ID: 1107002043

View in Genome Browser
Species Human (GRCh38)
Location 13:35559284-35559306
Sequence TTTAGAGCACCCTTTATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 246
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 222}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107002043_1107002045 15 Left 1107002043 13:35559284-35559306 CCTAAAATAAAGGGTGCTCTAAA 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG 0: 1
1: 0
2: 0
3: 1
4: 72
1107002043_1107002046 16 Left 1107002043 13:35559284-35559306 CCTAAAATAAAGGGTGCTCTAAA 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1107002046 13:35559323-35559345 AGTATCACTTTAACGAACACGGG 0: 1
1: 0
2: 0
3: 2
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107002043 Original CRISPR TTTAGAGCACCCTTTATTTT AGG (reversed) Intronic
900112520 1:1014512-1014534 TTTACAACAGCCTTTATTTCCGG - Exonic
904056171 1:27671762-27671784 TTTAGAATCCCCTTTATTATAGG - Intronic
904742219 1:32687025-32687047 TTTAGAGAAAACTTTAGTTTTGG + Intronic
905927909 1:41765100-41765122 CTTTGACCTCCCTTTATTTTTGG + Intronic
908141668 1:61191475-61191497 TTCCCAGCACCATTTATTTTGGG + Intronic
909050140 1:70756707-70756729 TATAGATCACCATTTATTTATGG + Intergenic
909170975 1:72295042-72295064 GTTAGAGCATCCTTTTGTTTTGG + Intergenic
909786414 1:79619757-79619779 ATAAGAGCACATTTTATTTTCGG + Intergenic
910068158 1:83178888-83178910 TTTATAACACCTTTAATTTTAGG + Intergenic
911306025 1:96233219-96233241 TTTAAAGCATTCTTTATATTTGG + Intergenic
916371818 1:164105955-164105977 TTTTGAGCTCTCTGTATTTTTGG - Intergenic
919346693 1:196389804-196389826 TTTAGAGTACCCTTTGCTCTGGG + Intronic
919605905 1:199683625-199683647 TTTAGATCAGTCTTTACTTTAGG - Intergenic
921136886 1:212269253-212269275 TCTAGAGTAGCCTTTACTTTAGG + Intergenic
921972777 1:221168474-221168496 CTTAGAGCACCATTTAGGTTAGG + Intergenic
923905657 1:238381195-238381217 TTTAGATCACCATTTATATAAGG - Intergenic
1063376964 10:5559964-5559986 CTTAAAGCACGCTTTATTTATGG - Intergenic
1064375296 10:14789967-14789989 TTCACAGCACCTTTTATTTGAGG - Intergenic
1065238747 10:23684201-23684223 TTTTGAACACTCTTAATTTTGGG - Intergenic
1070047457 10:72852983-72853005 TCTAGAGAATCCTTTATTCTAGG - Intronic
1074006194 10:109426980-109427002 CTAATAGCCCCCTTTATTTTTGG + Intergenic
1074630000 10:115242493-115242515 TTAAGAGCACCTTTTATTGAGGG + Intronic
1074796469 10:116950685-116950707 TTTAGTGTAGGCTTTATTTTTGG + Intronic
1076361702 10:129894305-129894327 TTTAGAACCCCCTTCATTTATGG - Intronic
1078040234 11:7854790-7854812 TTGAGACCATACTTTATTTTTGG - Intergenic
1079993904 11:27275012-27275034 TTTAGACCATTGTTTATTTTTGG - Intergenic
1081321590 11:41698283-41698305 TTTAGAGCTATCTTTATTTTGGG + Intergenic
1081840583 11:46198422-46198444 TTTAGGGCAGCATTTATTTGAGG - Intergenic
1082041786 11:47691924-47691946 TTTAGAAAACATTTTATTTTGGG + Intronic
1083414873 11:62518938-62518960 TTCAGGTCACCCTCTATTTTTGG + Exonic
1087227420 11:95616894-95616916 TTTAGAGCAGCCTGTAATCTGGG - Intergenic
1088343337 11:108794616-108794638 TTAAGACAATCCTTTATTTTTGG + Intronic
1088726629 11:112643813-112643835 ACTAGAGCAGCCTTTAGTTTAGG + Intergenic
1089437711 11:118484716-118484738 TTTAAAGCAGCAGTTATTTTTGG + Intronic
1090485422 11:127108259-127108281 TTTAGAGCAGCCAACATTTTTGG - Intergenic
1091341298 11:134816216-134816238 TCTAGGGCAACCTATATTTTTGG - Intergenic
1092962010 12:13605295-13605317 ATTAGAGATCCCTTTATTTGTGG - Intronic
1093091695 12:14928575-14928597 ATTTAAGCACTCTTTATTTTGGG + Intronic
1093261562 12:16943991-16944013 TGCAGAGCACCCTTTAATCTAGG + Intergenic
1095993707 12:48059792-48059814 TCCAGAGCAGCCTTTATTCTAGG + Intronic
1097364593 12:58697724-58697746 TTTATAGCACTATTTTTTTTTGG + Intronic
1097908929 12:64948650-64948672 CTTAGAGCATCCTTCATTTAAGG + Intergenic
1099086228 12:78249262-78249284 TTGACATCATCCTTTATTTTAGG - Intergenic
1101748161 12:107559826-107559848 TTCATAGCACCTTTTATTGTAGG - Intronic
1106139909 13:27003430-27003452 TTGGGAGCAGCCTCTATTTTGGG + Intergenic
1106508616 13:30393416-30393438 GTTAGAGCTACCTTTAGTTTTGG + Intergenic
1106895674 13:34299535-34299557 TTCTGAGCAACCTTTATTCTAGG + Intergenic
1106974014 13:35184378-35184400 TCTAGAGTAGCCTTTATATTAGG - Intronic
1107002043 13:35559284-35559306 TTTAGAGCACCCTTTATTTTAGG - Intronic
1107704919 13:43092650-43092672 TTTAAAAGACCATTTATTTTGGG + Intronic
1107757212 13:43637431-43637453 TTTTGAGTATCCTTAATTTTTGG - Intronic
1107796913 13:44062332-44062354 TATAGAGCTCCCAATATTTTAGG + Intergenic
1108006518 13:45952527-45952549 TTTAAAGCTCCCTATGTTTTAGG + Intergenic
1109391447 13:61699474-61699496 TTCAGGGTACCCATTATTTTGGG + Intergenic
1110715670 13:78701226-78701248 TTTAGAGCAGCTTTGATTTCTGG + Intergenic
1111255888 13:85668202-85668224 TTTAAAGCATACCTTATTTTAGG - Intergenic
1111854126 13:93614712-93614734 TCTATAGCACCCTTTCCTTTTGG - Intronic
1112120398 13:96404204-96404226 TTTAAATCACATTTTATTTTTGG + Intronic
1112988662 13:105483396-105483418 GATAGATCACCCTTTATTTAAGG + Intronic
1115759316 14:36562085-36562107 TCCAGAGAAACCTTTATTTTGGG - Intergenic
1116692390 14:48125977-48125999 TTTAGAGTACCTTTTCTTTCAGG - Intergenic
1117185903 14:53240627-53240649 ATTACAGCACTGTTTATTTTAGG + Intergenic
1118638564 14:67770970-67770992 TTTAAATCAACTTTTATTTTAGG + Intronic
1120150946 14:81032962-81032984 TTTGGTGCACCTTTTGTTTTTGG - Intronic
1120934524 14:89881412-89881434 TTTAGAGCTACTTATATTTTTGG + Intronic
1121639842 14:95478013-95478035 TTTAGAGCACCCCTTCTTGTTGG + Intergenic
1125212209 15:37230190-37230212 TCAAGAGGACCCTATATTTTCGG + Intergenic
1126817171 15:52465461-52465483 TTTTGGTCACCCTGTATTTTGGG - Intronic
1127615554 15:60681972-60681994 TTAAGAGCTGCCTTTATTCTTGG - Intronic
1129957761 15:79655016-79655038 TGAGGGGCACCCTTTATTTTTGG - Intergenic
1130289634 15:82586377-82586399 TTTAGAGTATTCTTTCTTTTAGG - Intronic
1130430064 15:83838811-83838833 TTTAAAACATCCTTTAGTTTGGG + Intronic
1132288378 15:100682423-100682445 TTTAAAGCACCCTTCATTTATGG - Intergenic
1135014854 16:18916734-18916756 TTCAGAGCCCATTTTATTTTTGG - Intronic
