ID: 1107026445

View in Genome Browser
Species Human (GRCh38)
Location 13:35806641-35806663
Sequence AGTTAGAAACTGAATGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 396
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 351}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107026445_1107026447 26 Left 1107026445 13:35806641-35806663 CCTTCTTCATTCAGTTTCTAACT 0: 1
1: 0
2: 3
3: 41
4: 351
Right 1107026447 13:35806690-35806712 CTGTGTGTGATGCCCTTTGCAGG 0: 1
1: 1
2: 3
3: 21
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107026445 Original CRISPR AGTTAGAAACTGAATGAAGA AGG (reversed) Intronic
904651723 1:32011014-32011036 AGAGAGCAACTGCATGAAGAGGG - Intergenic
905590717 1:39160917-39160939 AGTCAGTAACTAAATGAAGAGGG - Intronic
905951056 1:41951150-41951172 AATTAAATACTGAAAGAAGAAGG + Intronic
907770500 1:57457787-57457809 AGTAAGAAAGAGAAAGAAGATGG + Intronic
907815864 1:57917762-57917784 AGTTAAAAAGGGAAAGAAGAGGG - Intronic
908281053 1:62535351-62535373 AGTGAGAAACTTAGTGAAGAGGG + Intronic
908914787 1:69113953-69113975 AGTTAACCACTGAAGGAAGATGG - Intergenic
910873579 1:91856686-91856708 AGTCAGAATATGAATAAAGAAGG + Intronic
911167921 1:94741560-94741582 AGTTAGAAGGTGAAGGAAGTAGG + Intergenic
911304577 1:96217275-96217297 AGTTAGAACCTGAATCAATCTGG - Intergenic
911753488 1:101525735-101525757 AGTTTGAATCTGCATGCAGATGG - Intergenic
912452515 1:109776120-109776142 AGTAAACAAATGAATGAAGAAGG + Intergenic
913235698 1:116781130-116781152 ATTTAAAAACTGAATGCAAATGG + Intergenic
913553414 1:119938978-119939000 AGTTAGAAAATAAATGAATGGGG - Intronic
916235688 1:162585599-162585621 ATTTGTAAACTGAATGAAGTGGG - Intronic
916999494 1:170340824-170340846 AGTGGGAAACTGAAAGGAGATGG + Intergenic
917202201 1:172529674-172529696 AGGTAGTAACTAAATAAAGAAGG + Intergenic
917544365 1:175947911-175947933 TGAGAGAAAATGAATGAAGAAGG - Intronic
917762512 1:178177929-178177951 AGTTTGAAACTTTATCAAGAGGG - Intronic
918489360 1:185064093-185064115 AGTTAGAGACTTAATTCAGAAGG + Intronic
919259493 1:195173771-195173793 ATTTAGAAACTGAATGACTTGGG + Intergenic
919464830 1:197914874-197914896 ACTTGGAAACTGATTGCAGAAGG + Intronic
920296494 1:204960483-204960505 ACTTAGACACTGGAGGAAGAAGG - Intronic
920331938 1:205215092-205215114 ATCTAGGAATTGAATGAAGAGGG - Intergenic
920797150 1:209150456-209150478 ATTTCAAAACTCAATGAAGATGG + Intergenic
921008759 1:211119943-211119965 AATTTGATGCTGAATGAAGATGG - Intronic
922024037 1:221734038-221734060 AGTTAGAATGTGAAGGAAAAAGG - Intronic
1063222092 10:3978660-3978682 TGTTAGTAAATGAATGAAGGTGG + Intergenic
1064183652 10:13141507-13141529 ATTTAGGAACTGACTGAAAAGGG - Intergenic
1065709020 10:28497658-28497680 AGATAGAAAAGGAAGGAAGAAGG + Intergenic
1066619428 10:37328916-37328938 AGTTAAAAATTAAATCAAGATGG + Intronic
1068253480 10:54475331-54475353 AGTTAGAAGGTAAATTAAGATGG - Intronic
1068358882 10:55949714-55949736 AGTTAGCAACTGACTAAAGGAGG + Intergenic
1068505218 10:57891677-57891699 AGGGAGAAACTGAAAGAAGGTGG - Intergenic
1068657422 10:59589975-59589997 AGCAATAAATTGAATGAAGATGG - Intergenic
1069138821 10:64798954-64798976 AGTTAGAAAGAGAATAATGAGGG - Intergenic
1070448111 10:76528375-76528397 AGTAATAAAATAAATGAAGATGG + Intronic
1071020568 10:81050084-81050106 ATTTAGAAGATGAATGAAAAGGG - Intergenic
1071079078 10:81788585-81788607 AGATAGAAGCTAAATGAAGAGGG - Intergenic
1071123333 10:82305837-82305859 AGTTAGAAAATGAAAGAAATTGG - Intronic
1071159034 10:82725159-82725181 AGTGAGATACAGAATGAAGCAGG + Intronic
1071402554 10:85289284-85289306 GTTTAGAAAATGAATGAAAATGG + Intergenic
