ID: 1106989871

View in Genome Browser
Species Human (GRCh38)
Location 13:35406020-35406042
Sequence CTTTTTTTTCTGGAGATGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1005
Summary {0: 1, 1: 0, 2: 7, 3: 137, 4: 860}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106989871 Original CRISPR CTTTTTTTTCTGGAGATGGA GGG (reversed) Intronic
900727423 1:4226169-4226191 TTTTTTTTTTTTTAGATGGAGGG + Intergenic
900750726 1:4395529-4395551 CTCTTTTCTCTGTAGCTGGAGGG - Intergenic
900899947 1:5509575-5509597 CTTTTGCTTCTGGAGAAAGATGG + Intergenic
901603064 1:10437403-10437425 TTTTTTTTTTTGGAGCAGGAGGG + Intronic
901606005 1:10459952-10459974 CTTTTTTTTCTGGCCAGGGGTGG + Exonic
901836961 1:11930419-11930441 ATTTTTTTTGTGGAGACGGGAGG + Intergenic
902342804 1:15795286-15795308 CATTTTTTTCTGCAGAAGGAAGG - Intergenic
902943919 1:19820246-19820268 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
903080951 1:20812249-20812271 TTTTGTTTTCTTGAGATGGTGGG - Intronic
903526888 1:23997496-23997518 ATTTTTTTTTTAGAGATGGGGGG + Intergenic
903567855 1:24282453-24282475 CATTTTTTTGTGGAGATGGGGGG + Intergenic
903704621 1:25276521-25276543 TTTTTTTTTTTAGAGATGGGGGG - Intronic
903722611 1:25416800-25416822 TTTTTTTTTTTAGAGATGGCGGG + Intronic
904108499 1:28106403-28106425 TTATTTTTTGTAGAGATGGAAGG - Intergenic
904596511 1:31649571-31649593 TTTTTTTTTTTGGAGGTGGGGGG - Intergenic
904687409 1:32270707-32270729 TTTTTTTTTTTTGAGACGGACGG + Intronic
905634891 1:39543887-39543909 TTTTTTTTTGTAGAGATGGTGGG - Intergenic
906097964 1:43236902-43236924 CTTTTTTTTTTGGGGGGGGATGG - Intronic
906407289 1:45552181-45552203 ATTTTCTTTTTAGAGATGGATGG + Intronic
907144372 1:52219147-52219169 CTGGTTTTTCTGGGGATGGGGGG + Intronic
907283593 1:53366675-53366697 TTTTTTTTTGTAGAGATGGAGGG + Intergenic
907375850 1:54039016-54039038 TTATTTTTTGTAGAGATGGATGG + Intronic
907973246 1:59405601-59405623 GATTTTTTTTTAGAGATGGATGG + Intronic
908018307 1:59870737-59870759 CTTTTTTCTCTAGATATGGTGGG + Intronic
908299198 1:62745259-62745281 TTTTTTATTCTGGAGATATAGGG + Intergenic
908841181 1:68281645-68281667 TTTTTTTTTTCCGAGATGGAGGG - Intergenic
908903171 1:68979486-68979508 CTTTCTTTGCTGGGGAGGGAAGG + Intergenic
909201925 1:72700711-72700733 TTTTTTTTTTTTGAGATGGGGGG - Intergenic
909462883 1:75939303-75939325 CTTTTTTTCTAGGAGATGGAAGG - Intergenic
910449684 1:87332263-87332285 CTGTCTTTCCTGGAGATGGGGGG + Intronic
910558902 1:88568513-88568535 TTTTTTTTTGTGGAGATGATAGG - Intergenic
911160273 1:94676885-94676907 CTTTTATATCTTCAGATGGAGGG + Intergenic
911866028 1:103023371-103023393 TTTTTTTTTTTTGAGATGGATGG + Intronic
912281913 1:108324547-108324569 TTTCTTTTTGTAGAGATGGAGGG - Intergenic
912350515 1:109008273-109008295 CTTTTTTTTTTGGAGTGAGATGG + Intronic
913529664 1:119724722-119724744 ACTTTTTTTCTGGAGGTGGAAGG + Intronic
914774651 1:150725618-150725640 CTTTTTTTTCTTTAGAGGCAAGG + Intergenic
914859570 1:151374729-151374751 ATTTTTTTTGTAGAGATGGGGGG + Intergenic
916315621 1:163444899-163444921 CTTTTTTTTCTGGAGGTTTATGG + Intergenic
916422593 1:164650804-164650826 TTTTTTTTCTTGGAGGTGGAAGG - Intronic
916550071 1:165841538-165841560 CTTTTCTTTCAGGAGCAGGAAGG - Intronic
916664265 1:166951219-166951241 CTTTATCCTCTTGAGATGGAAGG + Intronic
916943785 1:169703563-169703585 CTTTATTTTCTTGAGAATGATGG + Intronic
917144196 1:171870432-171870454 TTTTTTGTTTTTGAGATGGAGGG - Intronic
917882899 1:179356857-179356879 TTTTTTTTTTTAGAGATGGGGGG + Exonic
918162625 1:181915427-181915449 CTTTTTTCTCTGGATCTGAAGGG - Intergenic
918682247 1:187370222-187370244 CTTTTCTTTCTGGATATGATGGG - Intergenic
918736401 1:188069444-188069466 TTTTTTTTTCTGCACATGGTTGG + Intergenic
919120539 1:193334735-193334757 CTTTCTTTACTGGAGACAGAAGG - Intergenic
919156603 1:193774135-193774157 ATTTTTTTTATGGAAATGAATGG + Intergenic
919246995 1:195001592-195001614 CTTTTCTTTTTTTAGATGGATGG + Intergenic
920070014 1:203296091-203296113 GTTTTTTGTCTGGAGATAAAGGG + Intergenic
920585209 1:207152473-207152495 GTTTGTTTTTTAGAGATGGAGGG - Intergenic
920773909 1:208917109-208917131 CTTTTCTTTCTGTAGCTTGAAGG - Intergenic
921231451 1:213076541-213076563 CTCTATTTTCTAGAGATTGAGGG + Intronic
921414857 1:214873968-214873990 CTTATTTTTCTGGAAATAGAAGG + Intergenic
921635647 1:217489107-217489129 TTTTTTTTGGTAGAGATGGAGGG + Intronic
921698810 1:218244201-218244223 TTTTTTTTTTTTGAGATGGGGGG + Intergenic
921825321 1:219666158-219666180 CTTCTTTTTCTTTAGAAGGAGGG - Intergenic
921920699 1:220666111-220666133 CTTGTTTTTTTGGAGATGGAGGG - Intergenic
922276971 1:224088259-224088281 CTTTTTTTTTTTTAGATGGAGGG + Intergenic
922399895 1:225242049-225242071 CATTTGTTTTTAGAGATGGATGG - Intronic
923087243 1:230710969-230710991 CTTTTTTTTGTAGACATGAATGG - Intronic
923747126 1:236711668-236711690 CTTTTCTTTCTGGGGATAGATGG + Intronic
923968215 1:239168072-239168094 TTTTTTTTTTTTGAGATGAAGGG - Intergenic
924199919 1:241647979-241648001 CTTTTTATTCTGAAAATGTAAGG + Intronic
924291244 1:242538517-242538539 CATTTCTCTCAGGAGATGGAAGG + Intergenic
924319672 1:242836393-242836415 TTTTTTCTTCTGCAGATGGCAGG - Intergenic
924464033 1:244284336-244284358 TTATTTTTTGTGGAGATGGGGGG + Intergenic
924541378 1:244983959-244983981 CTTTTTTTTCTGGAGAGACAGGG + Intronic
1063226590 10:4020630-4020652 ATGTTTTCTCTTGAGATGGAAGG - Intergenic
1063915161 10:10874137-10874159 CATTTTTTTTTGGAGAGGCAGGG - Intergenic
1064113028 10:12554715-12554737 TTTTTTTTTTAAGAGATGGAGGG + Intronic
1064179976 10:13106001-13106023 CCTTTTTTTCTGAAAATGAAAGG - Intronic
1065003065 10:21354757-21354779 GTTTCTTTTCTTGAGATGGTGGG - Intergenic
1065022798 10:21514906-21514928 TTTTTTTTTCTGGAGTAGGGTGG - Exonic
1065239166 10:23687729-23687751 TTTTTTTTTTCTGAGATGGAGGG - Intergenic
1065548803 10:26849299-26849321 TTTTTTTTTCTGTGGATGGTTGG - Intronic
1065961023 10:30734405-30734427 CTAATTTTTGTAGAGATGGAGGG - Intergenic
1066094213 10:32056886-32056908 CATTTTTGTCTGGGGGTGGAGGG + Intergenic
1066179932 10:32951423-32951445 TTTTTTTTTCAGGACAGGGAGGG - Intronic
1066928180 10:41723656-41723678 TTTTTTTATCTGGAGATGTTCGG - Intergenic
1068093590 10:52462875-52462897 CATTTTTTTCTTTAAATGGAAGG + Intergenic
1068158753 10:53236116-53236138 TTTTTTTTTCTGTAAAAGGAGGG + Intergenic
1068521040 10:58077777-58077799 CTTTTTCTTTTTGAGATGGGAGG - Intergenic
1069535956 10:69253294-69253316 CTGTCTGTTCTGCAGATGGAGGG + Intronic
1070002073 10:72386184-72386206 CTTTTTTTTTTGGAGGGGGACGG + Intronic
1070009204 10:72455870-72455892 CACATTTCTCTGGAGATGGAAGG + Intronic
1070154287 10:73824206-73824228 TTTTGTCTTCTGGAGATGGCTGG - Intronic
1070376700 10:75839414-75839436 CTTCTTTTTCTGAAGAAGTAAGG + Intronic
1070620671 10:78008001-78008023 CTTTTTTTTGGGGGGAGGGAGGG + Intronic
1071238511 10:83677772-83677794 CTTCTTTTGCTGGGGATGCATGG + Intergenic
1071542381 10:86498400-86498422 CTTTTTTTTCGGGGGAGGCAGGG + Intronic
1072230984 10:93413814-93413836 ATTTTTTTTGTAGAGATGGGGGG - Intronic
1072244690 10:93532593-93532615 TTATTTTTTGTAGAGATGGAGGG - Intergenic
1072343061 10:94474493-94474515 GTTTTTTTTTTGGAGGTGGAGGG - Intronic
1073065053 10:100753360-100753382 CTTTTTGCTCTGAAGAGGGAAGG + Intronic
1073803435 10:107068903-107068925 CTTTTTTTTCTTGGGGTGGAGGG + Intronic
1074090249 10:110246149-110246171 ATTTTTTTGGTAGAGATGGAGGG - Intronic
1074332857 10:112536588-112536610 ATTTTTTTTTTGCAGAGGGAGGG + Intronic
1074779706 10:116792602-116792624 TTTTTTTTTTTGTAGATGCAAGG - Intergenic
1074782761 10:116813704-116813726 TTTTTTTTTGTAGAGAGGGAGGG - Intergenic
1074966871 10:118498695-118498717 CTTCTTTCTCTGGAAATGTAGGG - Intergenic
1075220475 10:120580272-120580294 GATCTTTTTCTGGAAATGGATGG + Intronic
1075290407 10:121225160-121225182 TTTTTTTTTGTAGAGATGGGGGG + Intergenic
1077088362 11:765992-766014 CTATTTTTTGTAGAGATGGGGGG + Intergenic
1077507018 11:2934411-2934433 TTTTTTTTTGTAGAGATGGGGGG - Intergenic
1077621570 11:3729532-3729554 TTTTTTTTTTTGGAGATACAGGG - Intronic
1077621912 11:3732932-3732954 CTTTTTTGTATGGATATGTAGGG - Intronic
1078031982 11:7761872-7761894 ATTTTTTTCCTGGAAAAGGAAGG + Intergenic
1078223431 11:9370839-9370861 TCTTTTTTTTTGGAGATGGATGG - Intergenic
1078310440 11:10235893-10235915 CTATTATTTGTGGAGATGGGGGG - Intronic
1078704271 11:13724371-13724393 TTTTTTTTTCTGTAGAGAGAGGG - Intronic
1078948355 11:16097798-16097820 CTTTTGTTTCTGCAGATGTTTGG - Intronic
1079328787 11:19517035-19517057 TTTTTTTTTTTGGAGAGAGAGGG - Intronic
1079500661 11:21097965-21097987 TTTTTTTTTTTGGAGTTGGGAGG - Intronic
1079622688 11:22573160-22573182 CTATTTTTTATGGAGAAGAAAGG - Intergenic
1080607652 11:33877030-33877052 CTTTCTTTGCTGGACATAGATGG + Intronic
1080797348 11:35577205-35577227 TTTTTATTTGTAGAGATGGATGG - Intergenic
1080942789 11:36938432-36938454 CTTTTTTATTTGGAGTTTGAAGG - Intergenic
1081348069 11:42014885-42014907 CTTTTTTGTGTGAAGATGAAGGG - Intergenic
1081492836 11:43580801-43580823 CTTTTTTTTCAGAAGGGGGAGGG - Intronic
