ID: 1107003929

View in Genome Browser
Species Human (GRCh38)
Location 13:35585270-35585292
Sequence CAGGCTAAAGACTGAATGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 182
Summary {0: 1, 1: 0, 2: 2, 3: 10, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107003929_1107003938 23 Left 1107003929 13:35585270-35585292 CCTCCCATTCAGTCTTTAGCCTG 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1107003938 13:35585316-35585338 CACTTTACTGAACTGTTTTGGGG 0: 1
1: 0
2: 3
3: 21
4: 270
1107003929_1107003939 26 Left 1107003929 13:35585270-35585292 CCTCCCATTCAGTCTTTAGCCTG 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1107003939 13:35585319-35585341 TTTACTGAACTGTTTTGGGGAGG 0: 1
1: 0
2: 2
3: 25
4: 218
1107003929_1107003936 21 Left 1107003929 13:35585270-35585292 CCTCCCATTCAGTCTTTAGCCTG 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1107003936 13:35585314-35585336 ATCACTTTACTGAACTGTTTTGG 0: 1
1: 0
2: 0
3: 26
4: 224
1107003929_1107003937 22 Left 1107003929 13:35585270-35585292 CCTCCCATTCAGTCTTTAGCCTG 0: 1
1: 0
2: 2
3: 10
4: 169
Right 1107003937 13:35585315-35585337 TCACTTTACTGAACTGTTTTGGG 0: 1
1: 0
2: 3
3: 21
4: 257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107003929 Original CRISPR CAGGCTAAAGACTGAATGGG AGG (reversed) Intronic
901048167 1:6411469-6411491 CAGGCCAAAGAGTTAATGTGGGG - Intergenic
904819616 1:33233327-33233349 CAGGCTAAAGCCAGAATGGGTGG - Intergenic
906144560 1:43552205-43552227 AAGGCCAAAGAATGACTGGGAGG - Intronic
906724699 1:48035797-48035819 GAGGCTGGAGACTCAATGGGAGG - Intergenic
906724738 1:48036011-48036033 GAGGCTGGAGACTCAATGGGAGG - Intergenic
906724751 1:48036073-48036095 CAGGCTGGACACTCAATGGGAGG - Intergenic
908806741 1:67939754-67939776 CAGGCTAAAGACTGGAAACGTGG - Intergenic
910875756 1:91876137-91876159 CAGGCAGAAGAGTAAATGGGAGG + Intronic
910903884 1:92152605-92152627 CAGGCTAAAGATAGATTGGGAGG + Intergenic
911484066 1:98483362-98483384 CTGGAGAAAGACTGAATGGTGGG + Intergenic
911819931 1:102405150-102405172 CAGGCAACATACAGAATGGGGGG - Intergenic
912878499 1:113386676-113386698 ATGGCTAAAGACTGAAAGGAGGG - Intergenic
913006965 1:114643102-114643124 CAGGGATAAGACTGAAGGGGAGG + Intronic
915506452 1:156359964-156359986 TGGGCTCAAGACAGAATGGGAGG - Intronic
916061236 1:161099805-161099827 CAGACTAATGGCTGAAGGGGGGG + Intronic
916677916 1:167079710-167079732 GAGGATATTGACTGAATGGGTGG - Intronic
921912531 1:220565646-220565668 CAGGCTAAAGACTCTGTAGGAGG + Intronic
1063373125 10:5534483-5534505 CAGGTTACACACTGAATGGAGGG + Intergenic
1064594519 10:16930014-16930036 CAGTATGAAGACTGAAGGGGTGG - Intronic
1066019374 10:31282588-31282610 AAGGGTAATGGCTGAATGGGAGG + Intergenic
1066065931 10:31760720-31760742 ACGGCTAAGCACTGAATGGGAGG + Intergenic
1071888412 10:89976101-89976123 CTGGAGAAAGAATGAATGGGAGG + Intergenic