1071818573 10:89256684-89256706 AGTGAGACACTGTATGTAGAGGG + Intronic
1072880263 10:99219838-99219860 AGTTAGAAACAGACTAAAGAAGG - Intronic
1074485613 10:113875216-113875238 AGTTATAATTTGAATTAAGAGGG - Intronic
1076023431 10:127092817-127092839 GGTCAGAAACAGAATGAAAATGG + Intronic
1077575943 11:3383582-3383604 TGACAGAAACTGAATGAGGAGGG + Intergenic
1078189175 11:9077366-9077388 AAATAGAAACTGAAGGCAGATGG + Intronic
1078735002 11:14011754-14011776 AGTTAGAGAGTGGATGAGGATGG + Intronic
1080578460 11:33621929-33621951 ACTTTGAAAATGAATGAAGTAGG + Intronic
1083081749 11:60101302-60101324 AGTAAGAAAGTGAATAAAGCCGG + Intergenic
1083690826 11:64407502-64407524 ACTTAGAAATTGAGTGAGGAGGG + Intergenic
1087338673 11:96875577-96875599 AGTTAGAGATTGATTGGAGATGG + Intergenic
1087346897 11:96982924-96982946 TGTAAGAAAATGAATGCAGATGG - Intergenic
1087479307 11:98679918-98679940 ATTTAGAATCTGGATGAAAAAGG - Intergenic
1087570349 11:99919432-99919454 ATGTAGTAGCTGAATGAAGAGGG - Intronic
1087579492 11:100034001-100034023 AGTAAGATACAGAATGAAGGTGG - Intronic
1088831083 11:113537417-113537439 AGTTATAAATTGAATAAGGAGGG + Intergenic
1089186705 11:116621437-116621459 ACTTAGATATTGACTGAAGAAGG + Intergenic
1089916956 11:122166173-122166195 AAGAAGAAACTGAATTAAGAGGG + Intergenic
1090994638 11:131854465-131854487 AGTTGAAATCTGAAGGAAGAGGG + Intronic
1091970935 12:4786375-4786397 AATTAGTACCTTAATGAAGATGG - Intronic
1092798516 12:12139108-12139130 AGGGAGAAACTGAATAAAGCAGG - Intronic
1092994118 12:13932085-13932107 AGATAGGAACTGAATCATGAGGG - Intronic
1093301272 12:17460021-17460043 AGTTAAATGCTGAATAAAGAAGG + Intergenic
1093564503 12:20586560-20586582 ACTTAGATTCTGTATGAAGATGG + Intronic
1093636849 12:21480854-21480876 ACTTAGAAACTTAATGAAGAGGG - Intronic
1095304475 12:40623526-40623548 ATATAGAAACTCAAAGAAGAGGG - Intergenic
1095410265 12:41913766-41913788 TGTGAGAAACCGAAAGAAGATGG + Intergenic
1095630261 12:44367971-44367993 AGTTATAAACTGACTGTAGGAGG - Intronic
1095785380 12:46103089-46103111 CTTTAGAAACTGACTGAAAAAGG - Intergenic
1095794741 12:46206012-46206034 AATCAGAAACTGAATAAAAATGG - Intronic
1099476579 12:83114821-83114843 ATATATAAAATGAATGAAGATGG - Intronic
1099985409 12:89657189-89657211 ACTTAGTAACTGACTGAAGCCGG - Intronic
1101804695 12:108053155-108053177 ATTTAGAAAATGAATCAAGATGG + Intergenic
1102143973 12:110640402-110640424 ATTTAGAGACTGAATGACGATGG - Exonic
1102629800 12:114267985-114268007 AGATAGAAACCTAATGAAGAGGG - Intergenic
1103112111 12:118289692-118289714 ATTTAGAAACAGAATGAACCTGG + Intronic
1103173983 12:118845639-118845661 CGTTGGAGACTGAATGAAGGAGG - Intergenic
1103529137 12:121588229-121588251 AGTTATAAAATAAATAAAGAGGG + Intergenic
1103982096 12:124743104-124743126 AAATAGAAACTCCATGAAGAAGG - Intergenic
1104129010 12:125874685-125874707 AGTGAGAAACTGGAGCAAGAGGG + Intergenic
1106591576 13:31103058-31103080 AATGAAAAACTGAATGAATATGG - Intergenic
1107026445 13:35806641-35806663 AGTTAGAAACTGAATGAAGAAGG - Intronic
1107300324 13:38959250-38959272 AGTTTGGAACTGAATTAAGTGGG - Intergenic
1107843405 13:44484141-44484163 AGTTTGAAACTGAAAAAAGTAGG + Intronic
1109683086 13:65778547-65778569 AGTTATACAATGAAGGAAGAGGG - Intergenic
1111453977 13:88455167-88455189 AGGTAGAAAGTGATTGAAAAAGG + Intergenic
1113164004 13:107417078-107417100 CATAAGAAACTGAGTGAAGAAGG - Intronic
1113549710 13:111183274-111183296 AGTTAGAAATTAAGTGCAGAAGG + Intronic
1114029531 14:18565544-18565566 AATTAGAGAATGTATGAAGAAGG - Intergenic
1114747073 14:25160517-25160539 AGCTAGATACTGGAAGAAGATGG + Intergenic