1082232288 11:49782129-49782151 CTTTTAATTCTGGAGAAGGAGGG + Intergenic
1082704648 11:56478594-56478616 TTTTTTTTTTTTGAGATGGGTGG - Intergenic
1082902036 11:58265863-58265885 CTTTTTTTTTTTGAGACCGAGGG + Intergenic
1083336969 11:61928149-61928171 TTTTTTTTTCTGTAGCAGGAAGG - Intergenic
1083343599 11:61974484-61974506 GTTTTTTTTTTGGAGAGAGAGGG - Intergenic
1083343645 11:61974761-61974783 TTTTTTTTTTTGGAGAGAGAGGG - Intergenic
1083539361 11:63501663-63501685 TTTTTTTTTTTTGAGATGGATGG + Intergenic
1084063833 11:66692247-66692269 ATTTTTTTTGTAGAGATGGGGGG + Intronic
1084916320 11:72431700-72431722 CATTTTTTTCTGCAGAGTGAAGG - Intronic
1085009665 11:73129577-73129599 CTTGTTTTTCTGCAACTGGACGG - Intronic
1085255568 11:75170776-75170798 CTTTTCTTTCAGGGGAGGGAGGG - Intronic
1085280818 11:75329274-75329296 GTATTTTTTATAGAGATGGAGGG + Intronic
1085559993 11:77462821-77462843 TTTTTTTTTTTGGAGATGGAGGG - Intronic
1085585223 11:77696684-77696706 CTTTTTTTTCTTGATTTAGAAGG + Intronic
1086294892 11:85354134-85354156 CTTTATTTTGTGGAGATATAGGG - Intronic
1086518181 11:87638736-87638758 TTTTTTTTTTTGTAGATGCAGGG + Intergenic
1086618341 11:88851820-88851842 CTTTTAATTCTGGAGAAGGAGGG - Intronic
1086790007 11:91025221-91025243 TTTTTTTTTCTGTAGATACAGGG - Intergenic
1086986827 11:93260333-93260355 CACTTTTTTTTTGAGATGGATGG - Intergenic
1087148066 11:94831856-94831878 CTTTTTCTCCAGGAAATGGAAGG + Intronic
1087336272 11:96848655-96848677 CTTTTTTTCCAGGACAAGGAAGG + Intergenic
1087569021 11:99900355-99900377 GTTTTTTTTCCAGAGATGCAAGG - Intronic
1087926317 11:103922749-103922771 ATTTTTTTTTTAGAGATGGGGGG + Intronic
1088268683 11:108011631-108011653 TTTTTTTTTTTGGAGGGGGACGG + Intronic
1088577007 11:111282091-111282113 TTTTTTTTTCTGTAGAAGGCAGG - Intronic
1089393721 11:118119955-118119977 GTTTCTGTTCTGGAGATGGATGG - Intronic
1089597576 11:119590845-119590867 CATCTTTTCCTGGAGGTGGAAGG + Intergenic
1090558423 11:127901944-127901966 TTTTTTTTTTTGGAGAGGCAAGG + Intergenic
1091178812 11:133584713-133584735 TTTTTTTTTTTGGAGAAGAATGG - Intergenic
1091652543 12:2320633-2320655 CTTTTCTCTCTGGGGGTGGATGG + Intronic
1091701619 12:2667078-2667100 GTTCTTTTCCTGGAGTTGGAAGG + Intronic
1091734809 12:2911954-2911976 TTTTTTTTTTAAGAGATGGAGGG - Intronic
1091736353 12:2925161-2925183 CTTTTTTTTTTTGAGACGGACGG - Intronic
1092115361 12:5997752-5997774 TTTGGTATTCTGGAGATGGAAGG - Intronic
1092139360 12:6172078-6172100 CTTGCTTTCCTGCAGATGGATGG + Intergenic
1093691589 12:22115395-22115417 CTTGTTTTTCAGGAGACAGAAGG - Intronic
1093946703 12:25117944-25117966 TTTTTTTTTTTTGAGACGGAGGG + Intronic
1093974646 12:25407913-25407935 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
1093995646 12:25639447-25639469 CTTTTTATTGTTGAGTTGGAAGG - Intronic
1094006246 12:25754984-25755006 TTTTTTTGTCAGGAGATGGAGGG - Intergenic
1094569066 12:31626102-31626124 TTTTTTTTTTTTGAGACGGAGGG - Intergenic
1095080344 12:37992350-37992372 CTTTTTTTTCTGGAAATATTTGG - Intergenic
1095139263 12:38641539-38641561 CTTTTTTTTTTGCAGTTGCAAGG - Intergenic
1096846673 12:54411169-54411191 TTTTTATTTCTGGAGACAGATGG + Intronic
1097471987 12:60004936-60004958 TTTTTTTTTGTAGAGATGGGTGG + Intergenic
1097680464 12:62644290-62644312 GTTTTTTTTCTGGAGACCCAGGG - Exonic
1097959134 12:65515272-65515294 TTTTTTTTTCTGTGGAGGGAAGG - Intergenic
1098088398 12:66873353-66873375 CTTTATTTTCCGAAGATGGATGG - Intergenic
1098127685 12:67317485-67317507 TTTTTTTTTTTTGAGATTGATGG + Exonic
1098214212 12:68198745-68198767 TCATTTTTTCCGGAGATGGAAGG - Intergenic
1098236889 12:68426053-68426075 ATTTTTTTTGTAGAGATGGCGGG - Intergenic
1098258561 12:68644242-68644264 CTTTTTTATATTGACATGGAGGG + Intronic
1098311467 12:69153321-69153343 TTTTTGTTTCTGGAGTAGGACGG + Intergenic
1098361174 12:69655679-69655701 CTTCTTCTTCTGGGGCTGGAGGG + Exonic
1098740918 12:74172016-74172038 CTTTTTTTCCTGGGTAAGGAGGG - Intergenic
1099325329 12:81208009-81208031 CTTTGTGTTCAGGAGATGGTAGG - Intronic
1099708445 12:86187739-86187761 TTTTTTTTTTTGCAGTTGGAAGG - Intronic
1099841994 12:87977507-87977529 CTTTGTTTACTGTAGATGAAAGG + Intergenic
1099932060 12:89086307-89086329 CTTGTATGTTTGGAGATGGAAGG - Intergenic
1099953756 12:89332398-89332420 CTTTTTTTTTTGTAGGGGGAGGG - Intergenic
1100154128 12:91777196-91777218 TTTTTTTTTGTAGAGATGGAGGG + Intergenic
1100435131 12:94564373-94564395 TTTTTTTTTTTTGAGATGGCAGG + Intergenic
1100458155 12:94772674-94772696 CATTTTTCTCTAGAGTTGGAAGG - Intergenic
1100833747 12:98545137-98545159 TTTTTTTTTTTGGAGTGGGAGGG + Intronic
1101068607 12:101049488-101049510 TTTTTTTTTTTTGAGATAGATGG + Intronic
1101142714 12:101812583-101812605 CATTTTTTTGTAGAGATGGGGGG - Intronic
1101182406 12:102233542-102233564 CTGGGTTTTCTGGAGAGGGAGGG + Intergenic
1101199749 12:102422134-102422156 CTTTTTAGTCTGTAGATCGATGG + Intronic
1101248387 12:102907612-102907634 TTTTTTTTTGTGGGGAGGGAGGG + Intronic
1101288319 12:103339502-103339524 CACTTTTTTATGGACATGGATGG - Intronic
1101391552 12:104304965-104304987 GTTTTTTTTCTGAAGTTAGATGG + Exonic
1101608453 12:106268354-106268376 TTTTTTTTTTTTGAGATGGATGG - Intronic
1101664306 12:106796372-106796394 TTTTTCTTTTTAGAGATGGAGGG - Intronic
1101991956 12:109493335-109493357 CTTGTGTCTCTGGAGGTGGAGGG - Intronic
1102489717 12:113282749-113282771 TTTTTTTTTCTTGAGATAGGGGG - Intronic
1103031390 12:117616451-117616473 CTCTTTTCTCTGGAGATGTGAGG + Intronic
1103288330 12:119822054-119822076 GTTTTGTTTTTGGTGATGGAGGG - Intronic
1103543682 12:121684252-121684274 TTTTTTTTTCTGGAGAAAGAGGG - Intergenic
1103594269 12:122014124-122014146 CTTTCTTTTCTGTAAAAGGAGGG + Intergenic
1103854596 12:123957712-123957734 TTTTTTTTTTTTGAGATGGGGGG + Intronic
1103917471 12:124383523-124383545 TTTTTTTTTTTTGAGTTGGAAGG - Intronic
1104027411 12:125038245-125038267 TTTTTTTTTTTTGAGATGGCTGG - Intergenic
1104354007 12:128069107-128069129 CTTTGTTTTGTAGAGATGGGGGG + Intergenic
1104467421 12:129002129-129002151 CTTTATTTTTTGCCGATGGAAGG + Intergenic
1104504552 12:129319040-129319062 CCTTTTTTTCCGCAGCTGGAAGG - Intronic
1105219468 13:18312329-18312351 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1105715807 13:23063779-23063801 CTTTTTTTTCAGTAGAGGCAGGG + Intergenic
1106156575 13:27163386-27163408 CTTTATTATGTGGACATGGAGGG - Intronic
1106740423 13:32635207-32635229 TTTTTTTTTGTGGAGATGGGGGG + Intronic
1106847898 13:33756605-33756627 TTTTTTTTTTTGGAGATGGGGGG - Intergenic
1106989871 13:35406020-35406042 CTTTTTTTTCTGGAGATGGAGGG - Intronic
1107083275 13:36397777-36397799 TCTTTTTTTTTGGAGATGAATGG - Intergenic
1107201616 13:37726189-37726211 CTTTTTTTTTTGGGGGGGGACGG - Intronic
1107452908 13:40527688-40527710 TTTTTTTTTTTGGAGACGGACGG - Intergenic
1108069045 13:46608538-46608560 CTTCTTTTCCTGCAGAAGGATGG - Intronic
1108266140 13:48710901-48710923 CCTTTTTTTCAGGAAATGAAGGG + Exonic
1108898429 13:55365467-55365489 TTTTTTTTTCTGGAGGAGGTGGG - Intergenic
1109562535 13:64071417-64071439 CATTTTTTTCTGGAGGTTGTAGG + Intergenic
1110112085 13:71760345-71760367 CTTTTTCTTCTGGAGATAAGTGG - Intronic
1110145513 13:72185885-72185907 CTTCTTTTTCTGTAAAAGGAAGG - Intergenic
1110155625 13:72313355-72313377 CTTTCTTTTGGGGAGATGGAAGG - Intergenic
1110198194 13:72815418-72815440 CTTTTCTTGCTAGAGATGAACGG - Intronic
1110312139 13:74062789-74062811 CTTTTGTTTCTAGAGCTAGATGG - Intronic
1110413846 13:75231264-75231286 CTTCTCTTTCTTGAGGTGGAGGG - Intergenic
1110546775 13:76764862-76764884 CTTTTTTTTCTGGTGTTAGTGGG - Intergenic
1110916275 13:81025019-81025041 CGTTTTATTCTGGGGATGCAGGG + Intergenic
1111497893 13:89076957-89076979 CTTTTTTTTTTGGAGAAGATGGG + Intergenic
1111679259 13:91424299-91424321 CTTTTTTTTTTGGTGGTGGTGGG + Intronic
1112237551 13:97649969-97649991 CTTTGTTATCTGGCGATGGCTGG - Intergenic
1112699322 13:101987212-101987234 CTTTTTTTCCTGGAGTGGGATGG - Intronic
1113114234 13:106857908-106857930 TTTTTTTTTTTGGAGAGGCAGGG - Intergenic
1113212570 13:108001005-108001027 ATTTTTTTTCCTGTGATGGAAGG - Intergenic
1113316423 13:109184771-109184793 CTTTTTTTTTTTGAAATGGATGG + Intronic
1113568078 13:111331410-111331432 CTTTTTATTATGGAGTTGTATGG + Intronic
1113712402 13:112476612-112476634 TCTGTTTTTCTTGAGATGGAGGG - Intergenic
1113860234 13:113478543-113478565 TTTCTATTTCTTGAGATGGAAGG + Intronic
1114233465 14:20803835-20803857 CCTTTTTTTCTGGGTATGGGGGG - Intergenic
1114441507 14:22751945-22751967 TTTTTTTTTTTGGAGATGGCAGG + Intergenic
1114597182 14:23923376-23923398 ATATTTTTTGTGGAGATGGCAGG - Intergenic
1114746996 14:25159684-25159706 CTTTTTTGTCTCTAGTTGGAAGG + Intergenic
1114979490 14:28144764-28144786 CTTTTTTTTGTGGGGGTGGAGGG - Intergenic
1115214304 14:30999218-30999240 TTATTTTTTGTGGAGATGGGGGG + Intronic
1115290782 14:31769782-31769804 TTTTTTTTTCAGTAGTTGGAAGG + Intronic
1115661978 14:35505062-35505084 ATTTTTTTTCTGAAGAAGGTTGG + Intergenic
1116411157 14:44625580-44625602 CTTTTTCTTCTGTAGATACAGGG + Intergenic
