ID: 1107025620

View in Genome Browser
Species Human (GRCh38)
Location 13:35798399-35798421
Sequence CTGTAAACTCAGGAGAAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 290
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107025617_1107025620 -3 Left 1107025617 13:35798379-35798401 CCAGACTCCATTATTAATATCTG 0: 1
1: 0
2: 1
3: 11
4: 216
Right 1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG 0: 1
1: 0
2: 1
3: 24
4: 264
1107025618_1107025620 -10 Left 1107025618 13:35798386-35798408 CCATTATTAATATCTGTAAACTC 0: 1
1: 0
2: 1
3: 29
4: 273
Right 1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG 0: 1
1: 0
2: 1
3: 24
4: 264

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107025620 Original CRISPR CTGTAAACTCAGGAGAAGCA TGG Intronic
900587284 1:3439467-3439489 CTGTAAACACAGAGGAAGCTGGG + Intergenic
902720177 1:18298801-18298823 CTGTAAGCTCCGAAGAGGCAGGG - Intronic
902744721 1:18466007-18466029 TTCAAAACTCAGGGGAAGCAGGG - Intergenic
902838135 1:19059633-19059655 CTGGACACCCAGGAGAACCATGG + Intergenic
904148418 1:28414855-28414877 ACCTAAAATCAGGAGAAGCAAGG - Intronic
904410325 1:30321107-30321129 CAGAACAATCAGGAGAAGCATGG - Intergenic
906086812 1:43143306-43143328 ATTTAAAGCCAGGAGAAGCAAGG + Intergenic
907605691 1:55815240-55815262 CTGGAAGTTCAGGAGCAGCATGG - Intergenic
908128965 1:61055523-61055545 ATGTAAACACAGGGAAAGCAAGG - Intronic
908826792 1:68141044-68141066 ATGTAAAATCAGGAAAAACAGGG - Intronic
909482865 1:76144130-76144152 CTAAAACCTCATGAGAAGCATGG + Intronic
912866989 1:113266599-113266621 CTGAGACCTCAGGAGAAGCTGGG - Intergenic
913075264 1:115336677-115336699 CTGTAAACACAGGATAAGAAGGG + Intronic
913184774 1:116360242-116360264 CTGGAAACTCTGGAGGAACAGGG + Intergenic
915238198 1:154501557-154501579 GTGGACACTCAGGAGAAGAACGG - Exonic
915681451 1:157585644-157585666 CAGGAAACTCACAAGAAGCAGGG - Intronic
915925168 1:160011979-160012001 CTGTAAGCTAAAGAGAACCAGGG + Intergenic
917507375 1:175639964-175639986 ATGTAAACTCAGGAAGTGCAAGG + Intronic
917674669 1:177307337-177307359 AAGTAAAGACAGGAGAAGCAGGG + Intergenic
918127811 1:181599604-181599626 CTGTAAACTCTGTAGGTGCAGGG + Intronic
919084271 1:192902575-192902597 CTGCAGGGTCAGGAGAAGCAAGG - Intergenic
924748006 1:246856182-246856204 CTATGAACTCAGTAGAGGCAAGG + Intronic
1063812119 10:9723152-9723174 CTGTAAACTCAGGCCAAGGTGGG - Intergenic
1067300467 10:45003497-45003519 CAGTAGACTCAGAAGAAGCTTGG + Exonic
1067691427 10:48504539-48504561 CTGAGAACTCAGGAACAGCAGGG + Intronic
1067732245 10:48820679-48820701 CGGTGTTCTCAGGAGAAGCAGGG + Intronic
1068010310 10:51440934-51440956 CTATAAAATCAGGAAAAGAATGG + Intronic