1072490739 10:95903834-95903856 CAGGCTAAAGAGAGATTTGGAGG + Intronic
1073489554 10:103843945-103843967 CAGGTTAGAGAATGTATGGGTGG - Intronic
1074972040 10:118547067-118547089 GAGGAGAAAGACTGACTGGGTGG - Intergenic
1075283365 10:121160743-121160765 CAGGCTAAAGACTGAGTCCATGG - Intergenic
1076196879 10:128524972-128524994 CTGGCTAAGGACTGAAGTGGGGG + Intergenic
1078806215 11:14707704-14707726 AAGTCTAAAGAATTAATGGGAGG - Intronic
1079388198 11:19999229-19999251 CTGGCTGAGGACTGAGTGGGTGG - Intronic
1079451000 11:20599642-20599664 CAGGCAACAGACTGAACTGGTGG - Exonic
1079980836 11:27149986-27150008 CAGGCAGAAGCCTGAATGAGAGG - Intergenic
1081029480 11:38060406-38060428 CAAGCTCAAGTCAGAATGGGAGG + Intergenic
1081330653 11:41795939-41795961 CACACTAAAGACTGAGTTGGTGG - Intergenic
1082191776 11:49253908-49253930 GAGGAAAAAGACTGAATGGAGGG - Intergenic
1084941279 11:72614743-72614765 GAGGCTAAGGACTGGAGGGGAGG + Intronic
1086046991 11:82544766-82544788 CAAGCTAAATACTCAATGGTAGG + Intergenic
1086674346 11:89587108-89587130 GAGGAAAAAGACTGAATGGAGGG + Intergenic
1089938312 11:122388679-122388701 CAGGCTAAGGAGTAAATGAGAGG + Intergenic
1091103107 11:132894104-132894126 TAGACTGAGGACTGAATGGGAGG - Intronic
1092095193 12:5836473-5836495 CAGTGTAGAGACTGAATTGGAGG - Intronic
1092425860 12:8375269-8375291 CAGGTGAATGAATGAATGGGTGG + Intergenic
1093536123 12:20225651-20225673 CAGGCTGAAGACTTAATCGTTGG - Intergenic
1094555535 12:31495772-31495794 AAGGCTAAAGAGTAAATGAGGGG + Intronic
1097172350 12:57123916-57123938 CAGGCTAAATGTTGAATGAGAGG - Intronic
1102389246 12:112536348-112536370 CAGGCTAGAGAATGACTTGGTGG + Intergenic
1104740421 12:131168067-131168089 CAGGTTAAAGAGTGAATGTCAGG - Intergenic
1106477674 13:30112334-30112356 CAGACTAAAGACAGTATGGACGG + Intergenic
1107003929 13:35585270-35585292 CAGGCTAAAGACTGAATGGGAGG - Intronic
1108481786 13:50879968-50879990 CTGGCTACAGGCAGAATGGGTGG + Intergenic
1112059798 13:95727025-95727047 CAGGCTGAAGACTGGGTGGTGGG + Intronic
1113613746 13:111666063-111666085 CAGGCTAAAGCCTGAACTTGGGG + Intronic
1114400022 14:22401653-22401675 CAGGATAAAGAAAGGATGGGAGG - Intergenic
1116476850 14:45350119-45350141 CAGGCTACCTACAGAATGGGAGG - Intergenic
1119368588 14:74118011-74118033 CACGTTTAAGACTGAATGGTTGG + Intronic
1127685244 15:61337302-61337324 CAGCCAGAAGAATGAATGGGAGG - Intergenic
1129924835 15:79354840-79354862 CAAGCTAAAAACGGAATGGGGGG - Intronic
1133721939 16:8502765-8502787 CAGGCTGAAGGCTGCATGGTCGG - Intergenic
1134801002 16:17084657-17084679 CAGATGAAAGAATGAATGGGTGG - Intergenic
1136230710 16:28883720-28883742 CAGGCTGGAGAGTGAATGGGTGG - Intronic
1136622093 16:31436156-31436178 GAGGCTGGAGACTGAGTGGGGGG + Exonic
1138202255 16:55098641-55098663 CAGGATTAAGAGTGAATAGGAGG - Intergenic