1116420748 14:44728924-44728946 GTTTTCTTTCTGGAGAGGGAAGG + Intergenic
1117460773 14:55942669-55942691 CTTTGTCTACTGGAGATGGGAGG - Intergenic
1117535933 14:56703347-56703369 TTTTTTTTTGTGGAGGGGGATGG - Intronic
1117988267 14:61409523-61409545 CTTTTTTTGGTGGAGATGCCTGG - Intronic
1118031352 14:61821151-61821173 CTTTTTCTTGTGGAGAAGAAGGG - Intergenic
1118035937 14:61865753-61865775 ATTTTTTTTCAGCACATGGAGGG + Intergenic
1118047221 14:61983698-61983720 CTATTTTTTCTAGAGATGGGGGG + Intergenic
1118465107 14:66023808-66023830 CTTGTTTTTCTGTAGAGAGAAGG + Intergenic
1119290978 14:73494730-73494752 TATTTTTTTGTAGAGATGGAGGG + Intronic
1119567184 14:75638651-75638673 TTCTTTTTTCTGGTGAGGGATGG + Intronic
1119883755 14:78123022-78123044 CTCTGTTTTCTGGGGAGGGAAGG - Intergenic
1120320235 14:82950346-82950368 TTTTTTTTTTTTGAGACGGAGGG - Intergenic
1120393284 14:83935637-83935659 CTTTTTTTTTTGCAGAAGCATGG - Intergenic
1120693130 14:87615468-87615490 CTTTTTTTTTTGGAGGGGGGTGG + Intergenic
1120876574 14:89381135-89381157 TTTTTTTTTTTTGAGACGGAGGG - Intronic
1120923555 14:89776539-89776561 TTTTTTTTTTTGGAGAGGCAGGG + Intergenic
1120961023 14:90125054-90125076 AATTTTTTACTGTAGATGGAAGG + Intronic
1121013995 14:90537357-90537379 TTTTTTTTTGTAGAGATGGGGGG + Exonic
1121266368 14:92604931-92604953 TTTTTTTTTTTTGAGATGGAGGG + Intronic
1121762969 14:96461274-96461296 CTTTTTTTTGTAGACATGGGGGG - Intronic
1121867220 14:97373918-97373940 CTTTTTTTTCTGGTGGGTGATGG - Intergenic
1122683433 14:103485265-103485287 TTTTTTTTTTTTAAGATGGATGG + Intronic
1122737276 14:103849954-103849976 TTTTTTTTTTTAGAGATGGGGGG - Intergenic
1123045653 14:105512505-105512527 CTATTTTTTTTGGAGATGGGGGG + Intergenic
1123101592 14:105805705-105805727 ATTTTTTTTATGGAAAGGGAGGG + Intergenic
1123451529 15:20366280-20366302 CTTTTTTTTCTGGAAATATTTGG - Intergenic
1123715550 15:23027577-23027599 GTATTTTTTGTGGAGATGGGGGG - Intronic
1124074155 15:26426908-26426930 TTTTTTTTTTTGGAGAGGGGTGG + Intergenic
1124961230 15:34397132-34397154 CTTTTTTTTTTGGTGGTGGTGGG + Intronic
1124977860 15:34543356-34543378 CTTTTTTTTTTGGTGGTGGTGGG + Intronic
1125782064 15:42278216-42278238 CTTGTCTTTCTTGAGATGGTGGG - Intronic
1125823609 15:42656315-42656337 TTTTTTTTTTAGGAGATGGCTGG - Intronic
1126154992 15:45557698-45557720 CTGATATTTCAGGAGATGGAGGG - Intergenic
1126177475 15:45750641-45750663 GTTTTCTTTCTTGAGCTGGATGG - Intergenic
1126461022 15:48914844-48914866 AGTTCTGTTCTGGAGATGGATGG - Intronic
1126482179 15:49136982-49137004 CTTTTTTTTTTTGAGAGAGAGGG - Intronic
1126663216 15:51052329-51052351 CTCCTTTTTCTGGGGCTGGAAGG + Intergenic
1127512015 15:59651857-59651879 TTATTTTTTGTGGAGATGGGTGG + Intronic
1127512138 15:59653311-59653333 CCTTTCAGTCTGGAGATGGATGG + Intronic
1127960357 15:63885917-63885939 CTATTTTTTGTAGAGATGGGGGG + Intergenic
1128499508 15:68218108-68218130 TTATTTTTTCTGGAGTTGAAGGG - Intronic
1128726512 15:69992002-69992024 CTTTCTCTTCTGGAAAAGGAGGG + Intergenic
1129021576 15:72524249-72524271 TTTTTTTTTTTTGAGATGGATGG + Intronic
1129026011 15:72574909-72574931 TTTTTTTTTGTAGAGATGGGCGG - Intronic
1129044510 15:72721980-72722002 CTTTTCTTTCTGTAGATCAAAGG + Intronic
1129135722 15:73548867-73548889 ATATTTTTTGTAGAGATGGATGG + Intronic
1129806815 15:78468249-78468271 GTCTTTTTTTTTGAGATGGAGGG + Intronic
1129810906 15:78508869-78508891 TTTTTTTTTTTGGAGAGAGAGGG - Intronic
1130101123 15:80894932-80894954 TTTTTTTTTATAGAGAAGGAAGG - Intronic
1130235687 15:82131465-82131487 ATTTTTTTTCTGGAGGTGGTGGG + Intronic
1130529928 15:84739327-84739349 ATTTTTTTTTAAGAGATGGAGGG + Intergenic
1130559860 15:84949578-84949600 TTTTTTTTTTTAGAGATGGCGGG + Intergenic
1131494970 15:92900232-92900254 TTTTTTTTGGTGGAGATGAAGGG + Exonic
1132589449 16:720344-720366 TGTTGTTTTCTGGAGAAGGAAGG + Intronic
1132849112 16:2016477-2016499 TTTTTTTTTCTTGAGAGAGAAGG + Intronic
1133325862 16:4941902-4941924 TTTTTTTTTTTTGAGATGGATGG + Intronic
1133565876 16:6992826-6992848 TTTTTTTTTTTGGAAAAGGAAGG - Intronic
1133720387 16:8489158-8489180 CTTTTTTTTCTGGAATTAGGTGG + Intergenic
1134682714 16:16137562-16137584 TTTTTTTTTTTTGAGACGGAGGG + Intronic
1134752521 16:16637348-16637370 CTTTTTTTTCTGGCGGGGGTCGG - Intergenic
1135080619 16:19431532-19431554 TTTTTTTTTTCTGAGATGGAAGG - Intronic
1135142987 16:19937435-19937457 CTGTTGTTTCTTGACATGGATGG + Intergenic
1135283365 16:21172135-21172157 TTTTTTTTTAAAGAGATGGAGGG - Intronic
1135682860 16:24473129-24473151 TTTTTTTTTTTTGAGATAGATGG - Intergenic
1136116264 16:28096838-28096860 CTTTTTCCTTTGGAGATGGAGGG - Intergenic
1136148619 16:28331442-28331464 TTTTTTTTTTTGGAGAGGCAGGG - Intergenic
1136553730 16:30996002-30996024 CCTTTTTTTGTAGAGATGGGGGG - Intronic
1136698089 16:32104660-32104682 CTTTTTTTTGTGGGGGGGGATGG + Intergenic
1137085511 16:36117265-36117287 CTTTCTTCTCTGCAGATGGCTGG + Intergenic
1137418704 16:48311792-48311814 TTATTTTTTGTAGAGATGGAGGG + Intronic
1137753352 16:50882714-50882736 TTTTATTTTTTAGAGATGGAAGG + Intergenic
1138025808 16:53521679-53521701 CTTTTTTTTTTGGCGGTGGAGGG - Intergenic
1138833510 16:60405025-60405047 CTTATTTTTCTGCTGATGAAAGG + Intergenic
1140270282 16:73459365-73459387 GTTTTTTTTTCTGAGATGGATGG + Intergenic
1140322985 16:73971914-73971936 ATTTTTTTTCTGGACAGGGGAGG + Intergenic
1141328698 16:83087661-83087683 TTTTTTTTTTTTGAGACGGAGGG - Intronic
1141331222 16:83113096-83113118 TTTTGTTTTCTGGAGTTGCATGG - Intronic
1141338664 16:83181808-83181830 TGTATTTTTCTGGAGAGGGAAGG + Intronic
1141722643 16:85765349-85765371 CTTTTTTCTCGGGAGCTGCAGGG - Intergenic
1141909298 16:87047647-87047669 CTTTTTTTTCTGCAGGAGGGTGG - Intergenic
1142206678 16:88786103-88786125 TTTTTTTTTTTTGAGCTGGAGGG - Intergenic
1142552580 17:750184-750206 TTTTTTTTTTCGGAGATGGAGGG - Intronic
1142689466 17:1596553-1596575 CTTTTTATTATTGAGATGTAGGG - Intronic
1142833665 17:2568347-2568369 TTATTTTTTTTTGAGATGGATGG - Intergenic
1142888655 17:2929060-2929082 TTTTGTTTTTTAGAGATGGAGGG - Intronic
1143553668 17:7647509-7647531 CTTTCTTTTTTAGAGATGGGGGG - Intronic
1143581400 17:7829440-7829462 CTTACTTTCCTGGAGATGCAAGG - Intronic
1143645078 17:8224648-8224670 TTTTTTTTTTTTGAGACGGAGGG - Intergenic
1144075598 17:11716721-11716743 CTCTTTTCTCTGGAGCTGCAGGG - Intronic
1145093737 17:20007799-20007821 TTTTTTTTTGTAGAGATGGGGGG + Intergenic
1145222024 17:21097280-21097302 CTTTTTTTGCTGGTGGTGGAAGG + Intergenic
1145364178 17:22240961-22240983 CTTTTTTTTGTGGATCTAGAGGG - Intergenic
1145838584 17:27974551-27974573 CTTTATTTTCTGGACAGGGTAGG + Intergenic
1147038867 17:37701906-37701928 CTTTCTGTTCTGGAGATGTCAGG + Intronic
1147293102 17:39459580-39459602 TATTTTTTTGTAGAGATGGAGGG - Intergenic
1147671715 17:42180461-42180483 CCTTTTTTTCTGGAGGTAGTGGG + Intronic
1147917986 17:43900132-43900154 CTTTTTTTTCTGGAGAAGGCAGG - Intronic
1148657651 17:49299856-49299878 TTTTTTTTTCTGTAGAGGCAGGG + Intronic
1148908152 17:50924599-50924621 CTTTTTTTGCTGGGGAGAGATGG + Intergenic
1148943149 17:51233049-51233071 TTTTTTTTTTTGGTGAGGGAAGG - Intronic
1148968022 17:51454153-51454175 CTTTTTTTTTTAGAGATGGTGGG + Intergenic
1149382427 17:56107339-56107361 CCTTTTTTTGGGGACATGGATGG - Intergenic
1149776227 17:59359345-59359367 CTTTTTTTTCTCTAGATGTCTGG + Intronic
1149833487 17:59891957-59891979 TTTTTTTTTCTGGAGACAGGAGG - Intronic
1149888388 17:60363848-60363870 CTTTGTTTTTGGGAGAAGGAAGG + Intronic
1149949328 17:60968566-60968588 CTTTTTTTTTTGGATATAGGTGG + Intronic
1150259413 17:63776112-63776134 CTTGTATTTTTGGAGGTGGAAGG - Intronic
1150380269 17:64714574-64714596 TTTTTTTTTTTTGAGATGGATGG - Intergenic
1150741492 17:67782242-67782264 ATTTTTTTTGTAGAGATGGGGGG - Intergenic
1150961553 17:69918483-69918505 CTTTTTTTTTTGGAGGGGCAGGG + Intergenic
1151005341 17:70429677-70429699 TTTTTTCTTTTTGAGATGGATGG + Intergenic
1151042389 17:70877587-70877609 TTTTTTTTTCTAGAGTTGCAGGG + Intergenic
1151493469 17:74445997-74446019 TTTTTTTTTGTAGAGATGGTGGG - Intronic
1151521734 17:74635224-74635246 TTTTTTTTTCTAGAGAGAGAGGG - Intergenic
1151632975 17:75323812-75323834 TTTTTTTTTTTAAAGATGGATGG + Intronic
1151844928 17:76646065-76646087 ATTTTTTTTGTAGAGATGGGGGG + Intergenic
1151925260 17:77191166-77191188 CTTTTTTTTTTGAAGATTGCAGG + Exonic
1152109367 17:78349026-78349048 TTTTTTTTTTTTGAGACGGATGG - Intergenic
1152283048 17:79396624-79396646 CTTTTTTCTCTGGATAATGACGG - Intronic
1152679392 17:81658028-81658050 CTATTTTTTGTAGAGATGGGGGG - Intronic
1152832328 17:82505381-82505403 ATTTATTTTTTTGAGATGGATGG + Intergenic
1152990405 18:358411-358433 CTTGTTTTCCTGGAAATAGATGG + Intronic
1153276414 18:3372172-3372194 TTTTTTTTTTTAGAGATGGAAGG + Intergenic
1153329326 18:3856854-3856876 TTTTTTTTTTTGGAGGGGGACGG - Intronic
1153332892 18:3891913-3891935 CATTTTTTTGTAGAGATGGGGGG + Intronic
1154276133 18:12962222-12962244 CTTATTTTTATAGAGATGGGGGG - Intronic
