ID: 1107021776

View in Genome Browser
Species Human (GRCh38)
Location 13:35759610-35759632
Sequence GTAGAGAAGGAGGCTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107021776_1107021781 -2 Left 1107021776 13:35759610-35759632 CCTTCCTCAGCCTCCTTCTCTAC No data
Right 1107021781 13:35759631-35759653 ACTCACGTTCATGTCTCCTTGGG No data
1107021776_1107021780 -3 Left 1107021776 13:35759610-35759632 CCTTCCTCAGCCTCCTTCTCTAC No data
Right 1107021780 13:35759630-35759652 TACTCACGTTCATGTCTCCTTGG No data
1107021776_1107021782 4 Left 1107021776 13:35759610-35759632 CCTTCCTCAGCCTCCTTCTCTAC No data
Right 1107021782 13:35759637-35759659 GTTCATGTCTCCTTGGGTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107021776 Original CRISPR GTAGAGAAGGAGGCTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr