ID: 1107014811

View in Genome Browser
Species Human (GRCh38)
Location 13:35699648-35699670
Sequence GTGTTGTCATTAAGGAAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107014811_1107014816 19 Left 1107014811 13:35699648-35699670 CCCTTTTTCCTTAATGACAACAC No data
Right 1107014816 13:35699690-35699712 GCTGTAAACGTGAAGCTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107014811 Original CRISPR GTGTTGTCATTAAGGAAAAA GGG (reversed) Intergenic
No off target data available for this crispr