1154468055 18:14669027-14669049 CTTTTTTTTCCTGAGATTCAGGG + Intergenic
1154885191 18:20279558-20279580 CTCTTTTTTTTGGATATGGAAGG + Intergenic
1155179703 18:23333808-23333830 TGTTCTTTTCTGGAGGTGGAGGG + Intronic
1155211412 18:23605372-23605394 ATTTTTTTTCTGGAGAGATAGGG + Intronic
1155272616 18:24155483-24155505 CTTTTTTTTTTGGTGGTGGTGGG + Intronic
1155469445 18:26175634-26175656 TTTTTGTTTCTGGAGGTGTATGG + Intronic
1155483565 18:26316393-26316415 TTTTTTTTCCTCAAGATGGAGGG + Intronic
1155497019 18:26452779-26452801 CTTTTTTTTTTGGAGGCGGAGGG - Intergenic
1155511561 18:26582691-26582713 CTTTCTTTTCTAGAGGTGCATGG - Intronic
1156306964 18:35886192-35886214 TTCTTTTTTTTAGAGATGGAGGG - Intergenic
1156383726 18:36587135-36587157 ATGTCTTTTCTGGAGATGGTGGG + Intronic
1156506660 18:37600156-37600178 CTTTTGTATTTGGAGCTGGAGGG - Intergenic
1157352801 18:46904744-46904766 TTTTTTTTTTTTGAGACGGATGG - Intronic
1157536993 18:48467049-48467071 CTTTATTTTTTGGAGAGGCAGGG - Intergenic
1157733351 18:50023910-50023932 TTTTTCTTTCTGAAGTTGGAAGG - Intronic
1158644779 18:59236342-59236364 CTTTTGTTTTCAGAGATGGAGGG - Intergenic
1159108171 18:64027117-64027139 TTTTTTTTAGTGGAGATGGAGGG + Intergenic
1161413297 19:4129378-4129400 ATATTTTTTGTGGAGATGGGGGG + Intergenic
1161431019 19:4232546-4232568 ATTTTTTTTCTACAGATGGGGGG - Intronic
1161514960 19:4691299-4691321 CTTTTTTTTTTGGAGAGACAGGG - Intronic
1161669701 19:5599325-5599347 CCTTTATTGCTGGAGATGAATGG - Intronic
1161822213 19:6536772-6536794 GTTTTTTTCTTTGAGATGGAAGG + Intergenic
1162014761 19:7839296-7839318 ATTTTTTTTTTTTAGATGGATGG - Intronic
1162356639 19:10189587-10189609 ATTTTTTTTTTTGAGATGGGGGG + Intronic
1162360967 19:10220190-10220212 TTTTTTTTTGTAGAGATGGGGGG - Intronic
1162366064 19:10250443-10250465 TTTTTTTTTGTAGAGATGGCGGG - Intergenic
1162663739 19:12192598-12192620 GCTTTTTTTCTGGAGGCGGAGGG + Intergenic
1162772977 19:12961141-12961163 TTTTTTTTTTTTGAGACGGATGG + Intergenic
1163357871 19:16826177-16826199 CTTCTTCTTCCGGAGATGGCAGG - Intergenic
1163563749 19:18037058-18037080 TTTTTTTTTGTAGAGATGGGGGG - Intergenic
1163569364 19:18071330-18071352 CTTTTTTTTCTTGTGACAGATGG - Intronic
1163605498 19:18273033-18273055 TTTTATTTTTTTGAGATGGACGG + Intronic
1163895674 19:20056894-20056916 ATTTTTTTTTTGGAGGGGGATGG + Intergenic
1164642432 19:29836246-29836268 CTTTTTTTTTTTAAGAAGGAGGG - Intergenic
1164904247 19:31953982-31954004 CTTTTTTTTGTAGAGATGGTTGG - Intergenic
1166830326 19:45635548-45635570 CATTTTTTTTTGGAGTGGGAGGG - Intronic
1166950384 19:46423590-46423612 TTTTTTTTTTTTGAGATGTAGGG + Intergenic
1167128648 19:47569701-47569723 ATTTTTTTTGTAGAGATGGGTGG - Intergenic
1167191465 19:47992856-47992878 TTTTTTTTTGTAGAGATGGGGGG - Intergenic
1167191488 19:47992997-47993019 TTTTTTTTTGTAGAGATGGGGGG - Intergenic
1167224451 19:48228174-48228196 CTTCTTTTTCTGCAGCTAGATGG - Intronic
1167516377 19:49925425-49925447 CTTTTTTTAGTAGAGATGGGGGG - Intronic
1167783919 19:51620858-51620880 TTTCTTTTTGTAGAGATGGAGGG + Intronic
1168112843 19:54204061-54204083 GTTCTTTTTCAGGAGATAGATGG + Intronic
926270760 2:11364343-11364365 CTTTTTTTTTTGGTGGTGGTGGG + Intergenic
926471795 2:13269284-13269306 CATTGTTTTGTGGAGAAGGAGGG - Intergenic
927160443 2:20253515-20253537 TTTTTTTTTTTGTAGAGGGAGGG + Intronic
927174488 2:20395989-20396011 CATATTTTTCTGGGGCTGGAGGG + Intergenic
927526301 2:23744287-23744309 TTTTTTTTTTTGGAGAAGGAGGG + Intergenic
927563494 2:24090552-24090574 TTTTTTTTTTTTGAGATGGGAGG - Intronic
927744230 2:25601602-25601624 CTATTTTTTTTGCAGATGAAAGG + Intronic
927902813 2:26833532-26833554 CTTTATTTTTTTGAGATGGGGGG - Intergenic
927916978 2:26943431-26943453 TACTTTTTTGTGGAGATGGACGG + Intronic
929113824 2:38427788-38427810 TTTTTGTTTTTGGAGATGGGGGG - Intergenic
929322147 2:40557034-40557056 TTTTTTTTTTTGGACATTGAGGG + Intronic
929417288 2:41756178-41756200 ATTTTTTTTTTGGTGATGGGTGG + Intergenic
929748226 2:44681545-44681567 TTTTTTTTTTTGGAGGGGGAGGG + Intronic
930103727 2:47622953-47622975 TTTTTTTTTCTGTACTTGGAGGG + Intergenic
930660090 2:54044597-54044619 CTTTTTTTTTTTGAGAGGGGCGG - Intronic
930804161 2:55473274-55473296 CATTTTTTTTAAGAGATGGAGGG - Intergenic
930953571 2:57175729-57175751 CTTTATTTTCTGCAGCTGGAAGG - Intergenic
931383875 2:61778926-61778948 TTTTTTTTTTTGTAGAGGGAGGG + Intergenic
931798415 2:65734362-65734384 TTTTTTTTGCAGGACATGGATGG - Intergenic
932270328 2:70403510-70403532 CCTTTTCTTCTGCAGCTGGAAGG + Intergenic
932289395 2:70562866-70562888 TTTTTTTTTTTTGAGATGGAGGG - Intergenic
932756113 2:74410748-74410770 TTTTTTTTTCTGGGGAGAGAAGG - Intergenic
933486212 2:82927429-82927451 TTTTTTTTTTTGGTGATTGAAGG - Intergenic
933551908 2:83788658-83788680 CTCTTTTTTCTAGGGTTGGAAGG - Intergenic
933752817 2:85613936-85613958 AATTTTTTTGTGGAGATGGGGGG + Intronic
934184580 2:89660188-89660210 CCTTCTTTGCAGGAGATGGATGG + Intergenic
934226303 2:90134157-90134179 GTTTTTTTTCTAGAGATGAGGGG + Intergenic
934231405 2:90185288-90185310 CTTTTTTTTCTACAGACGGGGGG + Intergenic
934294862 2:91734326-91734348 CCTTCTTTGCAGGAGATGGATGG + Intergenic
935032942 2:99339546-99339568 TTTTGTTTTTTGGAGATGGAGGG + Intronic
935252804 2:101279500-101279522 GTTTTCTTTCTGGAGTTGGAAGG + Intronic
935479630 2:103569930-103569952 CTTTTCTTTCTGCTGAAGGAAGG + Intergenic
936472819 2:112813958-112813980 CTTTTTCTTCTTAAGAGGGAGGG + Intergenic
936623195 2:114121088-114121110 TTTTTTTTTTTTGAGATGGGGGG - Intergenic
936855390 2:116952088-116952110 CTTTTTCTTCTTAAGATGGATGG + Intergenic
937283645 2:120736625-120736647 CTGTTTTTTCAGGGGGTGGAGGG + Intronic
937368546 2:121282507-121282529 TTTTTTTTTTTAGAGATGGTGGG - Intronic
937515951 2:122655567-122655589 TTTTTTTTTTTTGAGATGGCAGG - Intergenic
937761681 2:125612030-125612052 TTTTTTTTTCTGGAGAAAGGAGG + Intergenic
938285202 2:130107755-130107777 CTTATTTTTCTGCAACTGGATGG - Intronic
938430397 2:131231138-131231160 CTTATTTTTCTGCAACTGGATGG + Intronic
938443264 2:131354381-131354403 TTTTTTTTTTTTGAGATGGATGG + Intergenic
938823251 2:134979651-134979673 TTTTTTTTTTTGGAGAGGGTGGG + Intronic
939088606 2:137752089-137752111 CTTATTTTTATGGAAAAGGAGGG + Intergenic
939553095 2:143639790-143639812 CTTTTTATTATGGGTATGGAGGG - Intronic
939660522 2:144883182-144883204 CTTTCTTTTTTGGAGAGGCAGGG + Intergenic
939807972 2:146797204-146797226 CTTTTTCTTCTGGAAATTCATGG - Intergenic
940069584 2:149670945-149670967 CTTTCTTTTCTGGACAGGGCAGG + Intergenic
940188886 2:151017529-151017551 TTTTTTTTTTTGGAGAGGTAGGG + Intronic
940376839 2:152967258-152967280 CATTCTTTTCTGGAAATGGCTGG - Intergenic
940483717 2:154270707-154270729 TTTTTTTTTCTTCAGATGAAAGG + Intronic
941298130 2:163766354-163766376 CTTTTGGGTCTGGAGCTGGATGG - Intergenic
941435986 2:165473370-165473392 CTCTTATTGCTGGAAATGGAGGG + Intronic
941662746 2:168212164-168212186 CTTTTGTTTCTGTAAAAGGAAGG - Intronic
941790577 2:169547985-169548007 TTTTTTTTTTTTGAGACGGAGGG - Intronic
941959184 2:171236837-171236859 CTTTTCTAACTGGAGATGAAAGG + Intergenic
942257533 2:174119155-174119177 TTTTTATTACAGGAGATGGAAGG - Intronic
942544798 2:177052450-177052472 TTTTTTTTTGTGGATTTGGATGG - Intergenic
942721565 2:178958883-178958905 TTTTTTTTTTTGGAGAGAGAAGG + Intronic
943588579 2:189769384-189769406 CTTTTTTTTTTTGAGATGGCTGG - Intergenic
943731544 2:191307962-191307984 TGTTTTTTTGGGGAGATGGAGGG - Intronic
943878853 2:193112506-193112528 CATTTTTTTCTGCATGTGGAAGG - Intergenic
943914826 2:193617218-193617240 CAATTTATTCTGGAGAAGGAAGG + Intergenic
943942544 2:194018551-194018573 CCTTTTTTTTTTGAGGTGGAAGG + Intergenic
944029827 2:195222016-195222038 GTTCTTTTTAGGGAGATGGATGG + Intergenic
944225176 2:197342377-197342399 TTTTTTTTTTTGGAGATGGGGGG - Intergenic
944591025 2:201218091-201218113 TTATTTTTTGTAGAGATGGAGGG + Exonic
944640252 2:201717467-201717489 TTTTTTTTTTTGGAGGTGGGAGG - Intronic
944815204 2:203369139-203369161 CTTGGTTTTCTGTAGAAGGAGGG + Intronic
945592030 2:211745702-211745724 GTTTTTTTTCTGGCGGTGGAGGG - Intronic
946543720 2:220714111-220714133 CTTTTTTTTGTGGGGGTGGTTGG + Intergenic
946853857 2:223933785-223933807 TTTTTTTTTGTAGAGATGGGGGG - Intronic
946891882 2:224285138-224285160 CATTTATTCCTGGAGAAGGAGGG - Intergenic
946917836 2:224543978-224544000 CTTTTTTTTTTTGAAATGGGAGG - Intronic
947210298 2:227702400-227702422 TTTTTTTTTTTTGAGATGGAGGG + Intronic
947247806 2:228069454-228069476 TTTTTTTTTTTAGAGATGGGGGG + Intronic
947457130 2:230265376-230265398 CTTTTTCTTCTGCAGCTGGGAGG - Intronic
948217517 2:236242844-236242866 TTTTTTTTTGTAGAGATGGGGGG - Intronic
948418002 2:237830910-237830932 TTTTTTTTTTTGTAGATAGACGG - Intronic
1169440384 20:5628839-5628861 TTTTTTTTTTTTGAGACGGAGGG - Intergenic
1169633843 20:7665120-7665142 TTTTTTTTTCTGCAGATGCCAGG - Intergenic
1169982173 20:11396892-11396914 CTTTTTTTTGTGGGGGGGGAGGG - Intergenic
1170136567 20:13080500-13080522 GTTTTTTTTTTGGAGATGGATGG - Intronic