1136331952 16:29585704-29585726 TTCAGAGCCCATTTTATTTTTGG - Intergenic
1136446587 16:30325446-30325468 TTCAGAGCCCATTTTATTTTTGG - Intergenic
1139897730 16:70301040-70301062 TTTAGAGCACAGTTCATATTGGG + Intronic
1141809381 16:86364710-86364732 TTTGGAGCTCCCTTGGTTTTTGG - Intergenic
1142912337 17:3104925-3104947 TGTAGAGTCCGCTTTATTTTTGG - Intergenic
1145093686 17:20007000-20007022 TTTTCTGAACCCTTTATTTTAGG - Intergenic
1145733006 17:27207020-27207042 TCCAAAGCACTCTTTATTTTTGG - Intergenic
1152012947 17:77730093-77730115 TTTAGAACAACCTTTAGTCTAGG - Intergenic
1152054434 17:78012487-78012509 TTTAAAAAAGCCTTTATTTTAGG - Intronic
1152483135 17:80569777-80569799 TCTAGAGAAGCCTTTACTTTTGG + Intronic
1153695866 18:7640851-7640873 TTTAGAGCACCCTGAAGTTGGGG + Intronic
1155372889 18:25121747-25121769 TGCAGAGCAACCTTTAATTTAGG - Intronic
1159388297 18:67755984-67756006 TTTAGTGTTCCCTTTATTTTTGG - Intergenic
1159894574 18:73984055-73984077 TTAAGGGAACACTTTATTTTTGG - Intergenic
1164225010 19:23236652-23236674 TTTAGAGAGACGTTTATTTTAGG - Intronic
1167541209 19:50088364-50088386 TGTTGAGCCCCCTTTTTTTTTGG - Intergenic
1167820152 19:51920434-51920456 TTTGGAGAATTCTTTATTTTGGG + Intronic
925126871 2:1463644-1463666 TTTGCAGCATCCTCTATTTTAGG + Intronic
925529673 2:4845281-4845303 TTTAGAGCACACTTTCTGGTTGG + Intergenic
928014579 2:27643697-27643719 TATAGAGCATCCTTCAGTTTAGG + Intronic
928034759 2:27811730-27811752 TTTAGAACTCTCTTTGTTTTTGG - Intronic
928036993 2:27833718-27833740 TTTAAAACACCCTTTGGTTTGGG + Intronic
928491259 2:31785755-31785777 TTTAAAACAACTTTTATTTTAGG - Intergenic
930355166 2:50309029-50309051 TTGAGAGATCCCTTTATGTTAGG - Intronic
930451701 2:51547235-51547257 TTTAAAGCTGCCTTTATTTTTGG + Intergenic
931473691 2:62566375-62566397 TATATAGCACTCTTTATTCTTGG + Intergenic
931962050 2:67493067-67493089 TTCACAGCACCTTTTATTTATGG + Intergenic
935551329 2:104460021-104460043 TTTACAGCACTCTTTATGCTAGG - Intergenic
938004092 2:127773466-127773488 TTTATTGCACTATTTATTTTTGG - Intronic
939094584 2:137820264-137820286 GATAGAACACCCTTTATTCTAGG + Intergenic
939282440 2:140081652-140081674 TTTAGAGCAAGCTTTATTACTGG + Intergenic
940132746 2:150402201-150402223 TTTAAACCACCCTCTGTTTTTGG - Intergenic
941625048 2:167822222-167822244 TTTAGAGAACTCTTAAATTTTGG - Intergenic
942314530 2:174685206-174685228 TTCAGAACACAATTTATTTTTGG - Intergenic
942798090 2:179844821-179844843 TTTGGAGGACCCTTTCTTATTGG - Intronic
943964128 2:194309864-194309886 TCTAGAGCAGCCTTTATTCTGGG + Intergenic
944274163 2:197817237-197817259 TTGGGAGAACCCTTTCTTTTTGG - Intronic
944537162 2:200722498-200722520 TTTAAAAAACCTTTTATTTTAGG - Intergenic
944699092 2:202229932-202229954 TTTATAGCACCTTCTATTTCAGG - Intronic
946474392 2:219993701-219993723 TTGAGACCAGCCTTTGTTTTTGG - Intergenic
946723239 2:222633737-222633759 TTTAGAGCTTTCTTTAATTTGGG - Intronic
948297319 2:236871319-236871341 TTGATAGCACCCTTCAATTTTGG + Intergenic
948924423 2:241085794-241085816 TTTGGAGTAGCCTTTATTCTGGG + Intronic
