ID: 1107023780

View in Genome Browser
Species Human (GRCh38)
Location 13:35778684-35778706
Sequence CTTCACATGGTTCCCAGGAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 138}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107023780_1107023792 16 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023792 13:35778723-35778745 ACACAGGGAGGCAGGGTTGGAGG 0: 1
1: 1
2: 3
3: 71
4: 901
1107023780_1107023789 9 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023789 13:35778716-35778738 AAAGCCAACACAGGGAGGCAGGG 0: 1
1: 0
2: 5
3: 34
4: 380
1107023780_1107023784 0 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023784 13:35778707-35778729 TCCAACACTAAAGCCAACACAGG 0: 1
1: 0
2: 1
3: 12
4: 132
1107023780_1107023786 1 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023786 13:35778708-35778730 CCAACACTAAAGCCAACACAGGG 0: 1
1: 0
2: 0
3: 19
4: 165
1107023780_1107023791 13 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023791 13:35778720-35778742 CCAACACAGGGAGGCAGGGTTGG 0: 1
1: 2
2: 2
3: 40
4: 517
1107023780_1107023788 8 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023788 13:35778715-35778737 TAAAGCCAACACAGGGAGGCAGG 0: 1
1: 0
2: 3
3: 41
4: 323
1107023780_1107023787 4 Left 1107023780 13:35778684-35778706 CCCATCCTGGGAACCATGTGAAG 0: 1
1: 0
2: 1
3: 9
4: 138
Right 1107023787 13:35778711-35778733 ACACTAAAGCCAACACAGGGAGG 0: 1
1: 0
2: 1
3: 10
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107023780 Original CRISPR CTTCACATGGTTCCCAGGAT GGG (reversed) Intronic
900556870 1:3285034-3285056 CTTCACCTGGTGCCCTGGACGGG + Intronic
900768613 1:4522257-4522279 AAACACATGGTTCCAAGGATTGG + Intergenic
900919281 1:5660647-5660669 CCTCACATGGGTTCCAGCATGGG - Intergenic
901770922 1:11530022-11530044 CTGGACATGGTTCCCTGGACAGG - Intronic
901864370 1:12094487-12094509 CTTCTCATGGCTCCCAGGATGGG - Intronic
901875527 1:12165157-12165179 CTTGAATTCGTTCCCAGGATGGG + Intergenic
902827265 1:18985176-18985198 CTGCACATGGCTCCAAGGGTGGG - Intergenic
903466794 1:23557488-23557510 CTTCACCTGGTGCCCAGGCATGG - Intergenic
904697440 1:32338175-32338197 CTTCCCAAGGATCCCAGGAGGGG + Intergenic
908204338 1:61829997-61830019 CTTCATATTGTTCCCATGTTAGG + Intronic
908778097 1:67661080-67661102 CTCCACATGGAACCCTGGATTGG - Intergenic
909388933 1:75095363-75095385 TTCCACATGGTACCCAAGATTGG - Intergenic
909962119 1:81859602-81859624 CTTGCCATGTTTCCCAGGCTAGG + Intronic
913052589 1:115130502-115130524 CTCCACATAGTGCCCAGGCTGGG + Intergenic
914676604 1:149911140-149911162 TTTCCCATGGTCCCAAGGATGGG - Intronic
914946666 1:152072971-152072993 CTTAAAATGGTGCCTAGGATGGG + Intergenic
916930298 1:169571314-169571336 CTAAACATGGTTCCTGGGATCGG - Intronic
917441544 1:175073281-175073303 CTCCACTTGATCCCCAGGATAGG - Intronic
917547451 1:175985567-175985589 CTTCACAGGGTTGCAGGGATTGG - Intronic
917966015 1:180179015-180179037 CTTCCCATGGCTCCCAGCAGGGG - Intronic
917968213 1:180191734-180191756 CTCCACATGGGTCCCAGCACCGG - Intronic
