ID: 1107002045

View in Genome Browser
Species Human (GRCh38)
Location 13:35559322-35559344
Sequence CAGTATCACTTTAACGAACA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 72}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107002043_1107002045 15 Left 1107002043 13:35559284-35559306 CCTAAAATAAAGGGTGCTCTAAA 0: 1
1: 0
2: 1
3: 22
4: 222
Right 1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG 0: 1
1: 0
2: 0
3: 1
4: 72

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107002045 Original CRISPR CAGTATCACTTTAACGAACA CGG Intronic
900356839 1:2269031-2269053 GAGGATCACTTGAACCAACAAGG - Intronic
905754045 1:40492556-40492578 CAGAACAACTTTAAAGAACAAGG - Intronic
919085898 1:192919678-192919700 CAACATCACTTTAGTGAACATGG - Intergenic
923956849 1:239031954-239031976 TATTATCACTTTAATGTACAAGG - Intergenic
1065168258 10:23003102-23003124 CAGTATTACTTTATCTAAGAGGG + Intronic
1068628872 10:59279103-59279125 CAGTAATACTTTATAGAACACGG - Intronic
1068836255 10:61557340-61557362 CAATAACGCTTTAATGAACATGG - Intergenic
1070364943 10:75727604-75727626 CATTGTCACGTTAAAGAACATGG - Intronic
1071187940 10:83065088-83065110 CAGTATCTCCTTAACCAAAAGGG + Intergenic
1071212868 10:83364716-83364738 CAGTATCAGTTTAACCAGCGAGG - Intergenic
1086246344 11:84757780-84757802 CAGTATCACTGGAAGCAACATGG - Intronic
1087523016 11:99267546-99267568 AAGTATCAATTAAACTAACAAGG - Intronic
1090766861 11:129883841-129883863 CAGTGTCACTGTAACGATTAAGG + Intronic
1098061821 12:66571046-66571068 CACTATCACTTTAGTTAACATGG + Intronic
1098480620 12:70955239-70955261 CAGTATCACTTTCAATAACCTGG - Intergenic
1102631314 12:114283094-114283116 CAATATCACTTTGATGAGCAAGG - Intergenic
1103515270 12:121503758-121503780 CTGAATTACTTTAAGGAACAAGG - Intronic
1104738768 12:131157363-131157385 CCCTATCACTTGAATGAACATGG - Intergenic
1107002045 13:35559322-35559344 CAGTATCACTTTAACGAACACGG + Intronic
1111416354 13:87950397-87950419 CAGTATCACTTTAAATGACCTGG - Intergenic
1116750236 14:48873696-48873718 CAGTGTTACCTTAACTAACATGG - Intergenic
1124953310 15:34343042-34343064 CAGTATTACCTCAACGAGCAGGG - Exonic
1125095424 15:35844763-35844785 CAGTTTCCCTTTAAGGAACTGGG + Intergenic
1132492418 16:239902-239924 CAGAACCACTTTAAAGATCATGG - Intronic
1137332705 16:47514809-47514831 TAATATCACTTTAACAAAAAAGG - Intronic
1137902366 16:52282621-52282643 CTGTATGACTTTAAGGTACAAGG - Intergenic
1158106025 18:53885740-53885762 CAGTATCACTTTGATATACATGG - Intergenic
1161832443 19:6616778-6616800 GAGTTCCACTTTAGCGAACACGG + Intergenic
1163397613 19:17073240-17073262 CAGGATCTCTTTAAGGAACATGG - Intronic
925117678 2:1394326-1394348 CAGTTTCATTTTGACGACCATGG + Intronic
931847300 2:66217803-66217825 CAGTAAGTTTTTAACGAACAAGG - Intergenic
933357387 2:81229444-81229466 CAGTATCACTGGAAGAAACAAGG + Intergenic
939466996 2:142569959-142569981 CAGACTCACTTTAAATAACAAGG - Intergenic