1070515146 10:77198123-77198145 GTGAAAATTCAGGAGAAACAAGG + Intronic
1073054746 10:100692150-100692172 TTGGGAACTCAGGAGAAGCAGGG + Intergenic
1073070515 10:100790577-100790599 AGGTGAACTCAGGAGTAGCAGGG - Intronic
1073352957 10:102832715-102832737 GTGTAAGCCCAGGAGAAGCAAGG + Intronic
1073965987 10:108990583-108990605 CTATAAATTCATGAGAAGCAAGG - Intergenic
1074326120 10:112453071-112453093 CTGTAAAGTCATCAGAAACAAGG - Intronic
1078083024 11:8217688-8217710 CTGAAAGCCCAGGTGAAGCAGGG + Intergenic
1081026129 11:38017428-38017450 CTGTAGACTCAGGAGTAGGTGGG - Intergenic
1081656871 11:44863161-44863183 GTGTAAAATCAGGGGATGCAAGG + Intronic
1081852234 11:46281671-46281693 CAGTTAGCTCAGGAGAAGCCAGG - Intronic
1083105016 11:60348935-60348957 TTCTATACTCAGGAGAAGAATGG + Intronic
1084709681 11:70836204-70836226 CTGCACACTCAGAAGCAGCATGG + Intronic
1085005490 11:73084854-73084876 CTTTAAACTCAGGATATTCAAGG - Intronic
1085240895 11:75054249-75054271 CTGAAAAGTCAGGAGTAGGATGG - Intergenic
1085361442 11:75891596-75891618 CTCCAAACTCAGGAGAAGAAAGG - Intronic
1086053794 11:82624818-82624840 CTGCAAGCTGAGGAGGAGCAAGG - Intergenic
1086427777 11:86703863-86703885 TTGTAAACACAGGAGAAGAGGGG - Intergenic
1088229967 11:107663530-107663552 CTGTAAATATAGGAGAAGGAGGG - Intronic
1088521887 11:110710849-110710871 CAGTAAAATCAAGACAAGCAGGG + Intronic
1089330831 11:117687983-117688005 CTGCAGACCCAGGACAAGCATGG + Intronic
1091903754 12:4165816-4165838 CTGGAGTCTCAGGAAAAGCAGGG - Intergenic
1092744903 12:11664221-11664243 CTGCTAACACAGCAGAAGCATGG - Intronic
1096156479 12:49344228-49344250 CTGTAAACCCAGGAGGTTCAGGG - Intergenic
1098373875 12:69791226-69791248 CTGTAAACTCAGAAGAAACAAGG + Intronic
1099726513 12:86436084-86436106 CTTTAAACCCATGGGAAGCAAGG - Intronic
1100035002 12:90239773-90239795 CTGAAATCTCAGGAGAACCAGGG - Intergenic
1100045234 12:90372146-90372168 CTGTAATTTTAGCAGAAGCAGGG - Intergenic
1100789856 12:98118461-98118483 CTGTAAACTCCATAGGAGCAAGG + Intergenic
1102557630 12:113738195-113738217 ATGTAAACTCAGCAGGTGCAAGG - Intergenic
1103447270 12:121002318-121002340 CTGTGAACCCAGGACAAGCATGG + Exonic
1103499563 12:121390672-121390694 TTGCAAACTCAGGTTAAGCAGGG - Intronic
1103499747 12:121392267-121392289 TTGCAAACTCAGGTTAAGCAGGG + Intronic
1104500249 12:129278399-129278421 GTGAAAAATCTGGAGAAGCAAGG + Intronic
1107025620 13:35798399-35798421 CTGTAAACTCAGGAGAAGCATGG + Intronic
1107961752 13:45565218-45565240 CTGTGGACTCAGTAGAGGCATGG - Intronic
1108067652 13:46595019-46595041 CTATAAACTCAGAAGAAGCTAGG - Intronic
1108481335 13:50875327-50875349 CTGGGAACTCAGGAGAGCCAAGG + Intergenic