1169462099 20:5804572-5804594 TTTAGAGCACATATTATGTTAGG - Intronic
1169692135 20:8343769-8343791 TTTAGAGAATTCTTTATTTCAGG + Intronic
1171787367 20:29480443-29480465 TTTAGAGCACCCTTAAATTCCGG - Intergenic
1171860584 20:30398941-30398963 TTTAGAGCACCCTTAAATTCCGG + Intronic
1172509013 20:35486897-35486919 TTTATAGCATCTTTTATTTATGG - Intronic
951346429 3:21551838-21551860 TTTATAGTACAGTTTATTTTTGG - Intronic
952065857 3:29569207-29569229 TTTAGAGAACTGTTTAGTTTAGG - Intronic
953284129 3:41589627-41589649 TTTAGAAGTGCCTTTATTTTAGG - Intronic
955980480 3:64520707-64520729 TTTCCAGCACCATTTATTATAGG - Intronic
956706205 3:72001295-72001317 TTTAGGGCTCCCTTTATTTTAGG + Intergenic
956954512 3:74320782-74320804 TTTAGAGCACACTTTTATTGTGG + Intronic
957264988 3:77951711-77951733 TTTAGTGCAGTCTTTATTTCTGG - Intergenic
958062525 3:88502543-88502565 TTTAAAGCACACCTTCTTTTTGG + Intergenic
958643869 3:96843451-96843473 TTTACAGAACCCTTTCTTTAAGG + Intronic
959366018 3:105458454-105458476 ATTAGAGCAGCCTTTATTTCTGG - Intronic
960933974 3:122884555-122884577 TTTAAAGCACTATTTAATTTAGG + Intergenic
962139524 3:132773612-132773634 TCTAGAGCCCCTTTTAATTTGGG - Intergenic
962327161 3:134445433-134445455 TCTAGAGTAGCCTTTATTTTAGG + Intergenic
963542611 3:146612354-146612376 TTTATAGCAGTCTATATTTTTGG - Intergenic
964653009 3:159032973-159032995 TTTAGAAAAACTTTTATTTTAGG + Intronic
964936377 3:162093800-162093822 TTTATCCCTCCCTTTATTTTTGG + Intergenic
966448247 3:180027873-180027895 TATAGAGTAGCCTTTATTTTGGG + Intronic
966648777 3:182275461-182275483 CTTAGACCACACTTTGTTTTGGG + Intergenic
967498317 3:190167194-190167216 TTTGGCGCACCTTTCATTTTTGG - Intergenic
967959103 3:194905482-194905504 TTTAGAGCACATCTTAATTTAGG - Intergenic
970832341 4:20356092-20356114 TTTAGTGGACATTTTATTTTGGG + Intronic
971637684 4:29083859-29083881 TTTAAAGCATTGTTTATTTTAGG + Intergenic
976106819 4:81627836-81627858 TTTAAAGCACCCTGTAACTTTGG + Intronic
977211612 4:94224583-94224605 TTTAGAACATTTTTTATTTTGGG + Intronic
977695155 4:99956738-99956760 GTTTGAGCCCCTTTTATTTTGGG + Intergenic
977909545 4:102516863-102516885 TTTAGAGTAGCCCTTATTTTAGG + Intronic
978003634 4:103589471-103589493 TTTAAAGCCCATTTTATTTTGGG + Exonic
978294419 4:107186842-107186864 TTTAAAAAAACCTTTATTTTAGG - Intronic
980023017 4:127731353-127731375 TTTAGGGCCCCCTTGAATTTTGG - Intronic
980224993 4:129971309-129971331 TTTAAAGCAACCTTTGTTTTAGG - Intergenic
981092652 4:140747638-140747660 TTTAGAGTAACAATTATTTTGGG + Intronic
981437300 4:144740247-144740269 AATAGAACACCTTTTATTTTGGG - Exonic
982896190 4:160930226-160930248 TCTAGAGCTTCCTCTATTTTGGG - Intergenic
983009315 4:162526267-162526289 TTTAGCTCACACTTTATTTGTGG - Intergenic
983210077 4:164949454-164949476 CTTAGAGCACCCTTTGTATGTGG + Intergenic
983684689 4:170394444-170394466 TTTGGAGCACTTTTTATTTAAGG + Intergenic
984540277 4:181029763-181029785 CTTAGAACACACTTTATTGTTGG + Intergenic
984679255 4:182588130-182588152 TTTAAAATTCCCTTTATTTTAGG - Intronic