1115251768 14:31356129-31356151 AGATAGAAACTACATGAATAGGG - Intronic
1115907798 14:38220542-38220564 AGTGAGAAACTGACTGAAAGAGG - Intergenic
1116758018 14:48972770-48972792 ATTTAGAGATTGAATGAAAATGG + Intergenic
1117270057 14:54134539-54134561 AGATAAAAACTGAAATAAGATGG + Intergenic
1117782897 14:59253120-59253142 TGTAAGAAAGTGAATTAAGATGG - Intronic
1119070195 14:71575280-71575302 AGTAAGACACTGAATGATAAGGG - Intronic
1119954997 14:78788388-78788410 GGTGCAAAACTGAATGAAGAAGG - Intronic
1120085151 14:80263478-80263500 AGTGAGAAACTGAATGCAGGGGG + Intronic
1120150350 14:81025894-81025916 GGCAAGAAACTGAAAGAAGATGG + Intronic
1120157329 14:81107953-81107975 AATTAGGAATGGAATGAAGATGG - Intronic
1121167154 14:91814649-91814671 AGTTAGAAACTGAAAAAAGGAGG + Intronic
1121223712 14:92306054-92306076 AGTTGGACACTAAATAAAGAAGG + Intergenic
1121484553 14:94304605-94304627 TGTTAGGTACAGAATGAAGATGG + Intronic
1124582909 15:30977442-30977464 AGTTATAATCTGAGTGCAGAAGG - Intronic
1125064819 15:35469819-35469841 ACATATAAACTGAAAGAAGAGGG + Intronic
1125780736 15:42264623-42264645 AGATAGAAACAGAATGGAAAAGG + Intronic
1126367577 15:47911676-47911698 ACTTAGAAACTGCATGAATTGGG - Intergenic
1127755032 15:62083935-62083957 AGTGTGAAACAGACTGAAGAAGG + Intergenic
1129187921 15:73921891-73921913 AGATAGAAAATGAACGAATAAGG + Intergenic
1129826403 15:78637722-78637744 AGTTGGAAAGTGGATGAAGTCGG - Intronic
1130103732 15:80913402-80913424 AGTTAGGAGTTGAATGAAGCAGG - Intronic
1131994919 15:98124531-98124553 ATTTAGAAACGGAGTGAGGAAGG - Intergenic
1133487116 16:6231053-6231075 AGATAGAAACTAATTAAAGAAGG + Intronic
1133568479 16:7018197-7018219 AGTTAGTAACTACCTGAAGAAGG + Intronic
1133688267 16:8187920-8187942 AGGAAGAAAATGAATGAAGGAGG + Intergenic
1134788955 16:16971160-16971182 ATCTAGAAACTGAAGGAAGATGG - Intergenic
1135657015 16:24259056-24259078 AGTGAGAAATTGAATCAAGAAGG + Intronic
1136531296 16:30871188-30871210 AGCTAGAAACTGACTTAGGAGGG + Intronic
1138456888 16:57126235-57126257 AGTAAGAAAATGAATCATGATGG + Intronic
1138799947 16:60015498-60015520 ATTTTGAAACTGAAAGAAAATGG + Intergenic
1139106002 16:63827137-63827159 ATTTAGAAACTGAATTAGGCAGG + Intergenic
1139244593 16:65429130-65429152 AGTGAGATGCTGAAGGAAGAAGG + Intergenic
1139830914 16:69797511-69797533 AGTTAGAAAATGTATGCACATGG + Intronic
1141193921 16:81845270-81845292 TGTTAGCAACTGAATCAAGCTGG - Intronic
1144965086 17:19072097-19072119 AGACTGAAAGTGAATGAAGAAGG + Intergenic
1144982881 17:19180083-19180105 AGACTGAAAGTGAATGAAGAAGG - Intergenic
1144985342 17:19198156-19198178 AGACTGAAAGTGAATGAAGAAGG + Intergenic
1146659377 17:34654183-34654205 AGTTAGAAAATGAATCCAGAGGG - Intergenic
1147979578 17:44266280-44266302 AGGAAGAAAGTGAATAAAGATGG - Intronic
1148318414 17:46725480-46725502 AGGAAGGAACTGAATCAAGATGG + Intronic
1149306662 17:55354173-55354195 AGATAGAAACTGGATGAGGAGGG + Intergenic
1150536208 17:66044683-66044705 AGTGAGGAACTGAATAAAGACGG + Intronic
1152027334 17:77819605-77819627 TTTCAGACACTGAATGAAGATGG + Intergenic
1155181047 18:23347044-23347066 TTTTAGAAACTAAAGGAAGAGGG - Intronic
1155788910 18:29938285-29938307 AGTAAGAAATTTAATCAAGAAGG - Intergenic
1156011072 18:32498606-32498628 AGTCAGAAACAAAATGAAGATGG - Intergenic
1157073301 18:44435453-44435475 AGGAATAAACTGAATCAAGAAGG - Intergenic
1157543793 18:48533441-48533463 ATTTATAAACTGACTGAAGAGGG + Intergenic
1158000688 18:52614945-52614967 AGTTAAAAACGGAGTGAAAAGGG - Intronic
1159051690 18:63426427-63426449 AGGTAGTGACAGAATGAAGAGGG - Intergenic