1170478338 20:16739471-16739493 CTTTTTTTTTTCCAGATGGCGGG + Intronic
1170965120 20:21061412-21061434 GTATTTTTACTGGAGATGGATGG - Intergenic
1171126728 20:22608906-22608928 TTTTTTTTTCTGGTGGCGGAGGG + Intergenic
1171362835 20:24601628-24601650 TTATCTTTTCTGGGGATGGATGG + Intronic
1172080577 20:32337690-32337712 TTTTTTTTTTTTAAGATGGATGG - Intergenic
1172084996 20:32374464-32374486 ATTTTTTTTATAGAGATGGAGGG + Intronic
1172127059 20:32630782-32630804 TTTTTTTTTGTAGAGATGGGGGG - Intergenic
1172333208 20:34090920-34090942 TTTTTTTTGGTAGAGATGGAGGG + Intronic
1172401072 20:34651931-34651953 TTTTTTTTTGTAGAGATGGGGGG - Intronic
1172951476 20:38725694-38725716 CTTTTGTTTGTGGAGCTGTAGGG - Intronic
1173244097 20:41322655-41322677 CATTTTTTTGTAGAGATGGGGGG - Intergenic
1173422604 20:42915769-42915791 TTTTTTTTTCTGTAGATACAGGG + Intronic
1174088489 20:48027614-48027636 TTTTTTTTTGTAGAGATGGGTGG + Intergenic
1174578070 20:51551580-51551602 TTTTTTTTTCTGGAGAGACAAGG + Intronic
1174620508 20:51870803-51870825 CTTTTCTTTTTGGACATGGTGGG - Intergenic
1174669643 20:52294410-52294432 TTTTTCTTTCTGGGGAGGGAGGG + Intergenic
1174783583 20:53412511-53412533 CTTGTTTCCCTGGAGATGGATGG - Intronic
1175991118 20:62789758-62789780 TTTTTTTTGGTAGAGATGGAGGG + Intergenic
1176806459 21:13488623-13488645 CTTTTTTTTCCTGAGATTCAGGG - Intergenic
1176863184 21:14025648-14025670 CTTGTTCTCATGGAGATGGAAGG - Intergenic
1177065818 21:16434276-16434298 CTTTTTTTAGTGGAGGAGGAAGG - Intergenic
1177454806 21:21322952-21322974 CTATTTTTTCTTTAGCTGGAAGG - Intronic
1177468390 21:21520972-21520994 CTTATGTTTCTGGAAATAGAAGG + Intronic
1177765076 21:25448939-25448961 CATTTTTTTTTAGAGATGGGAGG - Intergenic
1177903899 21:26951669-26951691 TTTTTTTTTTTTGAGATGGAGGG - Intronic
1178137301 21:29641953-29641975 CTTTCTGTACTGGAGAAGGATGG - Intronic
1178232275 21:30799859-30799881 TTTTTTTTTCTGGCGGGGGATGG + Intergenic
1178262420 21:31112143-31112165 CTTTTTTTTTTGGCGGTGGAGGG - Intergenic
1178293247 21:31387210-31387232 TTTTTTTTTTTGGAGGTGGGGGG + Intronic
1178576629 21:33798270-33798292 TTTTTTTTTGTAGAGATGGGGGG + Intronic
1178613292 21:34106928-34106950 TTTTTTTTTTTGGCGGTGGAGGG + Intronic
1178661062 21:34508198-34508220 TTTTTTTTTCTGTAGAGGCAAGG + Intergenic
1179152111 21:38817940-38817962 ATTTATTTTCTGGAGAGGGAAGG - Intronic
1179539549 21:42075225-42075247 ATATTTTTGCTGGAGATGGGGGG + Intronic
1180817070 22:18797189-18797211 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181203259 22:21231534-21231556 CCTTCTTTGCAGGAGATGGATGG - Intergenic
1181362350 22:22347659-22347681 CTTTTTTTTCTAGATATCGCTGG - Intergenic
1181647377 22:24240079-24240101 TTGTTTTTTCTTGAGATAGAGGG - Intronic
1181687118 22:24537034-24537056 CTTTTTTTGGTGGTGGTGGAAGG + Intergenic
1181759365 22:25047475-25047497 TTTTTTTTTTTTGAGATGGATGG + Intronic
1182460450 22:30480021-30480043 CCTTTTTATCTGGGGAGGGAGGG - Intergenic
1182525924 22:30919161-30919183 CTTGTTTTCCTGGAGCTAGATGG - Intergenic
1182666521 22:31964224-31964246 ATGTTTTTTCTGGAGATTGAGGG + Intergenic
1183155765 22:36073850-36073872 CTTTTTTTTTTGTAGAGGTAGGG - Intergenic
1183524855 22:38317067-38317089 TTGTTTTTGCTGGAGAGGGAGGG - Intronic
1183574279 22:38677238-38677260 TTTTTTTTTTTTGAGATGGGAGG - Intergenic
1183908514 22:41061231-41061253 CTTTTTTTTGGGGGGGTGGAGGG + Intergenic
1183913379 22:41096151-41096173 CTTTTTTTTTTGGAGGGAGAGGG - Intronic
1183913797 22:41100053-41100075 ATTTTTTTTCTAGAGATGGTGGG - Intronic
1203223660 22_KI270731v1_random:63890-63912 CCTTCTTTGCAGGAGATGGATGG + Intergenic
1203267169 22_KI270734v1_random:22910-22932 CCTTCTTTGCAGGAGATGGATGG - Intergenic
949414852 3:3802460-3802482 CTTTTTTTTCTGGCGGGGGTTGG - Intronic
949431317 3:3979145-3979167 ATTTTTTTTGTGGGGGTGGAGGG - Intronic
949671737 3:6404018-6404040 TTTTTTTTTTTTGAGATGGATGG - Intergenic
949694373 3:6677350-6677372 ATTTTATTTCTGGAGATATAAGG - Intergenic
949879767 3:8652108-8652130 ATTTTCCTTCTGGGGATGGATGG - Intronic
950745645 3:15086080-15086102 TTTTTTTTTTTGGAGAGAGACGG - Intronic
951390339 3:22095097-22095119 TTTTTTTTTGTAGAGATGGGGGG + Intronic
951582117 3:24176131-24176153 CATTTTTTTCTAGAGATATAAGG - Intronic
951727733 3:25778876-25778898 TTTTTTTTTTTTGAGATGGGGGG + Intronic
951785127 3:26410118-26410140 TTTTTTTTTTTGGAGAGAGATGG - Intergenic
953228753 3:41044659-41044681 CTTTTTCTTTTGGAGAGGGTTGG - Intergenic
953263576 3:41363935-41363957 TTTTTTTTTCTGTAGATACAGGG + Intronic
953323478 3:41992819-41992841 GTATTTTTTGTGGAGATGGGGGG + Intergenic
953764269 3:45723460-45723482 CTTTTTCCTCTCTAGATGGACGG + Exonic
954057472 3:48039284-48039306 TCTTTTTTTCTGGAGAGGGAGGG - Intronic
954260326 3:49434026-49434048 CTTTTTTTTTTTGAGACAGATGG - Intergenic
954267381 3:49480278-49480300 TTTTTTTTTTGGGAGACGGACGG + Intronic
955632462 3:60989326-60989348 CTTTTTTTTTTGGAGAGACAGGG + Intronic
956755752 3:72384330-72384352 TTTTTTTTTTTGGAGATTGGTGG - Intronic
956772090 3:72535248-72535270 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
956864807 3:73358610-73358632 TTTTTTTTTTTTGAGACGGAGGG + Intergenic
957188012 3:76967715-76967737 TTTTTGTTTTTGGAGATGGAGGG + Intronic
957610662 3:82461144-82461166 ATTTTTTTTCTGGCGGGGGAGGG + Intergenic
957623203 3:82622775-82622797 CTGTTTTTGTTGGAGATGAATGG - Intergenic
957681487 3:83441221-83441243 CTTTTTTTTCTGGTGGGGGGTGG - Intergenic
957834047 3:85562677-85562699 CCTTTTTCTTTGGAGATGGGGGG + Intronic
957853331 3:85840287-85840309 CATTTTTTTCTAAAAATGGAAGG - Intronic
958057695 3:88434340-88434362 TTTTTTTTTCTGCATTTGGATGG - Intergenic
959094226 3:101935716-101935738 TTTTTTTTTCAAGAGAAGGACGG + Intergenic
959480893 3:106871687-106871709 TTTTTTTTTTTTGAGATGGATGG + Intergenic
959552230 3:107674914-107674936 CTTTCGTGTCTGGAGATGGCTGG - Intronic
959845264 3:111025171-111025193 TTTTTTTTTTTGGAGATAGATGG + Intergenic
960163916 3:114380490-114380512 TTTTTTTTTCTGAAGGGGGATGG + Intronic
960382046 3:116974896-116974918 TTTTTTTTTCTGGAATGGGAAGG - Intronic
960552657 3:118993894-118993916 GTTTTCTTTCTGGAGAGTGATGG + Intronic
961126232 3:124420709-124420731 CTTTTTTTTCTGGTGTTACATGG - Intronic
962172957 3:133122162-133122184 CTTTTTTTTTTGGAGGTAGAGGG - Intronic
962682979 3:137819572-137819594 TTTTTTTTTATGTAGAGGGAAGG + Intergenic
962702762 3:138015125-138015147 ATTTTATTTTTAGAGATGGATGG - Intronic
963148871 3:142023112-142023134 TTTTTTTTTTTTGAGACGGAGGG - Intronic
963861628 3:150316412-150316434 TTTTTATTTCTGGCGATGGCAGG - Intergenic
964229778 3:154452302-154452324 TTTTTTTTTTTTGAGATGGATGG + Intergenic
964574623 3:158151388-158151410 CTTTCTTTTGGGGATATGGAGGG + Intronic
964957338 3:162377522-162377544 TGTTATTTTTTGGAGATGGATGG - Intergenic
965071604 3:163922863-163922885 TTTTTTTTTTTGGAGTTAGAAGG + Intergenic
965097797 3:164256228-164256250 TTTTTTTTTTTTGAGACGGAGGG - Intergenic
965355345 3:167666582-167666604 CTTTTTTTTCTGGTGGGGGATGG + Intergenic
965602562 3:170469484-170469506 CTTTCTTTTCTGTAGGTGGGGGG + Intronic
965699340 3:171443642-171443664 TTTTTTTTTGTAGAGATGGGGGG - Intronic
965761361 3:172080448-172080470 TTTTTTTTTCTAGAGATGAAGGG + Intronic
966036911 3:175429020-175429042 TGGTTTTTTCTGGAGAGGGATGG + Intronic
966050089 3:175605338-175605360 CTTTTATTTCTAGATATGGATGG + Intronic
966310108 3:178584435-178584457 CTTTTTCTTTTGGAGAGGGAGGG - Intronic
967231940 3:187347464-187347486 TTTTTTTTTTCTGAGATGGAGGG + Intergenic
967292903 3:187938866-187938888 CTTTTTTTTGTACAGATGGTGGG + Intergenic
967656474 3:192056279-192056301 TTTTTTTTTCAGGGGGTGGATGG - Intergenic
967806736 3:193720896-193720918 TTTTTTTTTTTTGAGATTGAGGG + Intergenic
969967285 4:11010258-11010280 TTTTCTTTTCTGGAGAGTGAGGG + Intergenic
970073027 4:12183880-12183902 TTTTTTTTTTTGTAGAGGGACGG - Intergenic
970285418 4:14507869-14507891 TTTTTTTTTTTGTAGATGCAAGG + Intergenic
970598793 4:17624459-17624481 CTTTTTTTTTTTGACATAGAAGG + Exonic
970764124 4:19525758-19525780 TTTTTTTTTGTGGTGAGGGAGGG - Intergenic
971011281 4:22438584-22438606 CTTTTTTGCCTTGAGATTGAAGG - Intronic
971178687 4:24307017-24307039 CTTTTTTGTCTTAAGATTGATGG + Intergenic
971285132 4:25281690-25281712 ATTTTTTTTGTAGAGATGGGGGG - Intergenic
971522892 4:27577469-27577491 ATATTTTTTCTGGAGATGGGTGG - Intergenic
971789029 4:31143101-31143123 TTTTTTTTTTTGGAGAGGGGTGG - Intronic
971789358 4:31148402-31148424 TTTTTTTTTTTGGAGAGGCAGGG + Intergenic
972133725 4:35865421-35865443 TTTTTTTTTCTGGAGAGAAAAGG - Intergenic
972303595 4:37809979-37810001 GTTTTAGTTCTAGAGATGGATGG + Intergenic
972407025 4:38756670-38756692 TTTTTTTTTTTGGAGAGGAAAGG + Intergenic
972480341 4:39490608-39490630 TCTTTTTTTCTGGAGTTGAAGGG - Intergenic
973557910 4:52104748-52104770 TTTTTTTTTTTTGAGAGGGAGGG + Intergenic
974047945 4:56912968-56912990 TTTCTTTTTGTGGAGATGGGGGG + Intronic
974247276 4:59336101-59336123 TTTTTTTTTTTGGAGTGGGACGG + Intergenic
974758523 4:66244956-66244978 CTTATATTTCTGGAGATTGTTGG + Intergenic