985438769 4:189962819-189962841 TTTAGAGCAGCCTTAAATTCCGG + Intronic
986017480 5:3770318-3770340 TTTATAGCACCTCATATTTTAGG - Intergenic
988112662 5:26843100-26843122 TTTAGAGAATTCTGTATTTTTGG - Intergenic
988959422 5:36354733-36354755 TTAAAAGCAACATTTATTTTGGG + Intergenic
989159082 5:38372860-38372882 TTTGGAAAACCCTTTATTCTAGG + Intronic
990625286 5:57603912-57603934 TTTAGGGAAGCCTTTATTCTAGG - Intergenic
991182590 5:63770878-63770900 TACAGAACACCCTTTATTTTAGG + Intergenic
992070836 5:73147083-73147105 TCTAGAGTAGCCTTTATTTTAGG - Intergenic
993349849 5:86836291-86836313 TTCAGAGCAGCCTTTACTCTAGG + Intergenic
994471271 5:100211213-100211235 TTTAAAAAAACCTTTATTTTAGG - Intergenic
994738977 5:103594694-103594716 TCTAGATCACTCTTCATTTTTGG + Intergenic
995220165 5:109639713-109639735 TTTAAAAAAACCTTTATTTTAGG - Intergenic
995557302 5:113342836-113342858 TTTTGAGCACCCTTCTGTTTAGG - Intronic
997498052 5:134347182-134347204 TTTAAAGTAAACTTTATTTTGGG - Intronic
998771719 5:145553192-145553214 TTAACAGCTCCCTTTTTTTTTGG - Intronic
999590185 5:153136575-153136597 TTTAGAGCTATTTTTATTTTTGG + Intergenic
1004231980 6:13841968-13841990 TCTAGAGCACCATTGATTGTAGG + Intergenic
1004771178 6:18784120-18784142 TCAAGAGCAGCCTTTATTCTAGG - Intergenic
1008891001 6:56490304-56490326 TTTTGAGCACAGTTTCTTTTCGG + Intronic
1009903263 6:69835894-69835916 TGTAGAGCACCATCTAGTTTTGG - Intergenic
1009927932 6:70142745-70142767 TATATACCACCTTTTATTTTAGG + Exonic
1009979187 6:70706207-70706229 TTTAGAGAAACATTTATTATTGG + Intronic
1010058177 6:71589226-71589248 TTTAAAACACCTTGTATTTTAGG - Intergenic
1013785641 6:113776853-113776875 TATAAAGCAACCTCTATTTTGGG - Intergenic
1013835766 6:114333497-114333519 TTTATAGCAGCATTTACTTTGGG - Intronic
1014090176 6:117395682-117395704 TTGTAAGCACCCTTTCTTTTTGG - Intronic
1015176455 6:130314312-130314334 TTTGGAGGTCCCTTTATTTCAGG - Intronic
1015880839 6:137868263-137868285 TTTTGAGCCCGCTTTGTTTTCGG + Intronic
1016408362 6:143755987-143756009 CTTAATTCACCCTTTATTTTGGG + Intronic
1018465019 6:164035980-164036002 TTAAGTGCATCCTATATTTTTGG - Intergenic
1020587448 7:10086695-10086717 ATTTGAGCACCCTTAAGTTTTGG - Intergenic
1020592890 7:10166039-10166061 TTTGGACCAACCCTTATTTTTGG - Intergenic
1020634162 7:10675989-10676011 TTTAGACCATCCTTTATACTTGG + Intergenic
1021189164 7:17600789-17600811 CTTAGACCACCTTTTTTTTTAGG + Intergenic
1021241334 7:18205845-18205867 TTTAAAGAAGCCTATATTTTGGG + Intronic
1023973005 7:45005608-45005630 TTTAAATCACCCTCTATTGTTGG + Intronic
1026317001 7:69235769-69235791 TTTAAAGGAACCTTTCTTTTAGG + Intergenic
1027275940 7:76555871-76555893 TTTATAACACCTTTTATTTTAGG - Intergenic
1027905535 7:84175914-84175936 TTTATAGCACTTTTTATTTATGG + Intronic
1027923617 7:84430853-84430875 TTTAGACCAGCATTTAGTTTTGG + Intronic
1028117507 7:87016831-87016853 TTTAGAGAACTTTTTACTTTGGG - Intronic
1031351324 7:120735076-120735098 TTTATGGAACCCTTCATTTTTGG + Intronic
1031756743 7:125653663-125653685 TTTACAGATCTCTTTATTTTGGG + Intergenic