1159100044 18:63948538-63948560 AGTCAGATACTGAATAAAGGGGG - Intergenic
1159174634 18:64816526-64816548 AGCTAGAAACAAAATGAAGTTGG + Intergenic
1159687841 18:71445256-71445278 AATTAGAAACTGAATGATATTGG - Intergenic
1159828725 18:73247112-73247134 AGCTAGAAACTAATTGATGATGG + Intronic
1161275453 19:3413929-3413951 AGTCAGAAAATAAATCAAGAGGG - Intronic
1164112245 19:22178055-22178077 ATTTGGAAACTGAATAATGACGG - Intergenic
1164196762 19:22973930-22973952 ATTTGGAAACTGAATAATGATGG - Intergenic
1164234509 19:23320526-23320548 AGGGAGAAAGTGAATAAAGAAGG + Intronic
1164249279 19:23462930-23462952 AGGGAGAAAGTGAATGAAGAAGG + Intergenic
1164325020 19:24183663-24183685 AGAGAGAAAGTGAATGAAGGAGG - Intergenic
1167175943 19:47864463-47864485 AGTTTGTTAATGAATGAAGATGG + Intergenic
1167739461 19:51315657-51315679 AGTTAAGACCTGAAGGAAGAGGG + Intronic
1168576189 19:57513008-57513030 GGTTCGGGACTGAATGAAGAAGG - Intronic
925450552 2:3965808-3965830 AATTAGAAATTGAATTAAAAAGG + Intergenic
926192177 2:10737112-10737134 TGTTAGAAAATGAATTAAGTTGG + Intronic
926717974 2:15939944-15939966 AGTTTCAAATTGAAAGAAGAGGG - Intergenic
927235619 2:20871882-20871904 AGGTAGCAAAAGAATGAAGAAGG + Intergenic
927351027 2:22115021-22115043 AGGAACAAACTTAATGAAGAAGG + Intergenic
927367320 2:22313935-22313957 TGTTACAAAATGAATAAAGAAGG - Intergenic
927624078 2:24694685-24694707 ACTCAAAAACAGAATGAAGAAGG - Intronic
928182040 2:29075001-29075023 AATAAGATAGTGAATGAAGAAGG + Intergenic
928190010 2:29155681-29155703 CAGCAGAAACTGAATGAAGAGGG - Intronic
931626193 2:64257741-64257763 AGATAGAAACTTCATGAATATGG - Intergenic
932889285 2:75577928-75577950 AGGTAGAAGGTGAATGAAGTTGG + Intergenic
933431416 2:82184824-82184846 AAATAGAAAATGAATGATGAAGG + Intergenic
935502041 2:103853575-103853597 AGTTAGAAGCTAAATGCTGAAGG + Intergenic
936962456 2:118089522-118089544 AGTGAACCACTGAATGAAGATGG + Intronic
937174810 2:119919522-119919544 AGTTATAATATGAATGAACAAGG + Intronic
937461991 2:122097348-122097370 ACTGAGAAACTGAATGGAGGGGG - Intergenic
937681776 2:124652032-124652054 AGTCACCAACTGAATGAAAAAGG - Intronic
938869153 2:135455486-135455508 AGTTAGAAAGTGTAAGAAGTCGG - Intronic
939636189 2:144585182-144585204 AGAGAGAAACTGAATGTAAATGG + Intergenic
940229485 2:151434935-151434957 AATTAAAAACTGAATAAAAATGG - Intronic
940607394 2:155943479-155943501 ATTTAAAAAGTGAATGAAAAAGG - Intergenic
942413572 2:175735916-175735938 AGTTAGAAAACAAATGGAGAAGG + Intergenic
942604151 2:177672903-177672925 AGTTAGAATCTGAATGAATTAGG + Intronic
942902508 2:181138871-181138893 AGACAGAAAGTGAATGCAGATGG + Intergenic
944247068 2:197542047-197542069 ATTAGGAAACTGAATCAAGAAGG + Intronic
944418262 2:199500296-199500318 ATTTTGAAAATGAATGAAGTTGG + Intergenic
944867298 2:203875289-203875311 AGATTGAGACTGAATGAAGAGGG - Intergenic
945105345 2:206307162-206307184 AATTAGTCACTGAATGAAGAGGG - Exonic
947085906 2:226452600-226452622 AGAAAGAAACTGAAGGAGGAGGG + Intergenic
1172454490 20:35057421-35057443 AGTTAGGAAGGGAAGGAAGAAGG + Intronic
1172586871 20:36091835-36091857 AGATAGCATCTGAAAGAAGATGG - Intronic
1173041449 20:39467668-39467690 AGGTAGAAACTGACTGAAAGGGG - Intergenic
1173243167 20:41316248-41316270 ACATAGAAAATGAATGAAAAGGG - Intronic
1173327522 20:42047421-42047443 TGTAACAAGCTGAATGAAGAGGG - Intergenic
1173356530 20:42297564-42297586 AGCTAGAAACTCACTGAAAAAGG + Intronic
1174158615 20:48534298-48534320 ATTTTTAAACTGAAAGAAGATGG - Intergenic
1178217814 21:30621552-30621574 AATTAGAAATTGGATGAACAAGG - Intergenic
1178428147 21:32495733-32495755 AATTAGAATCTAAACGAAGAAGG - Intronic