1139179007 16:64723703-64723725 CTGGCATTAGACTGAATGGGAGG + Intergenic
1139301261 16:65947256-65947278 CTGGCTAAAGAATGAGTGGATGG + Intergenic
1140023190 16:71259379-71259401 AAGGCCAAAGACAGAATGTGAGG + Intergenic
1144422895 17:15114217-15114239 CAGGCTAAAGACTCAAATGAGGG - Intergenic
1146445162 17:32927655-32927677 CAGGGTAAAGAGTGAATCGAGGG - Intergenic
1153543851 18:6185909-6185931 CAGCCAGAAGACTGAATAGGTGG + Intronic
1153825867 18:8874487-8874509 CAAACTAAAGACAGAATGAGGGG - Intergenic
1158185344 18:54765192-54765214 CAAAATAAAGACTGAATTGGGGG - Intronic
1159415200 18:68138093-68138115 CAGGCAACAAACAGAATGGGAGG - Intergenic
1162062711 19:8106702-8106724 CAGGCAAATGAGTGAATGGGTGG + Intronic
1164465230 19:28482169-28482191 CAGGCTAAGGACTGAAAGACGGG + Intergenic
1166590234 19:43991391-43991413 CAGGATATAGACAGAATGAGTGG + Intronic
1166592099 19:44008660-44008682 CAGGATACAGACAGAATGAGTGG + Intronic
1167116698 19:47492796-47492818 CAGGCTGAAGACAGGGTGGGGGG + Intronic
1167719923 19:51172271-51172293 CAGGCTGGAGGCTGAATTGGTGG + Intergenic
926065077 2:9832118-9832140 CAGGTTTAAGGCAGAATGGGAGG - Intergenic
927195382 2:20542956-20542978 CAGCCTATAGCCTGGATGGGTGG - Intergenic
928398721 2:30962904-30962926 CAGGATAGAGAGTGAAAGGGAGG + Intronic
930361556 2:50386780-50386802 CAGGAGAAATACTGAATTGGTGG + Intronic
939201012 2:139034053-139034075 CTTGCTAAAGGCTGAATGGGAGG - Intergenic
939433715 2:142145751-142145773 CAGGGTCAAGACTGAAAGGCTGG - Intergenic
939959744 2:148556063-148556085 CAGGCAAAAGGCTGAGTGAGGGG - Intergenic
942124099 2:172805707-172805729 CAGGCAAGAGACTGAAGGTGGGG - Intronic
945874230 2:215261187-215261209 AAAGCTAATGACAGAATGGGTGG + Intergenic
948226827 2:236317954-236317976 CAGGATGGAGACTGAATGAGGGG - Intergenic
1170654645 20:18274991-18275013 CTGGCTAAAGACTGAATTCCAGG - Intergenic
1172470194 20:35187682-35187704 CAGGGTGAAGAGTGAATGGAAGG + Intergenic
1172578275 20:36026388-36026410 CAGGCAGGAGACTGAAGGGGAGG - Intronic
1172924812 20:38523437-38523459 GAGCCATAAGACTGAATGGGTGG + Intronic
1176974317 21:15301659-15301681 CAGGCTAGAAAGTGAATGAGCGG + Intergenic
1182040054 22:27231259-27231281 CAGGCTAGAGAATGGATTGGAGG + Intergenic
1183593703 22:38796909-38796931 TGGGCTGAAGAGTGAATGGGAGG - Intergenic
949097746 3:106205-106227 CATGATAAAGACTCACTGGGTGG - Intergenic
949735086 3:7162551-7162573 TAGGCTTAAGAAAGAATGGGAGG + Intronic
949758248 3:7438691-7438713 CAGGCAGAAGACTGAAGGGCAGG - Intronic
950267118 3:11582375-11582397 CAGGCACAAAACTGGATGGGCGG + Intronic
950698992 3:14727119-14727141 CAGACTGAAGATGGAATGGGCGG - Intronic
955271718 3:57506159-57506181 CATGGTAAAGACTGAAGGGAGGG + Intronic
955545975 3:60030689-60030711 CTTGCTAAACACTGAATTGGTGG + Intronic
955634165 3:61007885-61007907 ATAGCTAAAGACTGAATGGTGGG + Intronic
956501435 3:69890287-69890309 CATGCTCAAGTCTGAATGGAAGG - Intronic