1112369634 13:98783688-98783710 CTGTGAAGTCAAGAGAAACAGGG + Intergenic
1112674346 13:101681381-101681403 CTGTAAACTCAGAAGCCACAGGG - Intronic
1114266891 14:21077966-21077988 CTGTAAAGTCAGGATAAGAAAGG - Intronic
1114888408 14:26884849-26884871 CTATAAACTCAGGAGTAGAATGG + Intergenic
1115131255 14:30054576-30054598 ATGTAAACTCTGTAGAAGAATGG + Intronic
1115202482 14:30869715-30869737 ATGTAAACTCATCAGAGGCAAGG - Intergenic
1117405304 14:55396507-55396529 CTGCAAACTCTAGAGAAGCTTGG + Intronic
1117767961 14:59102496-59102518 CTGTAAACTCCAGAAGAGCAGGG - Intergenic
1117772784 14:59151565-59151587 CTGCAAACCCAGGAGAAACAAGG - Intergenic
1117946723 14:61033996-61034018 CTGTAAAATCAGCAAAAGGAAGG - Intronic
1119746034 14:77044798-77044820 CTGTAAACAGAGAAGCAGCAAGG - Intergenic
1120188144 14:81415869-81415891 CTGAGAACTCAGAAAAAGCAAGG + Intronic
1121798881 14:96756940-96756962 CTGTAAACTCCTGATAAGCAGGG - Intergenic
1122879514 14:104683847-104683869 CTGCAGACTCAGAAGAGGCAGGG - Intergenic
1123448172 15:20344532-20344554 CTGGAGACTAAGGAGAAGCAAGG - Intergenic
1124997670 15:34739505-34739527 CTGTAAACTAAGGTTTAGCAAGG + Intergenic
1125446270 15:39760837-39760859 ATGTAAGATTAGGAGAAGCAGGG + Intronic
1128096672 15:64961455-64961477 CTGTAAAGTCAGGATAATCAGGG + Intergenic
1128463724 15:67891059-67891081 CTGTAATCCCAGCTGAAGCAGGG - Intergenic
1129874894 15:78967849-78967871 CTGTATTCTTAGGAGATGCATGG - Intronic
1131590004 15:93738887-93738909 ATTTAAATTCAGGAGATGCAGGG - Intergenic
1134748540 16:16607065-16607087 CTGTAAACTCCAGAGGGGCAAGG - Intergenic
1134996925 16:18746551-18746573 CTGTAAACTCCAGAGGGGCAAGG + Intergenic
1135185871 16:20315382-20315404 CTGTAAACCCATGAGTAGGATGG + Intronic
1135875365 16:26195076-26195098 CTGTAAACTGAGGATAACAATGG - Intergenic
1140152501 16:72383873-72383895 GTCTAAAGTCAGCAGAAGCAAGG + Intergenic
1140465139 16:75175226-75175248 CTGTAGACTGAGGTGAGGCAAGG - Intergenic
1143100741 17:4503412-4503434 CTGCAAGGTCAGGAGAAGGAGGG + Intronic
1145913580 17:28556879-28556901 CTGTACATTCAGGACAAGGATGG - Exonic
1146471024 17:33125046-33125068 CTGTAAACACAGATGAAGCTTGG + Intronic
1146709028 17:35024569-35024591 CTGAAAACTCAGGGAATGCAAGG + Intronic
1150623413 17:66824801-66824823 GTGTAATCACAGGAGATGCAGGG - Intergenic
1152340623 17:79722048-79722070 CTGGAGACTAAGGAGAAGCAAGG + Intergenic
1153001847 18:463011-463033 CTGTTCTCTCAGGAGAAGCGGGG + Intronic
1153225598 18:2897437-2897459 CTGTAAACACAGCAGACACAGGG + Intronic
1153310333 18:3671417-3671439 CTGTATCCTCAGGAGCAGCCTGG + Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155366329 18:25052407-25052429 CAGTAAACAGAGGAGCAGCATGG - Intergenic