1178954253 21:37008363-37008385 AGTTGGAACCTGAATGAGTAAGG + Intronic
1179207111 21:39291896-39291918 AGTGAGACAGTGAAGGAAGAAGG - Intronic
1180453646 22:15492594-15492616 AATTAGAGAATGTATGAAGAAGG - Intergenic
1181320050 22:21997621-21997643 AGTTAGAAACAAGATGAAGATGG + Intergenic
1183667135 22:39252578-39252600 AGCTAGCAAATGAATGAAGGGGG + Intergenic
1184187296 22:42873333-42873355 TATCAGAAACTGGATGAAGATGG + Intronic
1184833769 22:47008325-47008347 GGCTAGAAAATGAATGGAGAGGG - Intronic
1184870193 22:47232922-47232944 AGTCAGAGGCTGAATCAAGAAGG + Intergenic
1185017931 22:48356299-48356321 AGTTAAAAAGTGGATGAAGCTGG - Intergenic
950261657 3:11546623-11546645 AGTTTGAAATTGGATGATGAGGG + Intronic
950429753 3:12944000-12944022 AGGAAGAGCCTGAATGAAGAGGG + Intronic
951074496 3:18373150-18373172 CTTTAGAAAGTGAATGAAGAAGG + Intronic
951245613 3:20338097-20338119 ATTTACAAACTGAGGGAAGAGGG + Intergenic
951383371 3:22013621-22013643 AGGTAGAAACTTAATTAAGAAGG + Intronic
951432201 3:22621409-22621431 AGTAAGAAAGTGAATGAGGCTGG + Intergenic
951572240 3:24076650-24076672 AGTCAAAAACAAAATGAAGATGG - Intergenic
952499230 3:33944288-33944310 AGTAAGAAACTAATTGAGGAGGG - Intergenic
953627373 3:44581813-44581835 ATTTAGAAGCTGAATGACCAGGG - Intronic
954005315 3:47585940-47585962 ATGGAGAAAATGAATGAAGAAGG - Exonic
955294749 3:57724639-57724661 AGTTCTAATCTTAATGAAGAGGG - Intergenic
955342567 3:58136696-58136718 TCTTAGAAACTGAAGGAAAAAGG - Intronic
955780365 3:62478147-62478169 AGTTTGAAACTAATTGGAGAAGG - Intronic
956021576 3:64938740-64938762 AGTTAGAACCTGAATTAATCAGG - Intergenic
956204151 3:66738631-66738653 AATTAGAAAGTGGATGAAGTTGG - Intergenic
956662384 3:71611992-71612014 ACTTAGAAGCTTAATAAAGATGG + Intergenic
956908839 3:73795805-73795827 AGTTAGGAACTGAGGGGAGATGG + Intergenic
957255837 3:77836799-77836821 TAGTAGAAACTGATTGAAGAAGG + Intergenic
957459596 3:80499104-80499126 GTTTAAAAAATGAATGAAGATGG - Intergenic
957797427 3:85029695-85029717 AGTTAGAAATGGAATGAATAAGG - Intronic
958425036 3:93970141-93970163 AGTTAGAGAAAGAAAGAAGAGGG + Intronic
959941173 3:112083189-112083211 ATTTAGAACCTGAATGATGTGGG + Intergenic
960072359 3:113445338-113445360 ATTGAGAAACAGAATGAAGAAGG - Exonic
960429334 3:117549506-117549528 AGTTAGCCACTTAATGCAGAGGG - Intergenic
960964200 3:123093293-123093315 AGTTAGTATCTGAATGAATCTGG - Intronic
962053754 3:131847052-131847074 AGTTAGAATCTGAGGGGAGATGG - Intronic
962213405 3:133498627-133498649 AGTTAGAAACTGAATAGACATGG - Intergenic
962595241 3:136935549-136935571 AGGGAGAAACTGAATTAATAAGG + Intronic
963373947 3:144438545-144438567 TGTGAGATACTGAATAAAGATGG - Intergenic
963738417 3:149048873-149048895 ACTTAGAATCAGAAAGAAGATGG - Exonic
963755876 3:149234764-149234786 ACTTGGAAACTGAAAGAGGAAGG + Intergenic
963773516 3:149414892-149414914 AGTTTGAAAGTGATTGAGGAGGG + Intergenic
964016085 3:151948445-151948467 ATTTTGAAACTGAGGGAAGAAGG + Intergenic
964185674 3:153939860-153939882 AGTTAGATACTAAATGCAAATGG + Intergenic
964724211 3:159797399-159797421 AATAAGAAACTGCATGAAGTTGG - Intronic
965841189 3:172907411-172907433 AGTTGGAAATAGATTGAAGAAGG - Intronic
967438188 3:189475903-189475925 AGATAGATACTAAAGGAAGAAGG - Intergenic
967597837 3:191348696-191348718 AGTAACAAAATAAATGAAGATGG + Intronic
969540419 4:7785093-7785115 AGTTAGCAGATGAATGAAGGAGG - Intronic
970389102 4:15589531-15589553 AGTTGGACCCTGAAAGAAGATGG - Exonic
970420349 4:15900118-15900140 AGGAAGAAAATGAATGAAGAAGG - Intergenic
970669459 4:18379437-18379459 AGATGTAAACTGAAAGAAGAGGG - Intergenic