920083098 1:203391030-203391052 CTCAACATGTTGCCCAGGATAGG + Intergenic
1064874461 10:19977350-19977372 TTTCACAAGATCCCCAGGATAGG + Intronic
1067218924 10:44327590-44327612 CTTCCCATGGTTTGCAGGATGGG - Intergenic
1068068760 10:52168865-52168887 CATTATATGGTTCCCAGGTTTGG + Intronic
1068169665 10:53377420-53377442 CCTCATATGGTGGCCAGGATGGG - Intergenic
1071741833 10:88367669-88367691 CTCCACATTGTTGCCAGAATTGG + Intronic
1073155449 10:101342862-101342884 CTACATATGTTTCCCAGGTTGGG - Intergenic
1074698595 10:116073277-116073299 CTTCACAGGGTGCCCTGGCTGGG + Intronic
1090079796 11:123604387-123604409 CTTCCCGTGGCTGCCAGGATAGG - Intronic
1090254046 11:125270777-125270799 CATTTCATGTTTCCCAGGATAGG + Intronic
1091813396 12:3418452-3418474 CTCCACATGGGTGACAGGATGGG + Intronic
1093764099 12:22942750-22942772 TTTCCCATGGGTCCCTGGATGGG + Intergenic
1094480241 12:30875730-30875752 CTTCACAGGGTGCTTAGGATGGG - Intergenic
1094531000 12:31274740-31274762 CAGCACATGAATCCCAGGATTGG - Intergenic
1095350707 12:41208283-41208305 CTTCAAATTATTCCCAGAATTGG - Intronic
1095535322 12:43239242-43239264 TTCCATATGGTTCCCAGGTTGGG + Intergenic
1095796533 12:46225345-46225367 ATTCAGATTGTTGCCAGGATAGG - Intronic
1096515494 12:52153061-52153083 CTGCCCATGGCTCCCAGGCTAGG + Intergenic
1096599966 12:52722207-52722229 CCTCAGGAGGTTCCCAGGATGGG + Intergenic
1101163644 12:102005804-102005826 CTTCACATGGTCTCCAGGTAAGG - Intronic
1103230289 12:119324595-119324617 CCTCACAAGAATCCCAGGATAGG + Intergenic
1107023780 13:35778684-35778706 CTTCACATGGTTCCCAGGATGGG - Intronic
1107923743 13:45237883-45237905 TTTGATATGGTTCCCAGGAGTGG - Intronic
1109181011 13:59213946-59213968 TTTCACATGTTGCCCAGGCTGGG + Intergenic
1111209072 13:85052007-85052029 CTTCAGATGGTTTCCCAGATGGG + Intergenic
1111319902 13:86613660-86613682 ATTCACATGGCTCCCAGGAAAGG - Intergenic
1113912913 13:113852751-113852773 GCACACAGGGTTCCCAGGATGGG + Intronic
1114897635 14:27011141-27011163 CTTCAAATAATTCCCAGCATTGG - Intergenic
1114911284 14:27201163-27201185 TTTCAAATATTTCCCAGGATGGG - Intergenic
1119374086 14:74174807-74174829 CTTGACATGTTGCCCAGGCTAGG - Intronic
1119777334 14:77257240-77257262 CATCACAGGGTTCCCTGCATGGG + Exonic
1120471081 14:84925334-84925356 TTGCACTTGGTTCCCAAGATAGG - Intergenic
1121238311 14:92409628-92409650 CCTAACATGCTCCCCAGGATAGG + Intronic
1123083721 14:105707852-105707874 CTTCCCATGGTTCCATGGCTCGG + Intergenic
1124972663 15:34504490-34504512 CCTCTCCTTGTTCCCAGGATAGG + Intergenic
1125359517 15:38850333-38850355 CTTCTCTTCCTTCCCAGGATGGG - Intergenic
1125642394 15:41242200-41242222 CTTCACTGAGTTCCCAGGAAGGG - Intronic
1126431359 15:48588794-48588816 CTTCACCAGTTTCCCAGGAAGGG - Intronic
1126432518 15:48601391-48601413 CTACACATGGAGGCCAGGATTGG + Intronic
1126582623 15:50255189-50255211 CTTTAACTGCTTCCCAGGATGGG + Intronic
1128180696 15:65601266-65601288 CTTCCCATGCATCCCAGGAGAGG + Intronic
1130957124 15:88635364-88635386 CTTCATATGGGTCCCATGGTGGG + Intergenic