1156832960 18:41516872-41516894 CTGTATAAGCAGGAGAAGAATGG - Intergenic
1157400690 18:47383983-47384005 CTGGAATCTCTGGAGAATCATGG - Intergenic
1158385702 18:56988701-56988723 TTATAAATTCAGAAGAAGCATGG + Intronic
1159052946 18:63438410-63438432 CTGTAAGCCAAGGAGAACCAAGG - Intergenic
1159174007 18:64811237-64811259 GAGTAAAAGCAGGAGAAGCAAGG + Intergenic
1160343596 18:78110816-78110838 CTGTCAGCTCAGGTGAGGCAAGG - Intergenic
1161714610 19:5868212-5868234 GTGAAGACTCAGGAGAGGCAGGG + Intronic
1161931810 19:7345587-7345609 CTGTAAGCTCAGAAGAAGTCAGG - Intergenic
1163001660 19:14372104-14372126 GTGTATACTCAGGAGCAGAATGG + Intergenic
1168546497 19:57254845-57254867 CTGTAAACTAATGAGAAAGATGG - Intronic
1168641240 19:58033279-58033301 ATGTAAACTCAAGAAAAACAAGG - Intergenic
928098975 2:28423751-28423773 CTGTCAAATCAGGAGAAGGAGGG - Intergenic
928666288 2:33553657-33553679 CTGACAACTAAGTAGAAGCAAGG - Intronic
928690831 2:33797092-33797114 CTCTTAACTCAGAAGAAGCTGGG + Intergenic
929227301 2:39524120-39524142 GTGTAAACTCATGGGAAGAAAGG + Intergenic
930811224 2:55543680-55543702 CTGTACAAACAGCAGAAGCATGG + Intronic
931106351 2:59060878-59060900 CTGGAAACTCAGGTAAACCAGGG - Intergenic
931250832 2:60529336-60529358 CTGTAAAGTGGGGAGAATCACGG - Intronic
931305715 2:61026253-61026275 CTGTACACTAAGGAGCAGAATGG - Intronic
931578676 2:63749245-63749267 CTGTAGATTCAGGATAACCAAGG + Intronic
931961655 2:67489498-67489520 CTGTAAGCACAGGAGAGGAAGGG + Intergenic
932223798 2:70022985-70023007 CTGTATTCTGTGGAGAAGCATGG - Intergenic
932431747 2:71679665-71679687 CTGTGGACTCAGGGGAAGGACGG - Intronic
932873152 2:75424100-75424122 CTGTAACCTCAGCAGCAGAAGGG - Intergenic
932949603 2:76277451-76277473 CTGTAAACTGATGATGAGCAAGG + Intergenic
933292367 2:80452378-80452400 CTGTAAATGCATCAGAAGCAGGG - Intronic
933457641 2:82536818-82536840 GTGTAAAATCAGGAGAAAAATGG + Intergenic
934692877 2:96375275-96375297 AGGGAAACTTAGGAGAAGCAGGG - Intergenic
938113494 2:128587572-128587594 CAGTAAATTCAGGAGGAGCCTGG - Intergenic
938835229 2:135095437-135095459 CTGTAGTCTCATGACAAGCATGG + Intronic
941715841 2:168762401-168762423 CTTTAAAATCAGGAAAACCACGG - Intronic
946074940 2:217065931-217065953 CTCTAAACTTCAGAGAAGCATGG - Intergenic
947258011 2:228187571-228187593 CTGGAAACTAAGGAGAGGTAGGG + Intergenic
1170540932 20:17387389-17387411 CTGCAACCTCACGAGAAACACGG - Intronic
1171727642 20:28640189-28640211 CTGAAAAGTCAGGAAAAGAAGGG - Intergenic
1172018763 20:31897734-31897756 CTGCAAACTCAGGGGAAGTCTGG + Intronic
1172712029 20:36932531-36932553 CTGCAACCTCAGGAGTAGCTGGG + Intronic
1172811455 20:37651088-37651110 CTGTAAAGTGAGGATAACCAAGG - Intergenic