942296803 2:174525349-174525371 GAGTATCACATTGACCAACAAGG + Intergenic
947360339 2:229339892-229339914 CATTAGCACTTTGACAAACACGG - Intergenic
1170105409 20:12750149-12750171 CAGTAGCAATTTATTGAACAGGG - Intergenic
1174208374 20:48857681-48857703 CAGGATCACTTGAACCAAGAAGG + Intergenic
1174365625 20:50054577-50054599 CAGTATCACTTTGTCGAATGTGG + Intergenic
1176691264 21:9913151-9913173 CTTTATCACTTTAACGCAGATGG + Intergenic
1177449023 21:21240725-21240747 CAGTGTCATTTTAAGGGACAAGG - Intronic
1182469219 22:30537272-30537294 CAGTTTCAGTTTAGCGAGCATGG - Intronic
953541712 3:43825146-43825168 CAGTAACACTTTAATTAATATGG - Intergenic
956388345 3:68744983-68745005 GGGTAACACTTTGACGAACAAGG - Intronic
961970801 3:130965078-130965100 CAGTATCCCTTTAAGAAACTTGG + Intronic
962234520 3:133695701-133695723 CAGTATCACTTTAACACAGTTGG + Intergenic
965042286 3:163524902-163524924 CAATATCAATTTAACAAACGGGG - Intergenic
967948307 3:194821272-194821294 CAGTATCACTTTCTCAACCAAGG + Intergenic
972218080 4:36919828-36919850 AAGTGTCTCTTTAATGAACATGG + Intergenic
978830846 4:113082888-113082910 CAGGATCACTTTTACAAAGATGG - Intronic
980363848 4:131773337-131773359 CTTTATCACTTTAACGCAGATGG + Intergenic
980909213 4:138978587-138978609 CTGTTTCACTTTAATGCACACGG - Intergenic
982469129 4:155765420-155765442 CATTTCCTCTTTAACGAACAAGG - Intronic
984122107 4:175758346-175758368 CAGTAGCATTTTTACGAAAATGG + Intronic
986611809 5:9575823-9575845 AAGTCTCACTTTGAGGAACAAGG + Intergenic
986878629 5:12142201-12142223 TAGTATGACTTTAAAGAAAATGG + Intergenic
1003440805 6:6139835-6139857 AGGTATCACTTTAGAGAACAGGG - Intergenic
1015629652 6:135219208-135219230 CAGTTACACTTTAAAGAAAATGG + Intergenic
1016276083 6:142354287-142354309 GAGAATCACTTGAACGAACTTGG + Intronic
1016949737 6:149567438-149567460 AAGTGTCACTTTGACCAACAAGG + Intronic
1017602982 6:156103516-156103538 CAGAATCACTTTAACTTAAATGG + Intergenic
1018352336 6:162973104-162973126 CAGCATCACTTTACCGTACTAGG - Intronic
1018942503 6:168319056-168319078 CTGTAACCCTGTAACGAACAGGG + Intronic
1021256097 7:18394201-18394223 GAGTGTCCCTTTAACAAACAAGG - Intronic
1023083320 7:36545791-36545813 CAGCATCCCTGAAACGAACATGG - Intronic
1025156108 7:56606946-56606968 CAGTTTCACTTCTAGGAACACGG + Intergenic
1027946588 7:84753763-84753785 CAGTAACACTGTAATGATCATGG - Intergenic
1031030397 7:116727931-116727953 CAGTAGGACTTCAACTAACAGGG - Intronic
1045474087 8:102538381-102538403 CAGCATCACTTCACTGAACATGG + Intronic
1046164500 8:110414054-110414076 AAGTATCACTTAAATGAACTTGG - Intergenic
1046209753 8:111054359-111054381 CAGAATCAATTTAACCAAGAAGG - Intergenic
1058719450 9:107750335-107750357 TAGTATCACTTTAACCAAATGGG - Intergenic
1059629258 9:116102344-116102366 TAATATTACTTTAACTAACATGG - Intergenic
1186695042 X:12021467-12021489 CAATATCATTTAAAGGAACAAGG + Intergenic
1195969622 X:110459057-110459079 CAGAATCACTTGAACCCACAAGG - Intergenic