1132187740 15:99817172-99817194 CCTCTCCTTGTTCCCAGGATAGG - Intergenic
1133675159 16:8064262-8064284 TTTCTGATGGTTCTCAGGATGGG + Intergenic
1138738067 16:59275588-59275610 TTTCACGTGGTCCCCAGCATAGG - Intergenic
1139525391 16:67512644-67512666 CTTCCTATGTTTCCCAGGCTGGG - Intergenic
1141777954 16:86136785-86136807 CTGGACATGGTTGCCTGGATGGG - Intergenic
1142330682 16:89450907-89450929 CTTCCCATGGAAACCAGGATTGG - Intronic
1147215458 17:38896497-38896519 CATCAGCAGGTTCCCAGGATCGG - Intronic
1147936851 17:44016751-44016773 CTACAGATGGTTCCCAGCATTGG - Intronic
1148622110 17:49042554-49042576 CTTCACCTGGTTCCTAGAGTAGG + Intronic
1151122429 17:71808062-71808084 CTTCAAGTGGCTCCCAGGAAGGG + Intergenic
1161753996 19:6118079-6118101 CATCAAATGATTCCAAGGATGGG + Intronic
1165374611 19:35432901-35432923 CATCAGATGGTCCCCAGGAGTGG - Intergenic
1167321266 19:48798518-48798540 GTACACATGGTTCCCAGGACTGG + Intronic
1168106696 19:54169700-54169722 ATTCAGATGGTTCCCAGTCTGGG - Intronic
925102471 2:1259839-1259861 CTGCTCATGGTTCCTAGGGTAGG + Intronic
925793776 2:7521074-7521096 CTCCACATGGTTCCCAGTCCAGG + Intergenic
927788386 2:25990478-25990500 CTTCACATAAATCCCAGGAAAGG + Intergenic
929265239 2:39911758-39911780 CTTCACATTGTTGCCAGAAATGG - Intergenic
935673204 2:105572766-105572788 CATCACCTGGTGCCCAGGTTGGG - Intergenic
935962436 2:108439798-108439820 CATCACACGTTTCCCAAGATTGG + Intergenic
936504162 2:113091764-113091786 CTACACATGGTTTCCAAGAGGGG - Intergenic
940853273 2:158708101-158708123 TTTCACATGCTTGGCAGGATTGG - Intergenic
941351511 2:164442878-164442900 TTTTACATTGTTCCCAGGATAGG - Intergenic
942769738 2:179502535-179502557 CTTCACATGGATGGCAGGAGAGG - Intronic
944780266 2:203010418-203010440 CTTCTGATGGCTCCCAGGAGTGG - Intronic
946769402 2:223073204-223073226 CTTCACATGGTTCTGAGGTGGGG + Intronic
947362392 2:229359605-229359627 TTTTACAAGGTTCCTAGGATGGG + Intronic
947597883 2:231425499-231425521 TTTCACATGGTTCCCAGAAGGGG + Intergenic
1169722179 20:8690530-8690552 CTTGGCATGGGTCACAGGATGGG + Intronic
1170371515 20:15654056-15654078 CTTTTCATGGTTGACAGGATGGG + Intronic
1174462557 20:50692921-50692943 CTTGCCATGTTTCCCAGGTTGGG + Intergenic
1179161362 21:38902273-38902295 CTTCACAGCTTTCACAGGATAGG - Intergenic
1180879735 22:19195384-19195406 CTTCAAATAGTTCCCAGGAAAGG + Intronic
1181064027 22:20297216-20297238 CTGCACCTGGTTACCAGAATTGG - Intergenic
949461810 3:4302655-4302677 CTTCAGATGGTTTGGAGGATTGG + Intronic
949722934 3:7011734-7011756 ATACACATGGTTCTCAGTATAGG - Intronic
954410018 3:50366438-50366460 CTTCACAGCCTTCCCAGGACTGG - Intronic
955267659 3:57462713-57462735 CTTCAAATTGTTCCAAGTATGGG + Intronic
957436154 3:80178984-80179006 CTTCATAGGTTTCACAGGATAGG + Intergenic
966904382 3:184511212-184511234 CCTCACATGGTTCTGAGGATTGG - Intronic
969818005 4:9700176-9700198 GTGCACATGGCTCCCAGGAGGGG - Intergenic
972299747 4:37773467-37773489 TTTCTCAAGGTTCCCAGGAAAGG - Intergenic
975029682 4:69600098-69600120 TTTCACCTGGCTCACAGGATAGG - Intronic