1173164893 20:40680999-40681021 CTGTAACACCAGCAGAAGCAGGG + Intergenic
1174083122 20:47984760-47984782 CTGTAAAATCAGGCGTAGCCCGG + Intergenic
1174432937 20:50483781-50483803 CAGGAAACTTAGGAGAAGGAGGG + Intergenic
1174541960 20:51296688-51296710 CTGACACCTCAGGAGGAGCAGGG + Intergenic
1174795298 20:53517306-53517328 CTGTAAACACAGATGAAGCTTGG - Intergenic
1174979422 20:55376337-55376359 ATGTAGAATCAGGAAAAGCAGGG - Intergenic
1175062023 20:56252202-56252224 CTGCAAAATCAGGATAACCATGG - Intergenic
1175604026 20:60297847-60297869 CTGTAAACACAGATGAAGCATGG + Intergenic
1176314170 21:5226498-5226520 CTGAAAAGTCAGGAAAAGAAGGG - Intergenic
1177494830 21:21874730-21874752 CTGATAACCCAGTAGAAGCAAGG - Intergenic
1177860772 21:26451067-26451089 CTTTGAACTCAGGAGAGTCATGG - Intergenic
1180953021 22:19729281-19729303 CTCTAAACTCAGTCCAAGCAGGG + Intergenic
1181405441 22:22681284-22681306 CTGCCAACTCAGGAGCAGCTGGG - Intergenic
1185057590 22:48588963-48588985 CTGTAATCGGAGGAGAAGGAAGG - Intronic
949711665 3:6877487-6877509 ATGTAAAAGCAGGAGTAGCAGGG - Intronic
949862456 3:8518608-8518630 CCATAAACATAGGAGAAGCAGGG + Intronic
950390203 3:12690561-12690583 CTAGAAACTCGGTAGAAGCAAGG + Intergenic
950833421 3:15897490-15897512 CTGTAAGTTCAGGAGAACCCAGG - Intergenic
951661446 3:25071011-25071033 CTCAAGACTCAGAAGAAGCATGG - Intergenic
952019674 3:29002580-29002602 CTATAGGTTCAGGAGAAGCAAGG - Intergenic
952729121 3:36620536-36620558 CTGGAAAGTCAGGAGCAGAAAGG - Intergenic
953915804 3:46920534-46920556 CTGCAATCCCAGGAGACGCAGGG + Intergenic
955241938 3:57186064-57186086 CTGGAGACTCTGGAGGAGCAGGG - Intergenic
955516888 3:59734848-59734870 CTGGAGTCTCAGGAAAAGCAAGG - Intergenic
956089826 3:65654206-65654228 CTGCAAACTGAGAAGAATCAGGG - Intronic
956148861 3:66220719-66220741 CTGTAAACCCAGAAGAGGCGTGG - Intronic
956429011 3:69165747-69165769 CTGTAAAGCCAGGAGAAGCTTGG - Intergenic
957122218 3:76109627-76109649 CTGCAATCTCAAGAGAAACATGG - Intronic
959130446 3:102349158-102349180 CTGCAAACTCAGGACTTGCAAGG - Intronic
959979588 3:112500824-112500846 CTGTGAACACAGGAAAAGGAAGG - Intergenic
960160056 3:114340462-114340484 CAGTAAACTGAGGAAAAACAAGG - Intronic
960598978 3:119436252-119436274 ACTTAAACACAGGAGAAGCAGGG + Intronic
961454803 3:127018619-127018641 TTGTAAACTGAGCTGAAGCAGGG - Intronic
961750946 3:129094387-129094409 CTGTCAAATGAGGAGAAGCCGGG + Intronic
962169127 3:133082213-133082235 CTGTAAACTCCAGAGAAGCCTGG - Intronic
964892529 3:161554385-161554407 CAGTAAACTCAAGAAAAGAATGG + Intergenic
966734122 3:183175490-183175512 AAGTAAGGTCAGGAGAAGCATGG + Intergenic
