ID: 1107018243

View in Genome Browser
Species Human (GRCh38)
Location 13:35726058-35726080
Sequence AACTGATACAAGGCTTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107018240_1107018243 14 Left 1107018240 13:35726021-35726043 CCAAGACCAATATTATCTTATAT No data
Right 1107018243 13:35726058-35726080 AACTGATACAAGGCTTTTGCAGG No data
1107018239_1107018243 22 Left 1107018239 13:35726013-35726035 CCTTGGTGCCAAGACCAATATTA No data
Right 1107018243 13:35726058-35726080 AACTGATACAAGGCTTTTGCAGG No data
1107018241_1107018243 8 Left 1107018241 13:35726027-35726049 CCAATATTATCTTATATTAAAAA No data
Right 1107018243 13:35726058-35726080 AACTGATACAAGGCTTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107018243 Original CRISPR AACTGATACAAGGCTTTTGC AGG Intergenic
No off target data available for this crispr