ID: 1106995722

View in Genome Browser
Species Human (GRCh38)
Location 13:35478045-35478067
Sequence CCGGGAGTTATAGGATTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106995722_1106995727 29 Left 1106995722 13:35478045-35478067 CCGTCAAATCCTATAACTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1106995727 13:35478097-35478119 CTTTTAACAAGATATTCTTCAGG 0: 1
1: 0
2: 5
3: 30
4: 292
1106995722_1106995728 30 Left 1106995722 13:35478045-35478067 CCGTCAAATCCTATAACTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1106995728 13:35478098-35478120 TTTTAACAAGATATTCTTCAGGG 0: 1
1: 0
2: 3
3: 41
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106995722 Original CRISPR CCGGGAGTTATAGGATTTGA CGG (reversed) Intronic
908796322 1:67833671-67833693 CCTGAAGTTCTAGGACTTGAGGG + Intergenic
912513951 1:110206648-110206670 CCTGGAGTCATAGGGTTGGAGGG - Intergenic
921878932 1:220231599-220231621 CCTGGAGTTAGAGGATAAGAGGG - Intronic
1066449604 10:35516749-35516771 CTGGGAGTGATAAGATTGGATGG + Intronic
1070938625 10:80322455-80322477 TAGGGAGTTAGAGCATTTGAGGG + Intergenic
1072876878 10:99182224-99182246 CCTGGAATTAGAGGATTTGGAGG - Intronic
1073985498 10:109203703-109203725 CCAGAATTTATGGGATTTGAGGG - Intergenic
1074937016 10:118191693-118191715 CCAGGATATATAGGTTTTGATGG + Intergenic
1075980415 10:126733725-126733747 GCTGGTGTTATAGGATGTGAAGG - Intergenic
1083149525 11:60783322-60783344 CTGGGAGTTGTGGGATCTGAGGG + Intergenic
1091031142 11:132188945-132188967 TCTGGAGTTATAGGATATGTGGG + Intronic
1094428137 12:30337164-30337186 CTGGGATTTTTAGGATTTAAGGG - Intergenic
1104491776 12:129200581-129200603 TCGGGAGTTATAGGATCTGCAGG + Intronic
1105594419 13:21823298-21823320 AAGTGAGTCATAGGATTTGAAGG - Intergenic
1106995722 13:35478045-35478067 CCGGGAGTTATAGGATTTGACGG - Intronic
1113033755 13:106025237-106025259 CAGTAAGTTCTAGGATTTGATGG + Intergenic
1113420425 13:110167157-110167179 CCAGGAGTTCCAGGATTTCAAGG - Exonic
1113460772 13:110480342-110480364 CCTGGATTTAAAGGAATTGATGG + Exonic
1116206109 14:41868883-41868905 ATGGGACATATAGGATTTGAAGG - Intronic
1118325822 14:64779724-64779746 CCGGGACTTAGAGGATGAGACGG - Exonic
1119705721 14:76781494-76781516 CCGGGAATGACAGGGTTTGAGGG + Exonic
1123924850 15:25097979-25098001 ACAGGAGTTATAGGATTTACAGG + Intergenic
1130619333 15:85445330-85445352 GTGGGAGTTACAGGCTTTGATGG + Intronic
1132775420 16:1591106-1591128 CCGGGAGCTGTAGGCTTTGTGGG - Intronic
1139535638 16:67571317-67571339 CCTGGAGTTGGAGGATTTGTTGG + Intronic
1140266467 16:73425571-73425593 CCAGGAGTTAATGGGTTTGATGG + Intergenic
1144625368 17:16841737-16841759 CCAGGAGTTCTAGGAGTTGATGG - Intergenic
1144667588 17:17112469-17112491 CATGGAGTTAAAGGATTTGGGGG + Intronic
1144881059 17:18430984-18431006 CCAGGAGTTCTAGGAGTTGATGG + Intergenic
1145151173 17:20513402-20513424 CCAGGAGTTCTAGGAGTTGATGG - Intergenic
1150899627 17:69257519-69257541 CAGGGAGTTATAGGAGTGGATGG + Intronic
1151733799 17:75926402-75926424 CCAGGAGTTAGAGGAATAGAGGG + Exonic
1155787075 18:29914631-29914653 CTGGGAATTCTGGGATTTGAGGG - Intergenic
929450823 2:42035875-42035897 CCGGGGGTTATAGGCTGGGAAGG + Intergenic
931098469 2:58968794-58968816 CAGGGAGCTATAGAATTTGGGGG + Intergenic
936065110 2:109325277-109325299 CCAGGAGTCATTGGATTTCAGGG + Intronic
937331408 2:121032534-121032556 CCAGGAGGTAGAGGATTGGAGGG + Intergenic
942565311 2:177260363-177260385 GCAGGACTTATAGGATCTGATGG - Intronic
1173124846 20:40327069-40327091 CAGGGAGTTATAGGATGGGGTGG - Intergenic
1173755535 20:45512332-45512354 CTGGGAGATAAAGGTTTTGAAGG - Intergenic
1174345812 20:49929038-49929060 CTGAGAGTTACAGGATTTGAGGG + Intergenic
1175674693 20:60936623-60936645 CCTGGAGTTGTGGGGTTTGATGG + Intergenic
1175804700 20:61820994-61821016 CCTGTAGTTCTAGGATTTGCGGG + Intronic
953895669 3:46798053-46798075 CCTGGAGTTATGGGTTTTGGGGG - Intronic
957574034 3:81986466-81986488 CCGGGAGCAATAGGGTTTGGGGG - Intergenic
960540303 3:118854580-118854602 CCTGTAGTAATAGGAATTGAGGG - Intergenic
964018024 3:151971784-151971806 ACAGGAGTTTTATGATTTGAAGG - Intergenic
967216587 3:187215744-187215766 CCTGGGGTTATGGGATTTGGAGG + Intergenic
971780923 4:31033693-31033715 CTGGGAGTTAAAGGATTGGATGG - Intronic
971838825 4:31805161-31805183 CTGAGAGTTATTGGCTTTGAAGG - Intergenic
975056519 4:69939121-69939143 CTGGGATTTTTAGAATTTGAAGG - Intronic
975057846 4:69957546-69957568 CAGTGAGTTTTGGGATTTGAGGG + Exonic
982265463 4:153534731-153534753 CCAGGAGTTGGAGGATTTGATGG + Intronic
984606327 4:181789640-181789662 CAAGCAGTTATAGGATTTCAGGG + Intergenic
985838006 5:2284505-2284527 CCAGGAGTTAGAGGCTATGATGG - Intergenic
988343078 5:30000282-30000304 CAGGAAGTCATAGGTTTTGATGG + Intergenic
991452602 5:66768905-66768927 CAGAGAGTTATTGGATTTAATGG + Intronic
994921806 5:106054833-106054855 CTGGCAGTAATAGCATTTGAAGG + Intergenic
995551108 5:113282330-113282352 CAGGGAATTAAAGGGTTTGAAGG + Intronic
1000256920 5:159548187-159548209 CTGGAAGTTATAGGAATAGATGG + Intergenic
1005613311 6:27547626-27547648 TCGGGAGTTGTAGGAATTCATGG + Intergenic
1008766232 6:54918858-54918880 CGGGGAGTTACACCATTTGAGGG - Intronic
1018500534 6:164406084-164406106 CCTGTAGTTGTAGCATTTGATGG + Intergenic
1021142193 7:17040225-17040247 GTGGCAGTTATAGGACTTGATGG + Intergenic
1021584109 7:22189487-22189509 CTGTGAGTTAGAGGAGTTGAAGG - Intronic
1024726497 7:52202712-52202734 CCAGGAGTTCCAGGAGTTGAAGG + Intergenic
1037906333 8:22718039-22718061 CCCGGAGTAATTGGATGTGATGG - Intronic
1039369503 8:36970590-36970612 AAGGGAGTTAGAGGATTGGATGG + Intergenic
1040884315 8:52243244-52243266 CATGGAGTTATAGAATTTGGGGG + Intronic
1044544663 8:93446469-93446491 CCGGGAGTCATTTAATTTGATGG - Intergenic
1046909550 8:119610968-119610990 CAGGGAGTTTTGGGATTAGAGGG - Intronic
1048211660 8:132459144-132459166 ACGGGGGTTATGGGATTTGTGGG + Intronic
1050407187 9:5321983-5322005 CAGGAAGGTATAGAATTTGAAGG + Intergenic
1051686131 9:19659915-19659937 CCAGTAGTTTTAGGCTTTGATGG - Intronic
1190486805 X:50934921-50934943 CCGTGACTTATTGGTTTTGAGGG + Intergenic
1190516790 X:51232022-51232044 CTGGGACTTATGGGACTTGAGGG + Intergenic