ID: 1106995728

View in Genome Browser
Species Human (GRCh38)
Location 13:35478098-35478120
Sequence TTTTAACAAGATATTCTTCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 555
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 510}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1106995725_1106995728 12 Left 1106995725 13:35478063-35478085 CCCGGTAACATGTTTGTAGACAC 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1106995728 13:35478098-35478120 TTTTAACAAGATATTCTTCAGGG 0: 1
1: 0
2: 3
3: 41
4: 510
1106995726_1106995728 11 Left 1106995726 13:35478064-35478086 CCGGTAACATGTTTGTAGACACT 0: 1
1: 0
2: 0
3: 10
4: 145
Right 1106995728 13:35478098-35478120 TTTTAACAAGATATTCTTCAGGG 0: 1
1: 0
2: 3
3: 41
4: 510
1106995724_1106995728 21 Left 1106995724 13:35478054-35478076 CCTATAACTCCCGGTAACATGTT 0: 1
1: 0
2: 0
3: 3
4: 45
Right 1106995728 13:35478098-35478120 TTTTAACAAGATATTCTTCAGGG 0: 1
1: 0
2: 3
3: 41
4: 510
1106995722_1106995728 30 Left 1106995722 13:35478045-35478067 CCGTCAAATCCTATAACTCCCGG 0: 1
1: 0
2: 0
3: 8
4: 67
Right 1106995728 13:35478098-35478120 TTTTAACAAGATATTCTTCAGGG 0: 1
1: 0
2: 3
3: 41
4: 510

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1106995728 Original CRISPR TTTTAACAAGATATTCTTCA GGG Intronic