961011594 3:123440114-123440136 CAAGCAAATGAATGAATGGGTGG - Intronic
965503034 3:169479010-169479032 CAGGCATAGAACTGAATGGGAGG + Intronic
965978265 3:174652895-174652917 TAGGCAAAAGACTTAATAGGTGG + Intronic
969674885 4:8608982-8609004 CAAGTGAAAGAGTGAATGGGTGG - Intronic
972277128 4:37567843-37567865 CAGGCTAATTACTAGATGGGGGG + Intronic
973248050 4:48031359-48031381 CACCCTAAAAACTGAAGGGGTGG - Intronic
974840279 4:67291397-67291419 CAGGTTAGAGAGGGAATGGGAGG + Intergenic
975515503 4:75243207-75243229 GAGGGTAAGGACTGAGTGGGAGG + Intergenic
976093261 4:81479153-81479175 CAGGCAACATACAGAATGGGAGG + Intronic
976609178 4:87011808-87011830 CATGATAAAGACTGAAGGAGCGG + Intronic
979012764 4:115392381-115392403 CAGGCAACATACAGAATGGGGGG + Intergenic
981260193 4:142709568-142709590 CAGGAGAAAGAGTGAAGGGGAGG - Intronic
981686853 4:147464439-147464461 GAGGCTCAGGAATGAATGGGTGG - Intergenic
982292051 4:153790544-153790566 CCGGGTAATGAATGAATGGGTGG + Intergenic
983879535 4:172917456-172917478 CAGGCAACATACAGAATGGGAGG + Intronic
985013009 4:185603600-185603622 CATTCAAAAGACTGAATGTGAGG + Intronic
985789308 5:1916645-1916667 CAGGCCAGAGACAGAAGGGGCGG + Intergenic
987047877 5:14124463-14124485 CAGGCTAGAGAGAGAATGGGAGG + Intergenic
989359061 5:40578818-40578840 CATGCTAAGGAATGAATGGGAGG + Intergenic
990556667 5:56943187-56943209 CAAGCTAAAGACTGAACGGGAGG + Intronic
993865437 5:93189042-93189064 TAGGTTAGAGATTGAATGGGAGG + Intergenic
995018606 5:107341902-107341924 CAGGGGAGAGACAGAATGGGGGG - Intergenic
995819176 5:116207865-116207887 CAGCCAAAAGAAAGAATGGGAGG - Intronic
998364332 5:141618983-141619005 CTGGCTAAAGAGCGACTGGGCGG - Exonic
998679785 5:144454213-144454235 ACAGCTAAAGACTGATTGGGTGG - Intronic
999151651 5:149430353-149430375 CAGGCTAGGAACTGAATGGTTGG + Intergenic
1000687762 5:164273549-164273571 CATAATAATGACTGAATGGGTGG + Intergenic
1001051957 5:168420840-168420862 GAGGCTGAAGACTGAAGGCGGGG - Intronic
1002904730 6:1438987-1439009 CAGGGTAAAGGCTGGGTGGGGGG - Intergenic
1005135002 6:22557777-22557799 CTGGAGAAAGGCTGAATGGGTGG + Intergenic
1005687039 6:28263255-28263277 CGGGCTAGAGACAGAATTGGGGG + Intergenic
1008684966 6:53915171-53915193 CAGTCTAAAGAGTGTTTGGGAGG + Intronic
1009932955 6:70197758-70197780 CAGACTGAAGGATGAATGGGAGG - Intronic
1011302023 6:85885736-85885758 GAGGTTAGAGACTGAATTGGGGG + Intergenic
1012861380 6:104563985-104564007 AATGCTAAAGCCTTAATGGGGGG + Intergenic
1013072785 6:106744056-106744078 AAGGCTAAAGGCAGATTGGGGGG - Intergenic
1014905403 6:127020444-127020466 GAGGCTCCAGACTCAATGGGAGG - Intergenic
1015372134 6:132466095-132466117 TAGGCTCAAGAGAGAATGGGAGG - Intronic
1016100914 6:140099031-140099053 GATGCAAAAGCCTGAATGGGAGG + Intergenic
1017697759 6:157035627-157035649 TAGGCTAAAGACTGAAATGTTGG - Intronic
