ID: 1107003530

View in Genome Browser
Species Human (GRCh38)
Location 13:35580507-35580529
Sequence TTGTCAGTATGTAGGTAAGT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 169
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 153}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107003530 Original CRISPR TTGTCAGTATGTAGGTAAGT AGG Intronic
900321577 1:2087014-2087036 CTGTCAGTATGATGGTCAGTTGG + Intronic
902992398 1:20197487-20197509 TTGTCAGTCTGTAGATAGGTGGG + Intergenic
905775329 1:40664490-40664512 TTATCAGGATGTAGGGAAGAAGG - Intronic
905784513 1:40743448-40743470 TTGTCTTTATGGAGGTGAGTTGG + Intronic
905967037 1:42107311-42107333 TGGTGAGTATGTGGGTAAGCTGG - Intergenic
906592417 1:47038812-47038834 ATGTAAGTAGGTGGGTAAGTGGG + Intronic
907563967 1:55417322-55417344 TTGTGTGTGTGTAGGTAGGTAGG + Intergenic
909618401 1:77639061-77639083 TGGTCGGTAGGTAGGTAGGTAGG + Intronic
909875708 1:80799825-80799847 ATCTCAGGAGGTAGGTAAGTGGG - Intergenic
910391186 1:86746304-86746326 CTGTCAGCATGGAGGTGAGTGGG - Intronic
910537295 1:88312968-88312990 TTGTAGGTAGGTAGGTAGGTAGG + Intergenic
912183940 1:107251916-107251938 TTCTCAGTATTTTGGTATGTAGG - Intronic
916945944 1:169727631-169727653 TTTTCAGCATGTAGGAAATTAGG + Intronic
917238242 1:172917818-172917840 TTTTCAGTTGGTAGGTAAGTTGG + Intergenic
918717591 1:187809660-187809682 ATGTATGTATGTAGGTAGGTAGG - Intergenic
918717592 1:187809664-187809686 TTGTATGTATGTATGTAGGTAGG - Intergenic
919255284 1:195113049-195113071 TGATCAGTACGTAGGTAAATTGG - Intergenic
922628618 1:227080836-227080858 TTGTGAGTATGTGGCCAAGTTGG - Intronic
924459603 1:244247239-244247261 ATGTCAGTAGGTAGGTAGGTGGG - Intergenic
1063229299 10:4048158-4048180 TTGTAAGTATATAGGTAATGGGG + Intergenic
1068282982 10:54900452-54900474 TTGTTAGTATTTAGTTAAGGTGG + Intronic
1068456565 10:57261987-57262009 TTGTCAACATGTAGGTATGTTGG - Intergenic
1068982125 10:63072866-63072888 TTTTCAATTTGTAGGTGAGTTGG + Intergenic
1077699911 11:4431779-4431801 TTGCCAGTAAGCAGGTGAGTGGG + Intergenic
1080380888 11:31771377-31771399 TTGTAAGGATGTGGGTAAGATGG + Intronic
1081126332 11:39327723-39327745 TTATCAGTATGTATATAAGATGG + Intergenic
1086553428 11:88080945-88080967 TTGTAAGTATGTTGGCAGGTAGG - Intergenic
1087800045 11:102493674-102493696 TGATCAGAATGTAGGTATGTAGG + Intronic
1089868753 11:121654328-121654350 TTGGGAGTTTATAGGTAAGTGGG + Intergenic
1090336830 11:125974339-125974361 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1095231466 12:39745210-39745232 TTGTCAGTATGTCAGTGATTAGG + Intronic
1099097877 12:78398208-78398230 TTGTCAAAATGTAGATAAGTAGG - Intergenic
1103240179 12:119406773-119406795 GTGGGGGTATGTAGGTAAGTGGG - Intronic
1106782690 13:33075404-33075426 GTGTGTGTGTGTAGGTAAGTCGG - Intergenic
1107003530 13:35580507-35580529 TTGTCAGTATGTAGGTAAGTAGG + Intronic
1109078053 13:57863939-57863961 ATGATAGTATGTAGTTAAGTGGG - Intergenic
1109430524 13:62227719-62227741 ATCTAAGTATATAGGTAAGTTGG + Intergenic
1109997216 13:70144524-70144546 TTTTCAGTATGTATGCAAATGGG + Intergenic