981701422 4:147611009-147611031 CTACACATGGTTCCAGGGAGAGG + Intergenic
985047282 4:185953017-185953039 CTTCAAATGTTTCCCAGGCCGGG + Intronic
985951163 5:3222374-3222396 CTCCGCATGCTTCCCAGGACTGG - Intergenic
986987797 5:13518801-13518823 CTTTACAAGGTTTCCAGCATTGG - Intergenic
993288232 5:86030119-86030141 CTTAAGAAGTTTCCCAGGATAGG + Intergenic
994421768 5:99532876-99532898 CTTCAGCAGGATCCCAGGATAGG + Intergenic
994506895 5:100654831-100654853 ATTCTAATGGTTCCCAGTATTGG + Intergenic
999364023 5:151009676-151009698 CCTAACCTGGTCCCCAGGATAGG - Intergenic
1001294292 5:170488265-170488287 CTTCAAAAGGATCCCAGGAAGGG + Intronic
1001363052 5:171106683-171106705 CTTCACATGGTTCTCAATACTGG + Intronic
1002941065 6:1716649-1716671 CTTCTCAGGGTTCCCAGACTGGG + Intronic
1004883876 6:20033835-20033857 TTTCACATGGCTCCTAGAATTGG - Intergenic
1005973808 6:30781877-30781899 CATCACATGGTTCGAAGGCTAGG + Intergenic
1008892872 6:56515551-56515573 CTTCATATGTTTCCCAGAATTGG + Exonic
1014811811 6:125894937-125894959 TTTCATAAGGTTCTCAGGATAGG - Intronic
1019342214 7:513608-513630 CTTCCCAAGCTTCCCAGGAGGGG - Intronic
1022781591 7:33590125-33590147 CTTCACATGGTTCCATCAATGGG - Intronic
1023073961 7:36464863-36464885 CTTCACAAGGTTCAGAGGTTTGG + Intergenic
1026197277 7:68184090-68184112 CTTCTTATGTTTCCCAGGGTGGG + Intergenic
1027961454 7:84951054-84951076 TGTCACATGGTACCCTGGATGGG + Intergenic
1031261041 7:119520717-119520739 TTTCACATGTTGGCCAGGATGGG + Intergenic
1031268579 7:119614641-119614663 CTTCCCCTTGTTCCCAGGGTTGG + Intergenic
1031886330 7:127249756-127249778 CTTCATGTTGTTCCCAGGAGAGG - Intronic
1036471751 8:9058669-9058691 CCACACATGGTTGCCAAGATAGG - Intronic
1039236072 8:35503995-35504017 CTTGAAATGGTTGCCAGGTTTGG + Intronic
1043500583 8:80850828-80850850 TTTCCCATGGTTCCCAGGTGAGG - Intronic
1044468024 8:92529665-92529687 CTTCACATTATTTCCAGTATTGG - Intergenic
1046581898 8:116103289-116103311 CTTCACAAGGTCTGCAGGATCGG + Intergenic
1047200685 8:122763297-122763319 CTTCATATCGCTCTCAGGATAGG + Intergenic
1048936136 8:139358708-139358730 CTTAAGGTGCTTCCCAGGATTGG - Intergenic
1049314624 8:141956977-141956999 ATGGACATGGTTCCCAGGGTGGG + Intergenic
1049941195 9:547649-547671 TTTCACATGGTTTCAAAGATAGG + Intronic
1050875773 9:10634120-10634142 CTTCACATTGTCTCCAGCATGGG + Intergenic
1051484573 9:17594119-17594141 CTCCTTATGGCTCCCAGGATAGG + Intronic
1057518613 9:95742263-95742285 TTTCCCATGGTTCCCAGGCCTGG - Intergenic
1057555174 9:96082421-96082443 ATTCAGATGTTTCCCAGGAAAGG - Intergenic
1059489331 9:114654298-114654320 CTTCACATTATAGCCAGGATGGG + Intergenic
1060665463 9:125429856-125429878 ACTCACACGGTTCCCATGATGGG + Intergenic
1061037128 9:128120173-128120195 CTGCACAGAGTACCCAGGATGGG - Intergenic
1185653391 X:1665553-1665575 CTTCACAGGGTTCTCAGAAGAGG + Intergenic
1191792151 X:64982316-64982338 CTGCACATCTTTCCCAGGCTGGG + Intronic
1192165746 X:68826788-68826810 CTTCCCATGTTTCCCAAGACTGG + Intergenic
1201752717 Y:17450881-17450903 CTCCTCATGGTTTCCAGCATAGG + Intergenic