974833325 4:67216244-67216266 TTTTTTTTTCTGGAGAGACAAGG - Intergenic
974855954 4:67460648-67460670 TTTTTTTTTTTTGAGATGGATGG - Intergenic
975058688 4:69969532-69969554 AATTTTATTCTGCAGATGGAGGG + Intergenic
975664977 4:76726532-76726554 TTTTTTTTTTTTTAGATGGAGGG - Intronic
976411194 4:84715348-84715370 AAGTTTTCTCTGGAGATGGACGG - Exonic
976483336 4:85570434-85570456 TTTTTTTTTCTGGAGAAGAGTGG + Intronic
976645361 4:87381750-87381772 TTTTTTTTTTTTGAGATGGGGGG - Intronic
977411107 4:96665318-96665340 CTACTTTTACTGGAGGTGGAGGG - Intergenic
977715898 4:100183573-100183595 TTTTTTTTTTTGGAGAGAGAGGG - Intergenic
978202978 4:106045063-106045085 TTTTTTTTTTTTGAGATGGCAGG + Exonic
978444176 4:108764708-108764730 CTTTTTTTTGTGGAGGGGGATGG - Intergenic
978445470 4:108776142-108776164 ATTCTTGCTCTGGAGATGGAGGG + Intergenic
978449463 4:108815465-108815487 CTTTCCTTTCTGGGGATGGGTGG + Intronic
978491538 4:109316124-109316146 ATTTTTTTTCTGGTTAGGGAAGG - Intergenic
978568772 4:110113406-110113428 AATTTTTTTGTAGAGATGGAGGG - Intronic
979090262 4:116474743-116474765 TTTTTTTTTCTGGAGAAAGCTGG + Intergenic
979646139 4:123071474-123071496 TTTTTTTTTTTGGAGGGGGACGG - Intronic
979737083 4:124100512-124100534 CTTTCTTCTCTGGAGATTGCTGG + Intergenic
979762467 4:124423648-124423670 TTTTTTTCTCTGGATATGTATGG - Intergenic
980135290 4:128852923-128852945 TTTTTTTTTTTTGAGATGGCTGG + Intronic
980835582 4:138187862-138187884 CTTTTTTTTATAGAGAAGGAGGG + Intronic
981490256 4:145331761-145331783 TTTTTTTTTCTGTAGACGCAGGG + Intergenic
981817612 4:148849131-148849153 ATTTTTCTTTTGGTGATGGAGGG + Intergenic
982222936 4:153140411-153140433 CATGTCTTTCTGGAGATGGATGG - Intergenic
982276997 4:153645945-153645967 CTTTCTTTTCTGGGGAGGGGGGG + Intergenic
982935843 4:161474548-161474570 TTTTTTTTTTTTGAGATGGGCGG + Intronic
983177635 4:164610199-164610221 CTTTCTTTTCATAAGATGGAGGG + Intergenic
983350618 4:166582926-166582948 CTTTTTTTTCTGAAAAGGTAAGG - Intergenic
983419459 4:167499643-167499665 TTTTTTTTGCAGGACATGGATGG - Intergenic
983536957 4:168868120-168868142 CTTTTCGTACTGAAGATGGAAGG - Intronic
983679438 4:170335147-170335169 TTTTTTTTTTTCGAGATGGAGGG - Intergenic
983994732 4:174168228-174168250 TTTTTTGTTCTGCAGTTGGAAGG - Intergenic
984804626 4:183739906-183739928 GTTTTTTTTTTGGAGGTGGGTGG + Intergenic
985050258 4:185983664-185983686 CTTTGTTTTCTGGAAATGGTAGG + Intergenic
985268490 4:188172677-188172699 CTTTCTTGTCTGGAGATTAAAGG + Intergenic
985327396 4:188787048-188787070 CTTCTTATTCTACAGATGGACGG + Intergenic
985369240 4:189267667-189267689 TTTTTTTTTCTGAAGATTTAGGG - Intergenic
985725692 5:1514803-1514825 CTGTTTTGGCTGGAGGTGGAAGG - Intronic
987374278 5:17218754-17218776 TTTATTTTTCTGGAAATGGAGGG - Intronic
987387524 5:17344126-17344148 CGTTGTTTTCTGGAGGTGGGGGG + Intergenic
987772349 5:22321795-22321817 CTTGCTATTCTGGAGTTGGAGGG - Intronic
987836371 5:23168453-23168475 CTTGTTTTTCTGGAATTAGATGG - Intergenic
988418482 5:30976026-30976048 TTTTTTTTTCTGTAGATGGTAGG - Intergenic
988631874 5:32940122-32940144 ATTTTTTTTGTAGAGATGGGGGG + Intergenic
988786642 5:34571290-34571312 CTTTTTTGTGTGGAGAAGAAGGG - Intergenic
989080033 5:37608730-37608752 TTGTTTTTTATAGAGATGGAGGG + Intronic
989642747 5:43599438-43599460 CTTTGTTTTTTGAAGAGGGATGG - Intergenic
989736853 5:44717977-44717999 TTTCTTTTTCTGGAGAAAGAAGG - Intergenic
990452697 5:55950785-55950807 ATTTTTTTTATAGAGATGGCTGG - Intronic
991493448 5:67205670-67205692 CTTTATTATGTGGAGATTGATGG + Intergenic
991592476 5:68267640-68267662 CTTTTTTTTTTGGAGGAAGAAGG - Intronic
992043753 5:72863729-72863751 TTTTTTTTTTTTGAGATGGCTGG - Intronic
992070865 5:73147305-73147327 ATTTTTTTTGTAGAGATGGAGGG - Intergenic
992658418 5:78933496-78933518 CTTTTTTTTGTGGAGGTCAATGG + Intronic
993346187 5:86785999-86786021 ATTTATTTTCTGAAGAGGGAAGG - Intergenic
993377343 5:87164700-87164722 CTTTTTTATGTGTAGAGGGAAGG - Intergenic
993604932 5:89977771-89977793 CTTTTTTTTCTCCAAATGAATGG - Intergenic
994048047 5:95331233-95331255 CTGTTCTTTCTGGAGATCCAGGG - Intergenic
994241788 5:97431183-97431205 TTTTTTTTTTTTGAGATAGAGGG + Intergenic
994466446 5:100139117-100139139 CTTTTTTTTTTGAAGTTAGAAGG - Intergenic
994943791 5:106359320-106359342 CTTGTTTTTCTGCAGCTAGATGG - Intergenic
995011002 5:107257163-107257185 TTTTTTTTTCTGTAGAGAGAGGG - Intergenic
995222827 5:109670303-109670325 ATTTATTTTCTGGAGGAGGAAGG - Intergenic
995431549 5:112084713-112084735 CTTTTTTTTTTTGAGGGGGATGG - Intergenic
995463889 5:112430980-112431002 CTTGTTTTCCTGCAGCTGGATGG + Intergenic
995520094 5:112995294-112995316 CTTTTCTTTCTGTAGATGGTAGG + Intronic
995624540 5:114061658-114061680 CTTTGTTTTCTGTAGATACATGG + Intergenic
995882491 5:116858471-116858493 CTATTTTTAGTAGAGATGGAGGG + Intergenic
996062849 5:119051070-119051092 CCTTTTCTTCAGGTGATGGAAGG + Intronic
996092238 5:119362621-119362643 ATTTTTTTTGTAGAGATGGGGGG - Intronic
996254201 5:121378428-121378450 CTTTTTTTTCTGGAGAGAGCAGG - Intergenic
996530093 5:124519468-124519490 CTTTTTTATCAGCAGATGGAAGG + Intergenic
996887676 5:128377539-128377561 TTTTTTTTTTTGGTGGTGGAGGG - Intronic
996895434 5:128475737-128475759 CTGTTCTTTCTGGAAATGGAAGG - Intronic
997050615 5:130375320-130375342 CTTTTTCCTCTGTAGGTGGAAGG + Intergenic
997952563 5:138253652-138253674 CTCTGTTTGGTGGAGATGGATGG + Intronic
998419516 5:141970689-141970711 ATTTCTTTTCTGCAGATGGCAGG + Exonic
998473257 5:142399813-142399835 CCTTTTCTTGTGGAGTTGGATGG + Intergenic
998544499 5:143015144-143015166 TTATTTTTTTTGGAGGTGGAGGG - Intronic
998727776 5:145037706-145037728 TTTTTTTTCCGGGGGATGGAGGG + Intergenic
998864050 5:146476934-146476956 TTATTTTTTGTAGAGATGGAGGG + Intronic
999013365 5:148068543-148068565 TTTTTTTTTTTGGAGAGGCAGGG - Intronic
999178117 5:149646530-149646552 CTTTTCTTGCTGGTGAAGGAAGG + Intergenic
999382324 5:151130239-151130261 CTTTTTTTTTTGAAGAGGCAGGG + Intronic
999458287 5:151736347-151736369 ATTTTTTTTATGGAGATGATGGG - Intergenic
999718871 5:154383767-154383789 CTTTGTCTTCTGGAGATTGAGGG - Intronic
1000218926 5:159192814-159192836 CTTATTTTTCGATAGATGGATGG - Intronic
1000298070 5:159929503-159929525 GTTTTTATTCTGGAGTTAGAGGG - Intronic
1000309596 5:160029468-160029490 TTTTTTTTTGTAGAGATGGGGGG - Intronic
1000744092 5:165008997-165009019 TTTTTTTTTCTTAAGATAGATGG + Intergenic
1000941138 5:167361333-167361355 CAATTATTTCTGGAGATGGAGGG - Intronic
1000970016 5:167703661-167703683 TATTTTTTTCTGGAAATGTACGG + Intronic
1001440713 5:171740648-171740670 TTTTTGTTACAGGAGATGGAAGG + Intergenic
1001694957 5:173663189-173663211 CTGCTTTTTCAGGAGAAGGAAGG + Intergenic
1001737849 5:174021523-174021545 CTTTCTTTGGTGGAGATGTATGG + Intergenic
1001989123 5:176101536-176101558 TTTGTTTTTCTCTAGATGGAGGG + Exonic
1002165728 5:177344211-177344233 TTTTTTTTTTTAGAGATGGGGGG - Intronic
1002227747 5:177736602-177736624 TTTGTTTTTCTCTAGATGGAGGG - Exonic
1002624435 5:180515243-180515265 TTTTTTTTTGTAGAGATGGGAGG - Intronic
1002962025 6:1924250-1924272 CTTTTTTGTGTGGAGGTGGCAGG - Intronic
1003138012 6:3447905-3447927 TTTTTTTTTTTTGAGATAGATGG + Intronic
1003278883 6:4675108-4675130 CTTTGTTTACCGCAGATGGATGG + Intergenic
1003316235 6:5014506-5014528 CTTGTTTTCATGGAGATGGCGGG + Intergenic
1003597906 6:7490848-7490870 CTTTTTTTTCTGCAGAAGAGAGG + Intergenic
1003871558 6:10407508-10407530 TTTTTTTTTTTACAGATGGATGG + Intronic
1003898436 6:10630533-10630555 TTTTTTTTTTTTGAGATGGAGGG + Intergenic
1004052171 6:12095496-12095518 TTTTTTTTTCTCCACATGGATGG + Intronic
1004069959 6:12288859-12288881 CCAGTTTTTCTGGGGATGGAGGG - Intergenic
1004725294 6:18305843-18305865 TTTTTTTCTTTTGAGATGGATGG + Intergenic
1005064812 6:21807822-21807844 CTTTCTCTTCTGGAGTGGGAAGG - Intergenic
1005082798 6:21973818-21973840 ATTTTTTTTCTGGAGAGATAGGG - Intergenic
1005513101 6:26529790-26529812 GTTTTTTGTCTGGAGATAGGCGG - Intergenic
1005562325 6:27053546-27053568 TTTTTTTTTTTGGAGCTTGAGGG - Intergenic
1005757251 6:28936094-28936116 TTTTTTTTTGTAGAGATGGTGGG + Intergenic
1006310689 6:33256905-33256927 CTTTTTTTTATGTGGATGGTTGG - Intronic
1006824093 6:36921440-36921462 CATTTTCCTGTGGAGATGGAGGG + Intronic
1006982697 6:38158627-38158649 CTTCCAGTTCTGGAGATGGACGG - Intergenic
1007660246 6:43479962-43479984 GCTTTTTTTCTTGAGATGGATGG - Intronic
1008509963 6:52267101-52267123 TTTTTTTTTTTTGAGACGGACGG + Intronic
1008688606 6:53952004-53952026 GTTCTGTTTCTTGAGATGGATGG - Intronic
1008875799 6:56324943-56324965 CTTTTATCTCTGAAGATGAAGGG + Intronic
1008879838 6:56370865-56370887 ATTCTTTTTCTGGGAATGGAAGG - Intronic
1009275118 6:61667137-61667159 TTTTTTTTTTTTAAGATGGAAGG + Intergenic
1009375572 6:62964204-62964226 TTTTTTTTTTTTGAGATGGATGG - Intergenic
1009972671 6:70641589-70641611 CATTTTTTAATGGAGATGGCGGG + Intergenic
1009982077 6:70738394-70738416 TTTTTTTTTCTGAATCTGGAAGG + Intronic
1010928737 6:81775083-81775105 CTTTTTTTTCTGTAAAAGGTAGG - Intergenic
1011661094 6:89594647-89594669 ATTTTTTTTCTTGAAATGGTTGG + Intronic
1011719384 6:90139588-90139610 CTTTTTTTTCTGGGGAGGAGGGG + Intronic
1012217507 6:96605726-96605748 TTTTTTTTTCTCCAGATGAATGG + Intronic
1012268397 6:97176134-97176156 CTTTTTCTTCTGTAAATGCATGG + Intronic
1012533771 6:100270878-100270900 TTTATTTTTGTAGAGATGGAGGG - Intergenic
1012576485 6:100807296-100807318 CTTTTTTTTGAGGGGAGGGAGGG - Intronic
1013597006 6:111669428-111669450 TTTTTTTTTTTTGAGATGGATGG - Intronic
1013868969 6:114733989-114734011 CTTTTTTTTATGGAGTAGGGAGG - Intergenic
1014409107 6:121092313-121092335 TTTTTTTTTTTGGAGATGTGGGG + Intronic
1014440000 6:121462917-121462939 TTTTCTTTTCTGGTGATGGGTGG + Intergenic
1014989723 6:128058734-128058756 TTTTTTTTTCTGGTGGAGGATGG + Intronic
1015011549 6:128355401-128355423 TTTTTTTCTCTGGATAAGGAAGG - Intronic
1015182604 6:130377339-130377361 CCTTGTTACCTGGAGATGGATGG - Intronic
1015727529 6:136314730-136314752 CTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1015880003 6:137862865-137862887 TCTTTTTTTATGGAGATGGCTGG + Intergenic
1015978917 6:138819302-138819324 TTTTTTTTTGTGTGGATGGAGGG + Intronic
1016044504 6:139467312-139467334 TTTTCTTTTCTGGAGATGGGGGG + Intergenic
1016439942 6:144073005-144073027 CTGTTTTTTTTGGGGAGGGAGGG + Intergenic
1016999141 6:149983643-149983665 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999151 6:149983734-149983756 CTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999156 6:149983777-149983799 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999166 6:149983860-149983882 CTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999221 6:149984251-149984273 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999251 6:149984484-149984506 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1016999256 6:149984525-149984547 TTTTTTTTTTTTGAGCTGGAAGG + Intergenic
1017111016 6:150932762-150932784 CTTTTTTTTTTGGAGACACATGG - Intronic
1017136478 6:151151691-151151713 TTTTTTTTTCTTGAGATAGCTGG - Intergenic
1017238290 6:152139956-152139978 CTTTTTGATCTGGAGCTCGATGG + Exonic
1017442412 6:154476028-154476050 TTTTTTTTTTCGGATATGGATGG + Intronic
1017610573 6:156182100-156182122 CTGTTTTTTCTTAAGAAGGAAGG + Intergenic
1017697060 6:157026685-157026707 CTTTTTATTTTTGAGATGGGGGG + Intronic
1017870586 6:158483331-158483353 CTTTTTATTGGGGGGATGGAGGG + Intronic
1017975018 6:159349367-159349389 TTTTTTTTTCTGGAGAGACAAGG - Intergenic
1017998834 6:159560328-159560350 CTTTTTTTTCTGGGGCTTCAGGG - Intergenic
1018672360 6:166190111-166190133 CATTTTTTTCTGCAAATGTAAGG + Intergenic
1018698672 6:166410451-166410473 CATTTTGTTCTGGATATGGGAGG + Intronic
1019139560 6:169934952-169934974 CTTTGTTTTCTGAAGCCGGAGGG + Intergenic
1019293985 7:264260-264282 GTATTTTTTGTAGAGATGGAGGG - Intergenic
1019391532 7:790004-790026 TTTTTTTTTCTGGAGAGACAGGG - Intergenic
1019766741 7:2857112-2857134 TTTTTTTTTTTTGAGATGGTGGG + Intergenic
1019790808 7:3012606-3012628 CTCTTTTTTGTAGAGATGGGGGG - Intronic
1019978324 7:4602414-4602436 GGATTTTATCTGGAGATGGAAGG + Intergenic
1020052534 7:5091419-5091441 TTCTTTTTTTTTGAGATGGAAGG - Intergenic
1020162420 7:5782340-5782362 TTTTTTTTTTTCGAGATGGAGGG - Intergenic
1020850525 7:13347244-13347266 CTGGTTTCTCGGGAGATGGATGG + Intergenic
1021557557 7:21936619-21936641 TTTTTTTTTCTGATGAGGGAAGG - Intronic
1021705343 7:23362237-23362259 CTTTATTTTTTAGAGATGGGGGG - Intronic
1022258925 7:28685474-28685496 CCTTTTTTCCTGGAGCTGGATGG - Intronic
1022401935 7:30046840-30046862 CCTTTTTTTCTGGGGTGGGATGG + Intronic
1022441188 7:30434941-30434963 TTTTTTTTTTTGTAGATAGAGGG + Intronic
1023010714 7:35922680-35922702 CATTTTTTTCTTGAGAGAGAGGG - Intergenic
1023450476 7:40279006-40279028 TTTTTTTTTTTAGAGATGGGGGG + Intronic
1023546848 7:41326715-41326737 CCTTTTTTCATGGAGTTGGATGG - Intergenic
1023943908 7:44788170-44788192 TTTTTTTTTGTAGAGATGGGAGG + Intergenic
1024073615 7:45807346-45807368 CTTGTTTTTCTGCAACTGGATGG - Intergenic
1024220480 7:47282765-47282787 CATTTTTTTCAGCAGATGAAGGG + Intronic
1024573743 7:50747333-50747355 CTTTGTTTTGTGGATTTGGAGGG - Intronic
1024627957 7:51224687-51224709 TTTTCTTTTTTTGAGATGGACGG + Intronic
1024646651 7:51376660-51376682 CATTTTTTTCTGCAGAAGGAAGG + Intergenic
1024928982 7:54649885-54649907 CTTTTTTTTCCACAGATGCATGG - Intergenic
1025293110 7:57748826-57748848 TTTTTTTTTTTTGAGGTGGAGGG - Intergenic
1025722891 7:64032537-64032559 TTTTTTTTTTTTGAGGTGGATGG - Intronic
1025727493 7:64080895-64080917 TTTTTTTTTGTGGTGGTGGAGGG + Intronic
1025985344 7:66445874-66445896 CCTTTTTTTGTGGAGACGGGAGG - Intergenic
1026024101 7:66731542-66731564 TTTTTTTTTCTGGAGAGACAGGG - Intronic
1026663415 7:72322140-72322162 CTTATTTTTCTGCAACTGGATGG + Intronic
1026882793 7:73918243-73918265 TTTTTTTTTGTAGAGATGGGGGG + Intergenic
1026975407 7:74494925-74494947 ATTTTTTTTGTAGAGATGGGGGG + Intronic
1027180532 7:75936274-75936296 TTTTTTTTTTTTGAGATGGAGGG + Intronic
1027197558 7:76041166-76041188 TTTTTTTTTTTGGAGATGGGGGG - Intronic
1027208560 7:76124474-76124496 CCTTTTTTTGTGGAGACGGGAGG - Intergenic
1027301028 7:76835554-76835576 TTTTTTTTTTTTGAGATGGAGGG - Intergenic
1027449041 7:78308540-78308562 TTTTTTTTTCTGGAAAGGGATGG + Intronic
1027803264 7:82782354-82782376 GATTTTTTTCTGGAAAAGGAAGG - Intronic
1028130855 7:87170957-87170979 GTTATTATTCTGGAGATGAACGG + Intronic
1028354162 7:89886316-89886338 CTTATTTGTATGGACATGGATGG - Intergenic
1028752672 7:94398651-94398673 GTTTTTATTCTGGAGATGGAAGG + Intronic
1029034078 7:97500225-97500247 TTTTTTTTTTTTTAGATGGATGG + Intergenic
1029061968 7:97807531-97807553 CTTTTTTTTTTGGTGGGGGAGGG - Intergenic
1029093481 7:98066958-98066980 TTTTTTTTTTTGGAGACGGGGGG + Intergenic
1029197886 7:98819133-98819155 TTTTTTTTTCTGGATAAGGTGGG + Intergenic
1029569600 7:101360852-101360874 TTTTTTTTTGTAGAGATGGGGGG + Intergenic
1029652903 7:101905996-101906018 TTTTTTTTTCTGGAGAGACAGGG + Intronic
1029733342 7:102451906-102451928 CTTTTGTTTCTGGAAAGAGAGGG - Exonic
1029738788 7:102479721-102479743 TTTTTATTTTTGGAGATGGTGGG + Intergenic
1029755913 7:102573377-102573399 TTTTTATTTTTGGAGATGGTGGG + Intronic
1029773855 7:102672450-102672472 TTTTTATTTTTGGAGATGGTGGG + Intergenic
1030146807 7:106365501-106365523 TGTTTTTTTCTGGGGGTGGAGGG - Intergenic
1030591738 7:111490288-111490310 TTTTTTTTTTTAGAGATGGGAGG + Intronic
1030799607 7:113833630-113833652 CTTTTTTATATGGAGATTGGTGG - Intergenic
1030815256 7:114028281-114028303 CTTTTTTTTCAGGACATAGAAGG - Intronic
1030837389 7:114306747-114306769 TTTTTTTTTCTGGAGGTGCAAGG + Intronic
1031530683 7:122872795-122872817 ATTTTTTTTCTGGATCTGCATGG - Intronic
1032084266 7:128875630-128875652 TTTTTTCTTCTGGAGATGGATGG + Intronic
1032085517 7:128881476-128881498 CATTCTTTTCTAGAAATGGAGGG - Intronic
1032239713 7:130151110-130151132 TTTTTTTTTTTTGAGACGGAGGG + Intergenic
1032434713 7:131890387-131890409 CTTGTTTTTCTGCAGCTAGAGGG + Intergenic
1032608354 7:133383452-133383474 TTCTTTTTTCTGGAGATTAATGG + Intronic
1032789381 7:135231437-135231459 CTTTTATTTCATGAAATGGATGG + Intergenic
1033022922 7:137745245-137745267 CCTTTGTTTATGTAGATGGAAGG + Intronic
1033056012 7:138055150-138055172 CTTTCTTTTCTAGAGATGCATGG + Intronic
1033059453 7:138091655-138091677 TTTTTTTTTTTTGAGATGGGGGG - Intronic
1033144773 7:138861679-138861701 TTTTTTTTTTTAGAGATGGGGGG - Intronic
1033383959 7:140853203-140853225 CTTTTTTTTTTGTAGATACAGGG - Intronic
1033861498 7:145633622-145633644 TTTTTGTTTCTGAAGATGGTAGG - Intergenic
1034084089 7:148307794-148307816 GTTTTTTTTGTAGAGATGGGTGG - Intronic
1034151090 7:148915859-148915881 TTTTTTTTGGTGGAGATGGTGGG - Intergenic
1034685312 7:152966037-152966059 CTTCTTTTCCTGCAGCTGGATGG + Intergenic
1035051363 7:156000764-156000786 CTTCTCTTTCAGGGGATGGAGGG + Intergenic
1035421827 7:158736007-158736029 TTTTTTTTATTGGAGATGGTGGG - Intronic
1036667247 8:10755275-10755297 TTTTTTTTTTTTAAGATGGAGGG + Intronic
1037040845 8:14230747-14230769 CTTTTTTTTTTGGTGGTGGTGGG + Intronic
1037089263 8:14893317-14893339 GTTTTCTTTCTGGAGATTGTAGG - Intronic
1037281267 8:17245559-17245581 ATTTTTTGTCTGGAAATGGATGG - Intronic
1037580759 8:20244842-20244864 ATTTTTTTTCTGGAGATGGGAGG - Intergenic
1038523238 8:28251432-28251454 CTTGTTTTTCTGCAGCTAGACGG + Intergenic
1038627680 8:29209872-29209894 TTTTTTTTTGTGGAGAGGTAGGG - Intronic
1038671354 8:29585633-29585655 CTTCATTTTTTGGAGATGGAAGG - Intergenic
1039025599 8:33254573-33254595 TTCTCTTTTCTGTAGATGGAGGG + Intergenic
1039558191 8:38491881-38491903 GTTTTTTTTTTTGAGATGGATGG - Intergenic
1039611204 8:38920734-38920756 TTATTTTTTGTAGAGATGGAGGG + Intronic
1039792688 8:40888183-40888205 CTGATGTTTCTGGAGAAGGAGGG - Intronic
1039949116 8:42153663-42153685 TTTTTTTTTTTGGAGGTGGAGGG + Intronic
1040506953 8:48057633-48057655 CTCTTTTTTCTGGGGAGGGAGGG + Intronic
1040520373 8:48171330-48171352 TTTTTTTTTGTAGAGATGGGGGG - Intergenic