1110098915 13:71570840-71570862 TTGTCAGAGTTTAGATAAGTAGG - Intronic
1113348205 13:109501889-109501911 TAGACAGTAGGTAGGTAGGTAGG - Intergenic
1114140689 14:19906527-19906549 TTCTCAGTGTGTAGATAAGGGGG - Intergenic
1116520720 14:45843546-45843568 TAGTAGGTAGGTAGGTAAGTAGG + Intergenic
1123820179 15:24021648-24021670 ATGTATGTAGGTAGGTAAGTAGG + Intergenic
1125075052 15:35604307-35604329 TTGTCAGTTTGCAGGTAATACGG + Intergenic
1127194717 15:56571337-56571359 TTGTCAGTTTGTTGTTAAGTTGG - Intergenic
1131484136 15:92806606-92806628 TAGTGTGTATGTATGTAAGTAGG + Intronic
1133163381 16:3927993-3928015 TTGTAGGTAGGTAGGTAGGTAGG - Intergenic
1135015069 16:18918387-18918409 TTGTCAGTGTGTAGAGAAATTGG - Intronic
1137580079 16:49628212-49628234 GTGTGAGTATGTAGATAAATGGG - Intronic
1137685792 16:50385943-50385965 GTGTCAGTATGTTGGTATGATGG + Intergenic
1140740041 16:77933438-77933460 TAGTCAGTATGTAGAGAATTTGG + Intronic
1142778454 17:2161038-2161060 TTGTATGTATGTATGTAGGTAGG + Intronic
1142778455 17:2161042-2161064 ATGTATGTATGTAGGTAGGTAGG + Intronic
1143072964 17:4312877-4312899 GTGTCAGTGTGAAGGTAAGGTGG + Intronic
1143275177 17:5705130-5705152 TTGTCAGTTTGTCTGTGAGTGGG + Intergenic
1144387386 17:14761386-14761408 TTGTGAGAAAGTAAGTAAGTGGG + Intergenic
1144744607 17:17605494-17605516 TTTTCAGTGTGTATGTAAATGGG + Intergenic
1146369238 17:32254641-32254663 TTGTGAGGATGTAGGTAAAAAGG - Intergenic
1148008351 17:44453477-44453499 TTGTAGGTAGGTAGGTAGGTAGG + Intronic
1156469864 18:37370482-37370504 TTGTCAGGATGTAGGGAGGCTGG - Intronic
1157515943 18:48311476-48311498 TTGTCAGTAACTCGGTAAGAGGG + Intronic
1158067784 18:53433811-53433833 CTGTGAGTATGTAAGGAAGTAGG - Intronic
1159071777 18:63631481-63631503 TTTTCTGTATGGAGGAAAGTGGG - Intergenic
1165381722 19:35486390-35486412 TTTTCAGAAGGTAGGTAAGGGGG + Intergenic
1166626102 19:44357259-44357281 TGGTAAGTAGGTAGGTAGGTAGG - Intronic
1166647410 19:44542578-44542600 TTGTAAGTCTGCAGGTCAGTTGG - Intergenic
925505319 2:4556126-4556148 TTAACAGTATGTAGATATGTTGG + Intergenic
926087452 2:10029137-10029159 TTGTCAGTATGCTGGCAAGGGGG - Intergenic
926528699 2:14013839-14013861 TTGTCAGTATGAATTTAACTCGG - Intergenic
926613521 2:14971661-14971683 TTGTCAGTAAGTAGTCAAATTGG - Intergenic
928276330 2:29903520-29903542 TTTTATGTATGTATGTAAGTAGG + Intronic
932939561 2:76147178-76147200 TTGACAGTATGTAGAGTAGTTGG + Intergenic
935805380 2:106741702-106741724 TTATCAGTATGTAGATAATTGGG - Intergenic
939464257 2:142537298-142537320 TTGTCAGTATGTGGGTGGGTTGG + Intergenic
941390595 2:164908923-164908945 GTGTCTGTATGTAAGTAATTTGG - Intronic
941841618 2:170091376-170091398 ATTTCAGTATGTATGTATGTTGG + Intergenic
942261794 2:174172433-174172455 TTGTCAGGAGGTAGGAAGGTGGG - Intronic
945814987 2:214593775-214593797 TAGTCAGTGTGAAGGTAAGTAGG + Intergenic
947110481 2:226713662-226713684 TTTTCTGTATGCAGGTAAATTGG + Intergenic
1169105776 20:2993077-2993099 TTGTCTCTATGTAGGTAGGTAGG + Intronic
1169746615 20:8949755-8949777 AAGTCTGTATTTAGGTAAGTAGG - Intronic
1170858359 20:20078572-20078594 TTGTCAGTTTGTCAGTAAGTGGG + Intronic
1170970177 20:21108506-21108528 TTGTCAGAATGTAGCAAATTTGG + Intergenic
1178140378 21:29676218-29676240 TTGCCAGTATATAGGTAAACTGG + Intronic
1178967125 21:37131352-37131374 GTTTCATTATGTAGGTATGTAGG - Intronic
1181598390 22:23933725-23933747 TTGTCAGTCTGTAGGAGAATGGG - Intergenic
1181677063 22:24462168-24462190 CTGTCAGAATATAAGTAAGTTGG + Intergenic
1183561032 22:38573069-38573091 TATTCAGTTTGTGGGTAAGTGGG + Intergenic
1184189677 22:42886406-42886428 TGGTATGTATGTAGGTAGGTAGG + Intronic
1184973440 22:48043976-48043998 TTGTCAGTAGGTAGGTAGATAGG + Intergenic
949825580 3:8161792-8161814 TTGACAGTATGTAGATCAGAAGG + Intergenic
950332233 3:12165291-12165313 TTTTCAGTATTTATGTAAGTGGG + Intronic
955358958 3:58256218-58256240 TTGTGATTATGTATGTATGTAGG - Intronic
955504721 3:59620132-59620154 TTGCCAGTTTGGAGGTAAATGGG - Intergenic
957687295 3:83517765-83517787 TTGTCATTATGTCGGAAAATTGG - Intergenic
958491025 3:94773571-94773593 TTGTGTGTATTTAGGTAGGTTGG + Intergenic
959178360 3:102946786-102946808 TTATCAATATGTAAGTAAATAGG - Intergenic
960876323 3:122298680-122298702 AGGTCAGTATCTAGGTAGGTAGG + Intergenic
961616813 3:128188948-128188970 TTGTGAGTCTGTAGGGGAGTTGG + Intronic
963705329 3:148679903-148679925 GTTTCAGCATGTAGGTAATTTGG - Intergenic
965238640 3:166161807-166161829 TAGTCAGTGTGTTGGTTAGTAGG + Intergenic
966314425 3:178629857-178629879 TTGAAAGTATGGAGGTATGTAGG - Intronic
966375048 3:179288044-179288066 TTGTCAGTTCGTAGCTGAGTTGG + Intergenic
966431218 3:179832896-179832918 ATGTAAGTAGGTAGGTAGGTGGG - Intronic
967454414 3:189666847-189666869 TTGTGTGTATGTATGTAAATGGG + Intronic
970309341 4:14765927-14765949 GTGTCAGTGTGTAGGTCACTGGG + Intergenic
972144979 4:36012443-36012465 TTATCAATATGTATGTAAGTGGG + Intronic
973124300 4:46565312-46565334 CTGTCACCATGTAGGCAAGTGGG - Intergenic
974639088 4:64606555-64606577 TGGTCAGTGTGTTGGTTAGTAGG - Intergenic
974920667 4:68235318-68235340 TTGTTTGTCTGTAGGTAAGTAGG + Intronic
974920668 4:68235322-68235344 TTGTCTGTAGGTAAGTAGGTTGG + Intronic
976490946 4:85669526-85669548 ATGTTTGTATGTAGGTATGTAGG + Intronic
977246726 4:94640100-94640122 CTGTGACTATGTAGGTAAATGGG - Intronic
978431355 4:108636187-108636209 TTCTCTGTAAGTAGGTAAGAAGG - Intergenic
980246645 4:130254129-130254151 AGGTAAGTAGGTAGGTAAGTAGG + Intergenic
981080433 4:140634478-140634500 ATGTGAGTGTGTAGGTAAGGGGG - Intronic
982450496 4:155546732-155546754 TTGATAGTATGTTGGAAAGTAGG - Intergenic
986075375 5:4331257-4331279 CTCTCAGTATCTAGGTGAGTGGG - Intergenic
988808379 5:34761585-34761607 GAGACAGGATGTAGGTAAGTGGG - Intronic
991244728 5:64498187-64498209 TGGCCAGTATGTAGGGAAATGGG + Intergenic
992368275 5:76115682-76115704 TTGCCAATATCTAGGTAAATAGG + Intronic
993785651 5:92132003-92132025 GTGTCAGTGTGTAGGGATGTGGG + Intergenic
997539545 5:134649954-134649976 TTGTAAGTAAATTGGTAAGTAGG - Intronic
998003568 5:138642766-138642788 CTGTCAGTCTGCAGGTGAGTGGG - Intronic
1000202572 5:159026238-159026260 TAGTCAGTATTTTGGTGAGTAGG + Intronic
1001249223 5:170133400-170133422 TTGTCTGTGTGAAGGTGAGTAGG + Intergenic
