ID: 1106995722

View in Genome Browser
Species Human (GRCh38)
Location 13:35478045-35478067
Sequence CCGGGAGTTATAGGATTTGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 76
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 67}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106995722_1106995727 29 Left 1106995722 13:35478045-35478067 CCGTCAAATCCTATAACTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1106995727 13:35478097-35478119 CTTTTAACAAGATATTCTTCAGG 0: 1
1: 0
2: 5
3: 30
4: 292
1106995722_1106995728 30 Left 1106995722 13:35478045-35478067 CCGTCAAATCCTATAACTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1106995728 13:35478098-35478120 TTTTAACAAGATATTCTTCAGGG 0: 1
1: 0
2: 3
3: 41
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106995722 Original CRISPR CCGGGAGTTATAGGATTTGA CGG (reversed) Intronic