACTGG + Intergenic
938123822 2:128656015-128656037 CCCTGATACCACTCTGATAGGGG + Intergenic
940748463 2:157597268-157597290 CCCTGATGGAACTCCATTCCCGG + Intronic
945936944 2:215912069-215912091 ACCTGATAGAACTGTAAGGCTGG - Intergenic
948212668 2:236206663-236206685 GCCTGATTGGACTCTGATACAGG - Intronic
1172821523 20:37739026-37739048 ACCTGATAGGACTCTAATGCTGG - Intronic
1177253616 21:18629893-18629915 CCCTGATAGAACTATAAACTGGG - Intergenic
1182450928 22:30420601-30420623 CTCTGAAAGACCTCTAGTACAGG + Intronic
1183016767 22:34994933-34994955 TCTTTGTAGAACTCTAATACAGG - Intergenic
1183465939 22:37980483-37980505 CCCTGACAGAAATCTAAGCCTGG + Intronic
951022886 3:17799751-17799773 CTATGGTAGAACTCTAATACAGG - Intronic
951641201 3:24837853-24837875 CAGTGATAGAAAACTAATACAGG - Intergenic
955489907 3:59471595-59471617 CCTTTAGAGAACGCTAATACAGG - Intergenic
958706239 3:97659595-97659617 ACCTGATTGAACTCTAATTAAGG + Intronic
962979963 3:140479519-140479541 CCCTGATAGAACACAAATGTTGG + Intronic
966650016 3:182290274-182290296 CCCTCATAGAAATATATTACAGG + Intergenic
970818418 4:20185639-20185661 GCATGATACTACTCTAATACAGG - Intergenic
977021853 4:91769718-91769740 CCCTGCTAGAACTGTAAAGCGGG + Intergenic
982526789 4:156489121-156489143 CCTTGAGAGAACCCTAATACAGG + Intergenic
991945709 5:71896856-71896878 TCCTTCTAGAACCCTAATACAGG + Intergenic
995274576 5:110263431-110263453 CCATGATAGACCCCAAATACAGG + Intergenic
996197346 5:120625197-120625219 CACTGGTAGAAATCTAATTCTGG + Intronic
1000610049 5:163364322-163364344 CCCAAAAAGAACTCTACTACTGG + Intergenic
1008949195 6:57136656-57136678 TCCTGAAAGAACTCTAATTCTGG - Intronic
1012877629 6:104746771-104746793 CCCTGACAGGACTCTGATATAGG + Intronic
1015784771 6:136911224-136911246 TCCTTATAGAATTCTAAGACAGG - Intronic
1018987126 6:168646363-168646385 CCCTGAAGGAACTCAAACACAGG - Intronic
1024005027 7:45219161-45219183 CAGTAATAGAACACTAATACAGG - Intergenic
1026511447 7:71030593-71030615 CTCTAAGAGAACTCTAATACAGG + Intergenic
1032535151 7:132656989-132657011 CCTTTACAGAACCCTAATACAGG + Intronic
1036104242 8:5823302-5823324 CCCTGATAGAAGTATAACAAAGG - Intergenic
1038169927 8:25121749-25121771 CTGTGGTAGACCTCTAATACAGG - Intergenic
1040849705 8:51886739-51886761 CAGTGATAGAAAACTAATACAGG - Intronic
1041253782 8:55961209-55961231 CCTTGAGAGCACTCTAATTCCGG - Intronic
1041590585 8:59577307-59577329 CCATGATAGAAATCTAATTTAGG + Intergenic
1042693139 8:71526398-71526420 CCATGATAGATCACTAATACAGG - Intronic
1043824099 8:84903701-84903723 GCATCATAGAACTATAATACGGG - Intronic
1055418646 9:76111859-76111881 CCCTGATAGATCTATAGCACTGG - Intronic
1188340414 X:28994021-28994043 CCCTGATAGAGCTTTCATTCTGG + Intronic