1001404280 5:171464667-171464689 TGGTCAGCAGGTAGGTAGGTAGG - Intergenic
1004046288 6:12027034-12027056 TGGTCAGTATGTAAATAAATGGG - Intronic
1006243327 6:32706644-32706666 TAGTCAGTGTGTTGGTTAGTAGG + Intergenic
1009816246 6:68739441-68739463 TTGTCTTTAGGTAGGTAAGAGGG + Intronic
1012188394 6:96250247-96250269 TTGTCAGTATGTCAGAAAGAAGG + Intergenic
1013995147 6:116299606-116299628 ATGTATGTATGTAGGTAGGTAGG + Intronic
1016152900 6:140766148-140766170 TGTTCAGTATGTAGGCAAATGGG - Intergenic
1018621714 6:165735272-165735294 AGGTCAGTTGGTAGGTAAGTAGG + Intronic
1018943221 6:168324775-168324797 ATTTCAGTATGTAAGTACGTCGG + Intergenic
1022762247 7:33366867-33366889 TTGTCTGTAAATTGGTAAGTTGG + Intronic
1025865806 7:65379545-65379567 TAGTGAGTATGTTTGTAAGTGGG - Intronic
1026197690 7:68187121-68187143 GTGTACGTATGTAGGTCAGTGGG + Intergenic
1028727063 7:94100209-94100231 ATGTGAGTATGTAGGAAAATGGG + Intergenic
1035531007 8:350832-350854 AGGTAAGTAGGTAGGTAAGTAGG + Intergenic
1036542752 8:9734803-9734825 TAGTAAGTAGGTAGGTAGGTAGG - Intronic
1037622017 8:20572294-20572316 TTGCCAGTATGTAGTTTATTTGG - Intergenic
1037874367 8:22533158-22533180 TTTTCTGTATGGAGGGAAGTAGG - Intronic
1038022914 8:23564936-23564958 TTCTAAGTAGGTAGGTACGTAGG - Intronic
1039899248 8:41739651-41739673 TTGTCAGCATGGAGGTGAGAAGG + Intronic
1042760479 8:72266934-72266956 TTGTCACTTTGTAGGTACTTAGG + Intergenic
1044643135 8:94406549-94406571 TTATTTGTATTTAGGTAAGTCGG + Intronic
1046140762 8:110087679-110087701 TTCTCAGTAAGTCAGTAAGTTGG + Intergenic
1047029303 8:120859692-120859714 ATGTCACTATGAAGGGAAGTTGG + Intergenic
1048410505 8:134167895-134167917 TTGTGAGTTTCTGGGTAAGTAGG - Intergenic
1048880713 8:138870212-138870234 TTGTATGTATGTAGGTGGGTGGG + Intronic
1052544930 9:29864318-29864340 TTGTCAGAATATAGGTAAAATGG + Intergenic
1056019614 9:82427865-82427887 TAGTCAGTGTGTTGGTTAGTAGG + Intergenic
1057072220 9:92109150-92109172 TAGTCAGTGTGTTGGTTAGTAGG - Intronic
1059113269 9:111577318-111577340 TGGTGAGTATGTAGAGAAGTTGG + Intronic
1060062664 9:120475124-120475146 ATCTAAGTAGGTAGGTAAGTAGG + Intronic
1186952127 X:14638123-14638145 TTGTTAGCATGTAGGTAAAAGGG + Intronic
1187072985 X:15907105-15907127 TTGTCAGTATTAAGAGAAGTCGG - Intergenic
1188010296 X:25048053-25048075 TTCTCAGTAATCAGGTAAGTAGG + Intergenic
1189395854 X:40622251-40622273 TTTTCAGAATGTCTGTAAGTTGG - Intergenic
1189443054 X:41054770-41054792 TAGTCATTTTGTAGGTAATTTGG - Intergenic
1191944941 X:66523186-66523208 TTGCCAATATGAAGGAAAGTTGG + Intergenic
1193075848 X:77354829-77354851 TTGGCAGAATGCAGATAAGTGGG - Intergenic
1193720808 X:84985138-84985160 TTTTCAGTGTGTAAGTCAGTAGG - Intergenic
1196830093 X:119768979-119769001 TTGTCAGAATGAAGGGAAGGAGG - Intergenic
1197290296 X:124648142-124648164 TTGTCAGAATGTAGATGACTGGG - Intronic
1198389462 X:136159716-136159738 TAGTCAGTAGATAGGTCAGTGGG + Intronic
1201478615 Y:14412314-14412336 TTGTCAATATGTAAGCAAATGGG - Intergenic
1202108508 Y:21396249-21396271 TTGAGAGTATGTAGATAAATTGG + Intergenic