970731684 4:19112259-19112281 TTGTAAACCCAGGAAAAGTATGG + Intergenic
971753014 4:30675695-30675717 CTGTAACCTCACTAGAAGGAAGG - Intergenic
971893927 4:32564802-32564824 CCAGAAACTCAGAAGAAGCATGG - Intergenic
971957222 4:33436753-33436775 CTGTAAACTGAGGAGAGGGCTGG - Intergenic
972180563 4:36459657-36459679 CTGTAAACACAGCAGCAGCCAGG + Intergenic
974031694 4:56782102-56782124 CAGTTAAATGAGGAGAAGCATGG - Intergenic
974193430 4:58538274-58538296 CTGCAAGCTGAGGAGGAGCAAGG + Intergenic
976753595 4:88475788-88475810 TTCAAAACTCAGTAGAAGCAGGG - Intronic
978585489 4:110272008-110272030 CTGGAGACCCAGGAGAGGCAAGG + Intergenic
979215553 4:118159658-118159680 CAATAAACTCAGGAGAAAAATGG + Intronic
979389571 4:120112238-120112260 CTGTAAGGACAGGGGAAGCAAGG + Intergenic
979471959 4:121109592-121109614 CTGTAGACTAATGAAAAGCATGG - Intergenic
979765120 4:124455347-124455369 TCGGAAACTGAGGAGAAGCAAGG - Intergenic
980467598 4:133205054-133205076 CAGGAAACCCAGGATAAGCAGGG + Intronic
982983783 4:162177790-162177812 CTGGAAAATCATCAGAAGCATGG + Intergenic
984936845 4:184897377-184897399 CTGGAAACTCGGGATAAGAATGG - Intergenic
985432945 4:189898860-189898882 CTGAAAAGTCAGGAAAAGAAGGG + Intergenic
985873220 5:2575456-2575478 TTGTAAGCTCAGGTGAAGCTGGG - Intergenic
986225570 5:5808780-5808802 CTTTAAACTATGGAGAAGTATGG + Intergenic
986255259 5:6097629-6097651 TTGCAACCTCAGGAAAAGCAAGG + Intergenic
986296547 5:6444090-6444112 CTATAAAGTAAGGATAAGCACGG + Intergenic
986312190 5:6559427-6559449 ATCTAAACTTAGGAGTAGCATGG + Intergenic
986696888 5:10365104-10365126 CTGTGAGATCAGAAGAAGCAGGG - Intronic
987433220 5:17862258-17862280 TGGTAAAATCAGGAGAGGCAGGG + Intergenic
987499284 5:18686502-18686524 CTGCAAAATCAGGAGAAACCTGG - Intergenic
988117673 5:26918827-26918849 CTGAAGACCCAGGAGAACCATGG - Intronic
988457386 5:31398471-31398493 CTGAGAACTCAGAAGAACCAGGG - Intergenic
988496083 5:31747465-31747487 CTGAAAAAACAGCAGAAGCAGGG - Intronic
989271849 5:39543040-39543062 ATCTAAACACAAGAGAAGCATGG + Intergenic
991202263 5:64008296-64008318 CTGTAAACACTGAGGAAGCATGG - Intergenic
991339012 5:65584850-65584872 CTCTAATCTCAGGACAAGCACGG - Intronic
991589729 5:68237777-68237799 CTGTAAACTCAACAGAACCGGGG + Intronic
991985442 5:72281164-72281186 TTGTAACATCGGGAGAAGCAAGG - Intronic
992917842 5:81477751-81477773 CTGTAAACTCCGCAAAAGTAGGG + Intronic
994398349 5:99247505-99247527 CTGCAAACCAAGGAGCAGCACGG + Intergenic
995215335 5:109588778-109588800 CTCTAAAGTCAGCAGCAGCAAGG - Intergenic
996304841 5:122035281-122035303 CTGGACACTCAGGAGAAAGATGG - Intronic
997872481 5:137517492-137517514 AGGCAAGCTCAGGAGAAGCAGGG + Intronic
998273520 5:140728975-140728997 CTGTAATCCCAGGAGAATCATGG - Intergenic