970905056 4:21205956-21205978 AGGCAGAACCTGAATGCAGATGG - Intronic
971259494 4:25043402-25043424 AGGTAGAAGCTGAAAGAAGATGG + Intergenic
971542558 4:27838258-27838280 AGGTAAAAACTGAACAAAGAAGG + Intergenic
973764747 4:54152835-54152857 ACTTGGAAAGTAAATGAAGATGG + Intronic
974356414 4:60818484-60818506 TGTTAAGAACAGAATGAAGAGGG - Intergenic
975760335 4:77613891-77613913 ACTGAGAAACTGAATGAAGGAGG + Intergenic
975923520 4:79421576-79421598 AGTTGCAAACTTAAAGAAGACGG + Intergenic
976982934 4:91254526-91254548 TGTAAGAGACTGAATGAAAAGGG + Intronic
977308788 4:95358201-95358223 AGGTAGAAACTGCATTAATAAGG - Intronic
977727678 4:100316159-100316181 AGTTGGAAACTGAAGGTAGGTGG - Intergenic
979279943 4:118855716-118855738 ACTAAGAAACTGATTGAAGTAGG + Intronic
979547431 4:121953388-121953410 AGTTAGAATGTGTATGAAAAAGG - Intergenic
980058037 4:128097605-128097627 AGTTAAAAACTCAGTGAACATGG - Intronic
980742371 4:136969259-136969281 AGTGAGAAAATGAATAAAGAGGG - Intergenic
981719590 4:147787897-147787919 ACTTAGAAAGTGAATAAGGAGGG + Intronic
981810938 4:148773474-148773496 AGTTGGACACTGATTCAAGAGGG + Intergenic
982038044 4:151365800-151365822 AATTAGAAAATGAATCAATATGG - Intergenic
982264460 4:153525639-153525661 ATTAAGAAACTGAAAGAAAAAGG - Intronic
982316426 4:154036487-154036509 AGTAGGAAACTGAATTAAGATGG + Intergenic
982500089 4:156143400-156143422 AATAAGAAACTGTAGGAAGAGGG + Intergenic
982783125 4:159511805-159511827 GGTTAGAAAAAGACTGAAGACGG - Intergenic
984243162 4:177242004-177242026 AGTAAGAAAGTGAATGAGGCCGG - Intergenic
985046042 4:185941298-185941320 AGCTAGAATTTGAATGTAGATGG + Intronic
985373636 4:189311623-189311645 AGTAAGAAACTGAATATACAAGG - Intergenic
987435735 5:17891946-17891968 AGTGAGCAAATGACTGAAGACGG - Intergenic
989543224 5:42642115-42642137 AGATAGAAACTAAATTCAGAAGG + Intronic
991585168 5:68194737-68194759 TGTTAGAACCTGAATGCAGTGGG + Intronic
993042282 5:82827956-82827978 AGTTAAAAAATGAAAGGAGATGG - Intergenic
993045212 5:82858632-82858654 AGGGAGACACTGAAGGAAGAAGG - Intergenic
993790356 5:92200409-92200431 AGTTAAGAACTGAAAGAAGGTGG - Intergenic
993807371 5:92428036-92428058 AAGGAGAAACTAAATGAAGAAGG - Intergenic
994457041 5:100023861-100023883 AGTGACAAAATGGATGAAGAAGG - Intergenic
995025867 5:107422089-107422111 AGTAAGCAACTAAAAGAAGAGGG - Intronic
996027981 5:118671065-118671087 ACTTAGAAACTTAAGCAAGAAGG - Intergenic
996891435 5:128425770-128425792 AGAAAGAAACTCAATGAAAATGG + Intronic
998781707 5:145664365-145664387 ACTAAGAAGCAGAATGAAGAAGG + Intronic
998814196 5:145995586-145995608 AGTTAGAAAATGAATGAAGTTGG - Intronic
999001515 5:147928867-147928889 AAATAGAAAATGAATGAAAAGGG + Intergenic
999504868 5:152184170-152184192 AGAAAGAAAAAGAATGAAGAGGG + Intergenic
999521572 5:152356335-152356357 AGATAAAAACTGAGTGGAGATGG - Intergenic
1000292166 5:159880624-159880646 AGTTTGACACTGTCTGAAGATGG - Intergenic
1000831982 5:166113583-166113605 ACTTAGAAACAGAAGGATGAAGG + Intergenic
1001160620 5:169309530-169309552 AGTTAGGAAGGGAATGAATAGGG + Intergenic
1003354947 6:5359557-5359579 ACTTGGCAACTGCATGAAGAGGG - Intronic
1003376534 6:5583413-5583435 ATTTATAAAATGAATAAAGACGG + Intronic
1003515986 6:6819146-6819168 AGTTAAAAAGTGATTGAAAAGGG + Intergenic
1003794238 6:9582021-9582043 AGTTAGAAACTGAATTGAGTAGG + Intergenic
1003905795 6:10698582-10698604 AGTTAGAGACTGAATTGGGAGGG + Intronic
1004062065 6:12207324-12207346 ATTTAAAAAATGAATAAAGATGG - Intergenic
1005128299 6:22473589-22473611 AGTTAGAAAAAGGTTGAAGAAGG + Intergenic
1005695538 6:28349615-28349637 GGTCAGAAACTGAGTGAAAACGG - Intronic