1041013344 8:53566589-53566611 TGTTGTTTTCTGGAGTTGGAAGG + Intergenic
1041275523 8:56153819-56153841 TTTTTTTTTTTGCAAATGGATGG - Intergenic
1041404963 8:57488180-57488202 GTTTTTTTGTTGGACATGGATGG + Intergenic
1042048216 8:64678679-64678701 CTTTATTTTCTACAGATAGAAGG - Intronic
1042455636 8:68999264-68999286 TTTTTTTTTTTGTAGAGGGATGG - Intergenic
1042561788 8:70077359-70077381 ATTTTTTCTTTTGAGATGGAAGG + Intergenic
1042780648 8:72487257-72487279 TTTTTTTTTTTGGAGACAGACGG - Intergenic
1042992797 8:74659472-74659494 ATTTTTTTGCTGAAGCTGGAGGG + Intronic
1043388982 8:79772596-79772618 ATTTTTTTTTTTGAGACGGACGG - Intergenic
1043445027 8:80310929-80310951 CTTTTTTTTTTAGGGAGGGAGGG + Intergenic
1043574628 8:81643544-81643566 TTTTTTTTTTTTGAGGTGGATGG - Intergenic
1043757873 8:84026743-84026765 GCTCTTTTTCTGAAGATGGAGGG - Intergenic
1043868459 8:85402362-85402384 CTTTTTTTTTTGGGGGGGGATGG + Intronic
1044662015 8:94600761-94600783 ATTTTTTTTATAGAGATGGGAGG - Intergenic
1045468316 8:102489226-102489248 TTTTTTTTTGTAGAGATGGGGGG + Intergenic
1045668425 8:104517831-104517853 ATTTTTATTTTGGAGATGGTGGG - Intronic
1045845935 8:106636324-106636346 TTTTTATTTCTGGACAAGGAGGG + Intronic
1046166194 8:110439403-110439425 CTTTTTTCTTTGGGGATGGGAGG + Intergenic
1046210919 8:111074504-111074526 TTTATTTTTCTAGAGATGGGGGG + Intergenic
1046593398 8:116232210-116232232 TTTTTTTTTCTGTACATGGGAGG - Intergenic
1046813926 8:118563393-118563415 CTTTATATTCTGGGTATGGATGG - Intronic
1046846003 8:118916905-118916927 CTTTTCTTTTTGCATATGGATGG - Intergenic
1046975996 8:120278368-120278390 TTTGTTTTTCTGGAGAAGAAAGG - Intronic
1047872617 8:129101688-129101710 CTTTTGTTTTTGGAGCTGGAGGG - Intergenic
1048784862 8:138039800-138039822 CTTCTTTTTCTGGAAGTGGGTGG + Intergenic
1048802116 8:138203830-138203852 CTTGTTTTTCTGGAACTAGATGG + Intronic
1048954605 8:139525576-139525598 CTTTTCTCTCTTGAAATGGAGGG + Intergenic
1049264075 8:141657510-141657532 TTATTTTCTCTGGAGGTGGAAGG - Intergenic
1049371388 8:142269499-142269521 CTTTATTTTCTGTAGAAGCAAGG + Intronic
1051208819 9:14719723-14719745 CTTTTCCTTCTTTAGATGGAGGG + Exonic
1051272948 9:15372644-15372666 TTTTTTTTTCTTGAAAAGGAGGG - Intergenic
1051323893 9:15943386-15943408 CTTTTATTTCTGCAAATGGTGGG + Intronic
1051405389 9:16732143-16732165 TTTTTTTTGCAGGAAATGGAGGG - Intronic
1051521397 9:17992618-17992640 CTTTTATTTTTTGAGATGGCAGG - Intergenic
1051936687 9:22451050-22451072 CTTTTTGTTCTGGAGAAGAGGGG - Exonic
1052098634 9:24415152-24415174 CTTTTTTTGGTGGAGAGGGGCGG + Intergenic
1052223430 9:26055162-26055184 CTTTTTTTTCAGTATCTGGAAGG + Intergenic
1052246748 9:26346357-26346379 TTTTTTTTTCTGCAGGTGGGAGG - Intergenic
1052721738 9:32179666-32179688 TTTTTTTTTGTGGGGAGGGAGGG - Intergenic
1053085416 9:35216247-35216269 CTTTCTTTTCTGGACCAGGATGG + Intronic
1053094723 9:35315062-35315084 TTTTTTTTTTTGTAGATGCAGGG + Intronic
1053560042 9:39182840-39182862 ACTTTTTTTCTAGAGATGGGGGG + Intronic
1054137074 9:61436115-61436137 ACTTTTTTTCTAGAGATGGGGGG - Intergenic
1054873272 9:70068715-70068737 TTTTTTTTTTTTGTGATGGAGGG - Intronic
1054955357 9:70903443-70903465 TTTCTTTTTGGGGAGATGGATGG - Intronic
1055167323 9:73212533-73212555 TTTTTTTTTTTTGAGATGGATGG - Intergenic
1055653717 9:78433538-78433560 CTCTTTTTTCTGTAAATGAATGG - Intergenic
1055699817 9:78931435-78931457 CTTTTTCATCTGGAGATGATAGG + Intergenic
1055762168 9:79620841-79620863 CTTTTTTTACTCATGATGGAAGG + Intronic
1055796348 9:79978598-79978620 CTTTTTTTTCTGCATATATACGG + Intergenic
1055811011 9:80147695-80147717 CTCTCTTATCTGGATATGGAAGG - Intergenic
1056150460 9:83782360-83782382 TTTTTTTTTTTTGAGATAGATGG + Intronic
1057243054 9:93429501-93429523 CTTATTTTTATTGAGATTGAGGG - Intergenic
1057571704 9:96208863-96208885 CTTTTTTTTCTGGGAATATAAGG - Intergenic
1057669903 9:97077946-97077968 TTTTTTTTTTTGGAGATGGCTGG + Intergenic
1057988500 9:99742510-99742532 CTATAATTTCAGGAGATGGAGGG + Intergenic
1058043932 9:100335734-100335756 CTTTTTTTTTTTGAGATAGATGG + Intronic
1058330591 9:103755345-103755367 CTTTTTTTTGTAGAGATGGGGGG - Intergenic
1058574554 9:106386290-106386312 ATTTTTTTTCTGATCATGGAAGG + Intergenic
1059173996 9:112152579-112152601 TTTTTTTTTGTACAGATGGAGGG + Intronic
1059439502 9:114298917-114298939 CTTTTTATTCTTGAGTTGTAAGG - Intronic
1059470481 9:114501637-114501659 ATTTTTTTTCCTGCGATGGAAGG - Intronic
1059694333 9:116716390-116716412 CTAAGTTTTCTGGAGAGGGAAGG + Intronic
1060153201 9:121301696-121301718 CAGCTTTTTCTGGTGATGGAGGG - Intronic
1060342616 9:122790268-122790290 TTTTTTTTTGTAGAGATGGTGGG - Intergenic
1060573370 9:124664999-124665021 TTTTTTTTTTTGGAGATACAAGG - Intronic
1060901231 9:127259865-127259887 TTTTTTTTTGTAGAGATGGGCGG - Intronic
1061070765 9:128309155-128309177 TTTTTTTTTTTTGAGATGGCAGG + Exonic
1061241547 9:129377068-129377090 CTATTTTTTGTAGAGATGGGGGG + Intergenic
1061278893 9:129585789-129585811 TTTTTTTTTCTGGTGGTGGAGGG + Intergenic
1061616566 9:131784191-131784213 ATTTTTTTTGTAGAGATGGGGGG + Intergenic
1061694975 9:132366236-132366258 TTTTTTTTTTGAGAGATGGAGGG + Intergenic
1061910215 9:133718443-133718465 CTTTAATTTCTGGAGAAAGAGGG - Intronic
1062049622 9:134440601-134440623 CTTTTTTGTTTGGAGCGGGAGGG + Intergenic
1185798583 X:2988156-2988178 CTTTTGTTTCTGTAGATACAGGG + Intergenic
1186109595 X:6241809-6241831 CTTTTTTTTTTAGAGAGGGTTGG - Intergenic
1186467544 X:9795733-9795755 TTTTTTTTTCTGGAGGGGCAGGG + Intronic
1186567381 X:10677835-10677857 TTTTTTTTTCTGGAGAGGAGAGG - Intronic
1187081469 X:15993728-15993750 CTTTATTTTCTGAAGATGGGGGG + Intergenic
1187414204 X:19078379-19078401 TATTTTTTTGTAGAGATGGAGGG - Intronic
1187731720 X:22262390-22262412 CTTTTTTTGCTGGCAATGGTAGG + Intergenic
1187824822 X:23324364-23324386 GTTTTTATTCTGGAGATGACAGG - Intergenic
1187882552 X:23860517-23860539 CTTTTTTTTCTGTTGAGAGAGGG + Intronic
1188369105 X:29347393-29347415 TTTTTTTTTTTGGAGAGAGAGGG + Intronic
1188415016 X:29922226-29922248 TTTATTTTTCTAGAAATGGAAGG - Intronic
1188487368 X:30698181-30698203 CTCTTTTTTCTTCAGAGGGAGGG - Intronic
1189339813 X:40196267-40196289 TTTTTTTTTTTTGAGATGGGGGG - Intergenic
1189416969 X:40824010-40824032 CTTCTCTTTCTGGAGAGGGAGGG - Intergenic
1189594166 X:42546895-42546917 CTTTTTATTCTGGAGTTAGGAGG - Intergenic
1189762025 X:44331742-44331764 TTATTTTTTCTAGAGTTGGAGGG - Intronic
1190098696 X:47503779-47503801 TTTTTTTTTGTAGAGATGGGGGG + Intergenic
1191006102 X:55712982-55713004 CTTTTTCTTGCTGAGATGGATGG + Intergenic
1192402501 X:70850567-70850589 TTTTTTTTTTTGTAGAGGGAGGG - Intronic
1192447497 X:71221959-71221981 TTTTTTTTTGTAGAGATGGGGGG - Intronic
1192699430 X:73452142-73452164 TTTCCTTTTCTGGAGATGAAAGG + Intronic
1192837001 X:74810624-74810646 TTTTTTTTTTTGTAGAGGGAGGG - Intronic
1194605650 X:95975006-95975028 CCTTTTCTTCTGGAGTTGGGAGG + Intergenic
1195937430 X:110139119-110139141 CTTTTGTTTCTTTAGATGAAAGG + Intronic
1196284585 X:113864200-113864222 ATTTTTTTCCTGGGGATGGGGGG + Intergenic
1196504563 X:116426157-116426179 CTTTTTTGTCTAGAAATGAAGGG - Intergenic
1196925298 X:120628348-120628370 TGCTTTTTTCTGAAGATGGAGGG - Intronic
1197101627 X:122662908-122662930 TTTTTTTTTCTGGAGAATGTAGG + Intergenic
1197234033 X:124038963-124038985 CATTTTTTTCTGGGGTAGGATGG + Intronic
1197469137 X:126846333-126846355 GCTTTTTTTCTGGAGTTAGAGGG + Intergenic
1197683705 X:129415708-129415730 GCTGATTTTCTGGAGATGGAGGG - Intergenic
1197969059 X:132096018-132096040 CTTTTTTTTTTGGAGGTGGGGGG + Intronic
1197984935 X:132257010-132257032 CTTTGTTTTCTCAAGATGGAGGG - Intergenic
1198007762 X:132516023-132516045 TTTTTTTTTTTGGCCATGGAAGG + Intergenic
1198130934 X:133694382-133694404 CTCTTCTTTTTGGAGATTGATGG - Intronic
1198561511 X:137855670-137855692 CTTCATCTTTTGGAGATGGATGG + Intergenic
1198752692 X:139951382-139951404 CTTTTTTTTGTGGGGCTGGGTGG + Intergenic
1199115431 X:143986410-143986432 TTGTTTTTCCTGGAGAAGGAAGG - Intergenic
1199249822 X:145647810-145647832 CTTTTTTTTCTGTTGCTGAAAGG + Intergenic
1199829787 X:151538184-151538206 CCTTCTTTTTTGGGGATGGACGG - Intergenic
1199839136 X:151626170-151626192 CTTTTTTTTCTTGAAAAGAAAGG + Intronic
1200828379 Y:7666376-7666398 TTTTTTTTTGTGGAGAGGGTGGG + Intergenic
1201587448 Y:15576612-15576634 ATTTTTTTTCTGTAGAAAGAGGG - Intergenic
1201897953 Y:19013900-19013922 CTTTTTTTTATGATGATTGATGG - Intergenic
1202082952 Y:21103729-21103751 TTTTTTTAACTGGAGATGGCTGG + Intergenic
1202167062 Y:22000858-22000880 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202224298 Y:22585515-22585537 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202305111 Y:23460855-23460877 CTTTTTTTTGTGGCGGGGGAGGG - Intergenic
1202318816 Y:23610145-23610167 CTTTCCTTGCTGGAGATGGAGGG + Intergenic
1202551952 Y:26059912-26059934 CTTTCCTTGCTGGAGATGGAGGG - Intergenic
1202565698 Y:26209734-26209756 CTTTTTTTTGTGGCGGGGGAGGG + Intergenic
1202585682 Y:26424205-26424227 CTTTTTTTTCTGGGGGCGGGAGG - Intergenic