1001735139 5:173991214-173991236 CTGGAAAATCATGAGAATCAAGG - Intronic
1002966178 6:1968843-1968865 CTGTAAACTCTACAGCAGCAGGG + Intronic
1004952225 6:20686314-20686336 CTGTAAACACAGATGAAGCTTGG - Intronic
1005051251 6:21685874-21685896 CTGTAAACACAGATGAAGCTTGG - Intergenic
1006080782 6:31565022-31565044 CTGTGAAGACAGGAAAAGCATGG + Intergenic
1007759583 6:44126114-44126136 CTGAAAACTCAGGCAAAGAAAGG + Intronic
1007764585 6:44153065-44153087 CTGTAAACTCAGGAAAGACTTGG + Intronic
1011172562 6:84522178-84522200 CTGTACAGGCAGGAGAAACAGGG + Intergenic
1012163415 6:95917218-95917240 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1013232833 6:108172168-108172190 TTTTCAACTCTGGAGAAGCAGGG + Intronic
1014060983 6:117071602-117071624 CTGTAAACCCCACAGAAGCAGGG + Intergenic
1014401820 6:120999189-120999211 CTGGAGACTCGGGAGAAACATGG - Intergenic
1014812140 6:125899337-125899359 CTGTGATCCCAGTAGAAGCAAGG - Intronic
1017599151 6:156061892-156061914 TTGTAAAATCAGGTGAAGGAAGG + Intergenic
1017980247 6:159394839-159394861 ATATAAACTCAGGAGGGGCAAGG + Intergenic
1019001934 6:168761272-168761294 CTGTAGACTCAGGAGTTGCAAGG - Intergenic
1022454846 7:30549411-30549433 CTGTAAAATGAGGAGAATGATGG + Intronic
1022727426 7:32993700-32993722 CTGTAATCTCAGCTGAGGCAGGG + Intronic
1023413027 7:39906621-39906643 CATGAAACTCAGGACAAGCATGG + Intergenic
1024490572 7:49977754-49977776 CTGCTACCTCAGCAGAAGCACGG + Intronic
1024509952 7:50196048-50196070 CTGTGACCTCAGGAGAAAAATGG + Intergenic
1025046157 7:55693949-55693971 CTGTAATCTCAGCTGAGGCAGGG - Intergenic
1025280574 7:57624125-57624147 CTGTAAACTTGGTATAAGCAGGG - Intergenic
1025304156 7:57841382-57841404 CTGTAAACTTGGTATAAGCAGGG + Intergenic
1026141872 7:67713419-67713441 CTGGAAACAAAGGAGATGCAAGG + Intergenic
1027444876 7:78262141-78262163 GTGTAAAGTCAGTAGAACCATGG - Intronic
1027858408 7:83542766-83542788 CTGTAAACTCCTGAATAGCAGGG + Intronic
1028883726 7:95909205-95909227 CTGAAAACTCTGGAGAAACTTGG + Intronic
1030338610 7:108351616-108351638 TTGACAACTCAGGAGAAGGAGGG + Intronic
1030823417 7:114123898-114123920 ATGTAAACTTCCGAGAAGCATGG - Intronic
1031420211 7:121542703-121542725 CTGTATTTTCAGGAGAAACAGGG - Intergenic
1034634207 7:152554337-152554359 ATGTAAGCTCAGGGGAAGAAAGG - Intergenic
1035925793 8:3726227-3726249 CTGTAAACCCATGAGAGGCTGGG + Intronic
1037926655 8:22848738-22848760 CTGAAAACACAGCAGAAGAAAGG - Intronic
1038187759 8:25291166-25291188 CTTTAAACCCAGGAGGGGCATGG + Intronic
1040894029 8:52347261-52347283 CTGTAAAAGCAGGAAAAGCTTGG + Intronic
1041382623 8:57266832-57266854 CTGTCAGCTCTGCAGAAGCAGGG - Intergenic