1007141637 6:39581454-39581476 AGTTAGAAAATGAGTAAAGCGGG - Intronic
1008161527 6:48082206-48082228 AGTCAGGAAATGAATGAAGAAGG + Intergenic
1008733964 6:54519623-54519645 TGTTAGAAACTTAATAGAGAAGG - Intergenic
1010186677 6:73152331-73152353 AGGTAGAAAATGAAAGAGGAAGG - Intronic
1010966327 6:82213545-82213567 ATTGAGAAACTGAAGTAAGAAGG + Intronic
1011608701 6:89129568-89129590 AATTAGAAACAGAGAGAAGAGGG - Intergenic
1014080392 6:117280418-117280440 AGGTAGCAACTGGAAGAAGATGG - Intergenic
1014370682 6:120603638-120603660 ATTTAAAACCTGAATGAAGGAGG + Intergenic
1014465595 6:121752812-121752834 AGGTAGAAATTGAATGAAAAAGG + Intergenic
1014706805 6:124757905-124757927 AGTTAAAAACTTAATAAACATGG - Intronic
1015528496 6:134196930-134196952 TGTTAAAAACTGAATGTATAAGG + Intronic
1015613764 6:135053826-135053848 AGTTATCTACTGCATGAAGAGGG + Intronic
1015927555 6:138325387-138325409 TGTGAGAAACTGAAGGTAGAAGG - Intronic
1016101733 6:140110219-140110241 AGTAAGTATCTGAATGAAAAAGG - Intergenic
1016805580 6:148208819-148208841 ATATAGAAACTGACTGAATACGG + Intergenic
1016878180 6:148884456-148884478 GAATAGAGACTGAATGAAGAGGG + Intronic
1017271076 6:152506134-152506156 ATTAAGAAACTGAATCAAGTTGG + Intronic
1017568925 6:155721086-155721108 AGATGGAAACTCAAGGAAGAGGG + Intergenic
1017809113 6:157971595-157971617 TTTTAGCTACTGAATGAAGAAGG + Intergenic
1018496984 6:164358927-164358949 GAATAGAGACTGAATGAAGAAGG - Intergenic
1020053772 7:5102367-5102389 AGTGGGAAACAGAATGAAGGAGG - Intergenic
1020491920 7:8796851-8796873 ATTTAAAAACTGAATTAAAATGG + Intergenic
1020986027 7:15135496-15135518 GCTTAGAAAATGAATGAAAAGGG + Intergenic
1022338219 7:29443239-29443261 AGTTAGAAATTCAATGAAATTGG - Intronic
1022420223 7:30213330-30213352 AGTAAGAAACAGAAAGAGGAAGG - Intergenic
1022521365 7:31009398-31009420 AATGAGAAACTTAATGGAGAAGG - Intergenic
1026442227 7:70454693-70454715 AGTTAGAAACTCAAAGGCGATGG - Intronic
1026515084 7:71062474-71062496 TGCTAGAAACTGAAGGATGATGG + Intergenic
1027503235 7:78981987-78982009 AGTAAGACACTAAATGAAGTTGG - Intronic
1027636362 7:80680293-80680315 ATATAGAAAGTGAATGAGGAAGG + Intergenic
1027653993 7:80905617-80905639 AGTTACAAACTGAATGGAGAGGG - Intronic
1028144185 7:87303915-87303937 AGTTAGAAAATGATTTCAGAAGG - Intergenic
1028181936 7:87734439-87734461 AGTTGGTAACTAAAGGAAGAAGG - Intronic
1028214667 7:88116753-88116775 ATTTGTAAACTGAATGAAAATGG - Exonic
1028620859 7:92827064-92827086 AGATATAAACTGATTGAGGATGG - Intronic
1028675889 7:93460090-93460112 ACTTGGCAACAGAATGAAGAGGG + Intronic
1030029527 7:105356078-105356100 AGTTAGAAACTCAATCCTGATGG - Intronic
1030424253 7:109353235-109353257 GGATAGAAACAGAATGAAGCTGG + Intergenic
1030994310 7:116339847-116339869 AGATAGAAACTGAATCAATATGG + Intronic
1031044217 7:116869445-116869467 ATTTAGTAAATGAATGAAGATGG - Intronic
1031602326 7:123725725-123725747 AGGTAGAAACTCAAAGAACAGGG + Intronic
1035766260 8:2108132-2108154 AATTAGAATCAGAAAGAAGATGG - Intronic
1037056886 8:14453576-14453598 AGTAAGAAAATGATTGAAGGTGG + Intronic
1037188261 8:16091128-16091150 GGTTTGACACAGAATGAAGAAGG + Intergenic
1037340916 8:17844072-17844094 AGTCAGAAATTGGAGGAAGAGGG + Intergenic
1038203851 8:25445092-25445114 CCTTAGAAACTGAAAGAAGCTGG + Intronic
1039206375 8:35160121-35160143 GGTTAGAAATTGAATGCTGAAGG + Intergenic
1040098363 8:43472304-43472326 AGTAAGAAAGTGATTGAAGGTGG + Intergenic
1041487494 8:58395130-58395152 TGTTAGAAAATGAATGAAAACGG + Intergenic
1042081942 8:65063388-65063410 AGTTATATTCTGAATGAGGAAGG + Intergenic
