ID: 1107020078

View in Genome Browser
Species Human (GRCh38)
Location 13:35742256-35742278
Sequence GGTTAAGGCTGAGACCTACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107020078_1107020081 -4 Left 1107020078 13:35742256-35742278 CCCAGTAGGTCTCAGCCTTAACC No data
Right 1107020081 13:35742275-35742297 AACCCAGCCCCTATTCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107020078 Original CRISPR GGTTAAGGCTGAGACCTACT GGG (reversed) Intergenic
No off target data available for this crispr