1042197078 8:66240043-66240065 TTTTTAACTCAGGAGAGGCAGGG + Intergenic
1043932799 8:86109934-86109956 CTGTTATCTCAGGATAAACATGG + Intronic
1045240420 8:100395908-100395930 TTGTAAACTTAGCAAAAGCAGGG - Intronic
1045629062 8:104095260-104095282 CAGAAAACTAAGAAGAAGCAAGG - Intronic
1047900330 8:129414416-129414438 CTTTAAAGTCAGGAAAAGCAGGG - Intergenic
1047912179 8:129542309-129542331 CTATAAGCTTAGGAGAAGTAGGG + Intergenic
1048614551 8:136059216-136059238 CTGCCAAGTCAGGAGTAGCAGGG - Intergenic
1048777765 8:137966559-137966581 CTGGAAACTGAGGACAAGGAGGG - Intergenic
1051152169 9:14094027-14094049 CTGTAAAATCAGGATAATAATGG - Intronic
1053067402 9:35078319-35078341 CTGGAGACACAGGAGCAGCAGGG - Exonic
1053722099 9:40956887-40956909 CTGAAAAGTCAGGAAAAGAAGGG + Intergenic
1054343871 9:63895086-63895108 CTGAAAAGTCAGGAAAAGGAGGG - Intergenic
1057754384 9:97820191-97820213 CTGAATCCTCAGGAGTAGCAAGG - Intergenic
1058481819 9:105403666-105403688 GAGTTAACTCAGGAGTAGCAGGG + Intronic
1059407510 9:114110610-114110632 CTGTAAAATGAGGACAATCATGG - Intergenic
1059840821 9:118213684-118213706 CTTTAAAGGGAGGAGAAGCAGGG - Intergenic
1060722499 9:125988466-125988488 CTGTAAAGAAATGAGAAGCAGGG - Intergenic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1203453073 Un_GL000219v1:139070-139092 CTGAAAAGTCAGGAAAAGAAGGG - Intergenic
1186427818 X:9478078-9478100 CTGTAAAATCAGGATAACCATGG + Intronic
1189829391 X:44955178-44955200 CTGTTTACACAAGAGAAGCAGGG - Intronic
1192075296 X:67989108-67989130 CTGAAAACTCAGAAGAGGAATGG + Intergenic
1192230383 X:69260586-69260608 CTGTAACCTCAGTAGCAGAAGGG + Intergenic
1193121101 X:77823715-77823737 CTGCAAGCTGAGGAGGAGCAAGG - Intergenic
1195850319 X:109275740-109275762 CTGGACACCAAGGAGAAGCATGG + Intergenic
1197167450 X:123393272-123393294 ATGTAAAATTAAGAGAAGCACGG + Intronic
1198088781 X:133306889-133306911 CTTTAGACTCTGGAGTAGCATGG + Intronic
1198102691 X:133435875-133435897 CTGTAAACTCATGGGAGACAAGG + Intergenic
1198503984 X:137282609-137282631 CTTTAAACTCTGAAAAAGCAAGG + Intergenic
1199794196 X:151179133-151179155 GTGAAAACTGAGGGGAAGCAGGG - Intronic
1200184203 X:154171043-154171065 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200189856 X:154208171-154208193 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200195609 X:154245980-154246002 CTGTGTGCTGAGGAGAAGCACGG - Intergenic
1200201262 X:154283101-154283123 CTGTGTGCTGAGGAGAAGCACGG - Intronic
1200749670 Y:6933389-6933411 CTGTAAAATCAGGATAATGATGG + Intronic
1201757684 Y:17504510-17504532 TTGAAAAGTCAGGAAAAGCAAGG + Intergenic
1201843870 Y:18401472-18401494 TTGAAAAGTCAGGAAAAGCAAGG - Intergenic