1042144159 8:65710834-65710856 AACTAGAAACTGAATGACGTGGG - Intronic
1042490640 8:69393791-69393813 AGTGAGAGCCTGGATGAAGAAGG + Intergenic
1044159766 8:88898893-88898915 AGTTAGGAACTGAAGGGACATGG + Intergenic
1045660347 8:104430878-104430900 AGTAAGAATCCGAATGGAGATGG - Intronic
1046698385 8:117370847-117370869 ACTTAAAAACTGAATGGAAATGG - Intergenic
1048745351 8:137608931-137608953 AGTTGAAAAGGGAATGAAGATGG - Intergenic
1050639509 9:7652326-7652348 AGTTAAAAACTGTAAGAAGCTGG - Intergenic
1052254519 9:26438779-26438801 ACTTAAAAATTGAATGAAGGAGG - Intergenic
1055373865 9:75627887-75627909 GGTTAGAAAAAGAATAAAGAGGG + Intergenic
1055584501 9:77743870-77743892 AGTCAGAAACTCAAAGTAGAAGG + Intronic
1055710450 9:79055131-79055153 AGATAGACACTGAGGGAAGATGG + Intergenic
1056937949 9:90932152-90932174 ATTCAGGAACAGAATGAAGAGGG + Intergenic
1057977498 9:99621741-99621763 AGCTACAACCTGCATGAAGATGG - Intergenic
1058329850 9:103746394-103746416 AATTAGAAAATGGATGAAAATGG + Intergenic
1059664716 9:116435665-116435687 GTTTAGAAACAGAATGAAGAAGG - Intronic
1059667549 9:116463076-116463098 ACTTGGAAACTGATTGAATATGG - Intronic
1059701560 9:116779824-116779846 ATTTAAAAAATGAATGAAAATGG - Intronic
1059827162 9:118044063-118044085 ACTTAGAAATTGACTGAAAATGG - Intergenic
1059896461 9:118871634-118871656 AGTCAGAAACTGAATTATAATGG - Intergenic
1185470553 X:379634-379656 AGATAGAAACTTAATCAAGGAGG + Intronic
1186378152 X:9030371-9030393 AGTTAGATAGTAAATGAAAATGG + Intronic
1186958058 X:14704317-14704339 AGCTAGATAGTGAAAGAAGAAGG - Intronic
1186969559 X:14826011-14826033 GTTTTGAAACTGAATGAAGTAGG - Intergenic
1187019761 X:15368792-15368814 AGGAAGAAAGTGAATGAAGCAGG + Intronic
1187318238 X:18218560-18218582 ACTTAGAAATTGTTTGAAGATGG + Intronic
1187343612 X:18443135-18443157 AGGAAGAAACTGAACCAAGAAGG - Intronic
1187625663 X:21110256-21110278 AGTTAGAAACTGACTTGACAAGG - Intergenic
1187638320 X:21258842-21258864 ATTGTGAAACTGAAGGAAGATGG + Intergenic
1188453442 X:30334743-30334765 AGTGAGAAAGTGAAGGGAGAAGG + Intergenic
1189824532 X:44904051-44904073 ATGTAGAAACTGAAAGCAGAAGG + Intronic
1189862163 X:45284020-45284042 CTTTAAAAACTGTATGAAGAGGG + Intergenic
1189878907 X:45468710-45468732 AGTCAAAAACAAAATGAAGATGG - Intergenic
1190177632 X:48164759-48164781 TGTGAAAAACTGGATGAAGAAGG + Intergenic
1190365146 X:49685947-49685969 AGAAAGAAACTGAAAGAAAAAGG + Intergenic
1190666236 X:52698195-52698217 TGTGAAAAACTGGATGAAGAAGG - Intronic
1190673182 X:52760215-52760237 TGTGAAAAACTGGATGAAGAAGG + Intronic
1191011861 X:55768688-55768710 AGTTAGCAACTTAATAATGATGG - Intergenic
1191660125 X:63641053-63641075 GGTTTGAAACTAAATGAAGCTGG + Intronic
1192015980 X:67331620-67331642 AATTACAAAATGAATGAAGGTGG + Intergenic
1192382013 X:70626799-70626821 AGTAAGAAAGTGAATGACTACGG - Intronic
1193174491 X:78376440-78376462 AATTGGAAGCTGAATGAATAAGG - Intergenic
1194053132 X:89097335-89097357 AGTTACAAACTGAAGCATGAAGG - Intergenic
1195646803 X:107240455-107240477 AGTTAGAAACTAAAGAAAGTAGG - Intronic
1196392787 X:115226162-115226184 AGTGAGAAAGTGAATAAAGATGG + Intronic
1196552039 X:117040188-117040210 AGTTAGTATATGAATGAAGAAGG - Intergenic
1197610207 X:128629833-128629855 AGTTTGAAACCTACTGAAGATGG + Intergenic
1197851511 X:130866096-130866118 TGTTAGAAAATGAAAGAACAGGG - Intronic
1197859658 X:130956800-130956822 TGAGAGAAAATGAATGAAGAGGG + Intergenic
1200312432 X:155091605-155091627 AATTAGACAATGAATGAACATGG - Intronic
1200947066 Y:8853423-8853445 AATTAGAAAATGAAAGAAAAAGG + Intergenic
1202065720 Y:20937717-20937739 AGTTAGAAAATCAATGAAAATGG - Intergenic