ID: 1107002376

View in Genome Browser
Species Human (GRCh38)
Location 13:35564026-35564048
Sequence GAGGGTAGAGGGAAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 8639
Summary {0: 2, 1: 30, 2: 344, 3: 1872, 4: 6391}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107002376_1107002385 27 Left 1107002376 13:35564026-35564048 CCTTCCTCCTTCCCTCTACCCTC 0: 2
1: 30
2: 344
3: 1872
4: 6391
Right 1107002385 13:35564076-35564098 ATCATTTCTATTAAAAAGGCTGG 0: 1
1: 0
2: 0
3: 24
4: 312
1107002376_1107002384 23 Left 1107002376 13:35564026-35564048 CCTTCCTCCTTCCCTCTACCCTC 0: 2
1: 30
2: 344
3: 1872
4: 6391
Right 1107002384 13:35564072-35564094 GAAAATCATTTCTATTAAAAAGG 0: 1
1: 0
2: 9
3: 65
4: 804

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107002376 Original CRISPR GAGGGTAGAGGGAAGGAGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr