ID: 1107020081

View in Genome Browser
Species Human (GRCh38)
Location 13:35742275-35742297
Sequence AACCCAGCCCCTATTCAAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107020076_1107020081 12 Left 1107020076 13:35742240-35742262 CCATATGGGAATGCAGCCCAGTA No data
Right 1107020081 13:35742275-35742297 AACCCAGCCCCTATTCAAGATGG No data
1107020079_1107020081 -5 Left 1107020079 13:35742257-35742279 CCAGTAGGTCTCAGCCTTAACCC No data
Right 1107020081 13:35742275-35742297 AACCCAGCCCCTATTCAAGATGG No data
1107020075_1107020081 17 Left 1107020075 13:35742235-35742257 CCTAACCATATGGGAATGCAGCC No data
Right 1107020081 13:35742275-35742297 AACCCAGCCCCTATTCAAGATGG No data
1107020078_1107020081 -4 Left 1107020078 13:35742256-35742278 CCCAGTAGGTCTCAGCCTTAACC No data
Right 1107020081 13:35742275-35742297 AACCCAGCCCCTATTCAAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107020081 Original CRISPR AACCCAGCCCCTATTCAAGA TGG Intergenic
No off target data available for this crispr