1032904825 7:136351971-136351993 TTTAGTGAACACTTTAATTTTGG + Intergenic
1033048282 7:137981818-137981840 TTTGGAGCAAACTCTATTTTTGG - Intronic
1033904593 7:146186784-146186806 TTTATGGCATCCTTTATTTTTGG + Intronic
1034593103 7:152160702-152160724 TTTAAATCACACTTTAATTTGGG + Intronic
1037433974 8:18843520-18843542 TTCAGAGCACTCTGTATTCTGGG + Intronic
1039236199 8:35505290-35505312 TTTGGGGGACCATTTATTTTGGG - Intronic
1039409958 8:37344800-37344822 TTTAGAGCAGCCTTTACTCTAGG - Intergenic
1041703834 8:60823723-60823745 TTTGGAGATCTCTTTATTTTAGG - Intronic
1042160250 8:65886314-65886336 TTTTGGGCCACCTTTATTTTTGG - Intergenic
1042507564 8:69577266-69577288 TTTATAGCACCTTTCATTTGAGG + Intronic
1043936088 8:86143969-86143991 CTTGGGGCAGCCTTTATTTTAGG - Intronic
1044118794 8:88367892-88367914 TTTAGCCAACCCTGTATTTTAGG - Intergenic
1044491268 8:92818779-92818801 TTTAAAGCTCCCTTTCTCTTTGG + Intergenic
1044995641 8:97835708-97835730 CTTGGAGCCCCCTTTCTTTTAGG + Intronic
1047061786 8:121235546-121235568 TTTTGAGCACCCATTATTTCAGG + Intergenic
1047287273 8:123498372-123498394 TTTGGAGCAGCCATCATTTTTGG + Exonic
1049226700 8:141455572-141455594 TTTAGAACCCCCTTTAGTTTGGG - Intergenic
1050749933 9:8925272-8925294 ATAAGAGCACCCTTTAATGTAGG - Intronic
1051128553 9:13833832-13833854 TTTAAAGTAGTCTTTATTTTTGG - Intergenic
1052557493 9:30035856-30035878 TTTAAAGCATTCTTTATATTTGG - Intergenic
1054989704 9:71309524-71309546 TGCAGAGCATACTTTATTTTGGG - Intronic
1055254568 9:74352803-74352825 TTTGAAGTAGCCTTTATTTTAGG + Intergenic
1055298320 9:74856543-74856565 CTTAGAGCGGCCCTTATTTTAGG - Intronic
1056849696 9:90072093-90072115 TGTGCAGCACCCTTTATTTTAGG + Intergenic
1058564221 9:106264002-106264024 TAGAGAGCAGCCTTTATTCTAGG + Intergenic
1058773253 9:108259383-108259405 TGTGGAGCAACTTTTATTTTAGG + Intergenic
1059761486 9:117341924-117341946 TTGAGTGCACCCTTCATTTAGGG + Intronic
1203447967 Un_GL000219v1:77926-77948 TTTAGAGCACCCTTAAATTCCGG - Intergenic
1185735858 X:2495697-2495719 TTTACAGCAACCTTTATTCGTGG - Intronic
1185816574 X:3162005-3162027 TTTAGAGCTCCAAGTATTTTTGG - Intergenic
1187506838 X:19885684-19885706 TTTTGATCACCTTTCATTTTGGG - Intronic
1188509417 X:30919365-30919387 TTTAGATTAGCCTTTATTCTAGG + Intronic
1189441113 X:41037021-41037043 TTCAGAGCAACCTTTCCTTTAGG - Intergenic
1190343055 X:49312635-49312657 TATAGAGCCCCCTTTATTGGAGG + Intronic
1193869971 X:86785122-86785144 TTTTGAAAACCTTTTATTTTAGG - Intronic
1194117335 X:89919144-89919166 TTTAGAGAAAGCTTAATTTTTGG - Intergenic
1194126606 X:90025894-90025916 ATTAGATCCCACTTTATTTTTGG - Intergenic
1195765068 X:108287478-108287500 TCTAGAGCAGCCTTGAGTTTAGG + Intronic
1196930807 X:120680336-120680358 TCTAGAATACCCTTTAGTTTAGG + Intergenic
1200470125 Y:3576287-3576309 TTTAGAGAAAGCTTAATTTTTGG - Intergenic
1201264845 Y:12195826-12195848 TTTAGAGCTCCAAGTATTTTTGG + Intergenic
1201278133 Y:12317334-12317356 TATAGAGCCCCCTTTACTTGAGG + Intergenic
1201358028 Y:13116642-13116664 TATAGAGCCCCCTTTACTTGAGG + Intergenic