1019312026 7:367573-367595 CAGGCTGCAGTCTGGATGGGTGG - Intergenic
1023548652 7:41345230-41345252 CAGGAAAAAGACTGAAAGGTTGG + Intergenic
1026853203 7:73737515-73737537 CAGGGTATATACTGAATGGGAGG + Intronic
1027488976 7:78798624-78798646 CAGGATGAATACTGAATGAGAGG + Intronic
1032325090 7:130920450-130920472 CTGGATAAAGACAGAATGGATGG - Intergenic
1032906615 7:136374779-136374801 TGGGCTGAAGAATGAATGGGTGG + Intergenic
1033454659 7:141491928-141491950 CTGGGCACAGACTGAATGGGAGG - Intergenic
1035292131 7:157845878-157845900 CAGATTAAAGCCTAAATGGGGGG + Intronic
1035758404 8:2051254-2051276 CAGAGTAAAGACAGAATGGGAGG + Intronic
1037551242 8:19973954-19973976 CAGGCTTAAAACTCAAAGGGGGG - Intergenic
1038333682 8:26629559-26629581 CGTGCTAAAGGCTGAAAGGGTGG + Intronic
1038468049 8:27784664-27784686 CAAGCTAAAGACTGCAATGGAGG + Intronic
1038594754 8:28878278-28878300 GAGGATAAAGACTGAAAGAGTGG + Intronic
1041755908 8:61313092-61313114 AAGAATGAAGACTGAATGGGAGG - Intronic
1042103410 8:65298127-65298149 CAGGCCAGGGACTGAAGGGGAGG + Intergenic
1043382419 8:79717472-79717494 TAGGCTAAAGACTGAAGTGTTGG - Intergenic
1044740617 8:95322740-95322762 CAGTCTAAAGATTTATTGGGAGG + Intergenic
1045973862 8:108109349-108109371 CAGGCAACCGACAGAATGGGAGG + Intergenic
1046061882 8:109150121-109150143 CAGACTAAAGAATGAATTAGAGG + Intergenic
1047924034 8:129665307-129665329 CAGGATAGAGACAGAATGAGAGG + Intergenic
1048786959 8:138060839-138060861 CAGACAAAAGGCTGAATGTGGGG + Intergenic
1050321120 9:4453388-4453410 CAGGCTACCTACAGAATGGGAGG + Intergenic
1054860186 9:69943887-69943909 AAGGCTGAAGAGGGAATGGGTGG + Intergenic
1057227917 9:93302188-93302210 CAGGGGAAAGACTGCAGGGGTGG + Intronic
1058807036 9:108602711-108602733 CAGGGGAAAGACTGAAGGCGAGG + Intergenic
1059368635 9:113807213-113807235 CAGGCTAAAGGCTGAAAGAGTGG - Intergenic
1059491420 9:114670665-114670687 CTGGCTAAAGATTTAAAGGGGGG + Intergenic
1185662486 X:1738348-1738370 CAGGCTACAGAGGGAATGGATGG + Intergenic
1186629546 X:11334349-11334371 AAGGCTAAAGCCTGAACAGGTGG - Intronic
1189676576 X:43467122-43467144 CAGGCAAAACACAGAATGGTTGG - Intergenic
1189722199 X:43931682-43931704 CAGGCTACATACACAATGGGTGG + Intergenic
1189957099 X:46287128-46287150 CAGGCTACAGAAAGAATAGGTGG + Intergenic
1192765644 X:74137322-74137344 GAGGCTAAAGAGTCTATGGGTGG - Intergenic
1193365432 X:80626563-80626585 CAGGCTGAAGAATGACTGGAAGG - Intergenic
1193709684 X:84863697-84863719 CAGGCTTCAGAGAGAATGGGTGG + Intergenic
1195444270 X:104933316-104933338 CAGGATTTAGACTGCATGGGGGG - Intronic
1197695108 X:129541025-129541047 CAGTGGAAGGACTGAATGGGCGG + Intronic
1198963284 X:142204482-142204504 CAGGCTAAAGACTGCAAGTAGGG + Intronic
1200689104 Y:6288542-6288564 TAGGCAAAAGACTGAATATGAGG - Intergenic
1201046169 Y:9886180-9886202 TAGGCAAAAGACTGAATATGAGG + Intergenic