ID: 1107028079

View in Genome Browser
Species Human (GRCh38)
Location 13:35823997-35824019
Sequence AAGGTAAGGCTGCTACACAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 105
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 100}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107028079 Original CRISPR AAGGTAAGGCTGCTACACAC AGG Intronic
900866850 1:5275094-5275116 AAGGTATGGCTGATACCCTCGGG + Intergenic
905942343 1:41874073-41874095 AAGGGAAGTCTGCTCTACACAGG - Intronic
911190621 1:94945033-94945055 AAGGTGAGACTGCCACACAGCGG + Intergenic
913165213 1:116178724-116178746 AAGGTAGGTCTGCAACAAACAGG + Intergenic
917090092 1:171344040-171344062 AAGGTGCAGCTGCTACACAGGGG - Intergenic
922612446 1:226940397-226940419 CAGGTAAGGCTGCCACCCGCCGG + Intronic
1064243905 10:13654501-13654523 GAGGTAAGGCAGCTACATGCAGG + Exonic
1071149909 10:82621742-82621764 AAGGTCAGGCAGCTACTAACTGG + Intronic
1076238342 10:128883179-128883201 GAGGTCAGCCTGATACACACGGG + Intergenic
1077403977 11:2374562-2374584 AGGGGAAGACTCCTACACACAGG + Intergenic
1079746962 11:24145209-24145231 AAAGTAAAGCAACTACACACAGG - Intergenic
1080398496 11:31912236-31912258 AAGGTAGGGCTCCTCCAGACAGG - Intronic
1087373097 11:97309464-97309486 AAGGAACGGCTGCGACATACAGG - Intergenic
1088360011 11:108979713-108979735 AAGGTAAAGCTGCTTATCACAGG + Intergenic
1092053631 12:5491118-5491140 AAGGTCAGACTGCTAAACAATGG - Intronic
1095472414 12:42551342-42551364 AAAATAACTCTGCTACACACAGG - Intronic
1096181711 12:49554763-49554785 AGGGTAAGGCTGCCTCAGACAGG - Intronic
1106483148 13:30151631-30151653 AAGGTCAGGCAGCTATAAACTGG - Intergenic
1107028079 13:35823997-35824019 AAGGTAAGGCTGCTACACACAGG + Intronic
1113575261 13:111390681-111390703 AAGGGCAGGCTGCTTGACACAGG + Intergenic
1113648610 13:112016268-112016290 AAGGGAACCCTGGTACACACTGG - Intergenic
1115374902 14:32663784-32663806 GAGGTATGTCTGCAACACACTGG + Intronic
1117735222 14:58762125-58762147 AAGGTAAGGCTGATAAACCAGGG + Intergenic
1127812028 15:62573074-62573096 AAGGGAAGGCTTTTACAGACAGG - Intronic
1130103282 15:80910321-80910343 ACGGTAGGCCTGCTGCACACTGG - Intronic
1135003833 16:18801252-18801274 AAGGTAAGGGTTCGACACCCAGG + Intronic
1135094030 16:19548012-19548034 AGGGTAAGAATGCCACACACGGG + Exonic
1149972137 17:61229541-61229563 AAGGACAGGCTGATACACAATGG + Intronic
1150912502 17:69403128-69403150 AAGGTAAGGCTGCCAGAAAGGGG + Intergenic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1153084655 18:1270809-1270831 AAGTTGAGGCTGCTTCACACTGG - Intergenic
1155506542 18:26538926-26538948 AACGGAAGCCTGCCACACACCGG + Intronic
1157609003 18:48944384-48944406 AAGGTAAGCCAGCTCCACACAGG + Intronic
1158532803 18:58278644-58278666 GAGGGAAGGCTCCTGCACACAGG - Intronic
1159922936 18:74242612-74242634 AAGGAAAGGCTGTTAGGCACTGG + Intergenic
1160540765 18:79621140-79621162 AAAGTTAGGCTGCTACAACCTGG + Intergenic
1160693003 19:468693-468715 CCGGTCACGCTGCTACACACAGG - Intronic
1166010874 19:39941711-39941733 AAGGGTAGGCTGCTCCCCACAGG + Intergenic
1168186560 19:54704072-54704094 AAGGTAAGGCCCCTGGACACTGG + Intergenic
925677282 2:6377007-6377029 AAGATAAGGCAGCTATACATTGG + Intergenic
933006418 2:77001259-77001281 AAGGTAAGCCTGGGGCACACTGG - Intronic
933287606 2:80401223-80401245 AAAGTAAGCCTGCACCACACAGG + Intronic
934588971 2:95529379-95529401 TGGGTAAGGCTGGAACACACTGG - Intergenic
935802002 2:106707183-106707205 ACGGGAAGGCAGCTGCACACAGG - Intergenic
937077693 2:119118761-119118783 AAATTATGGCTGCTTCACACAGG + Intergenic
937345803 2:121124584-121124606 CAGGTAAGGCTGATGCCCACAGG + Intergenic
938132109 2:128725396-128725418 AAGGAAGGCCTCCTACACACAGG + Intergenic
940359513 2:152782342-152782364 AAGGGAACTCTGTTACACACAGG + Intergenic
940364072 2:152826533-152826555 AAGGCAAGTCTGATACACACCGG + Intergenic
948937763 2:241178791-241178813 ATGGTGAGGCTGCCAGACACAGG - Intronic
1170929445 20:20755616-20755638 AAGGTATGGCTGGGGCACACTGG - Intergenic
1172857124 20:38013813-38013835 AGGGGAAGGCTGCTGCACAATGG - Exonic
1173531892 20:43776078-43776100 CAGGCAAGGGTGCCACACACAGG + Intergenic
1176690235 21:9898246-9898268 AAGATCAGGCTGCTGCACTCTGG + Intergenic
1176874593 21:14115666-14115688 AAGGGAAGGCTCCAAGACACGGG - Intronic
1179795745 21:43782086-43782108 AACCTAAGGATGCTGCACACAGG + Intergenic
1184779461 22:46639651-46639673 ACGGTAATACTGCTGCACACGGG - Intronic
950900354 3:16492059-16492081 AAGGAATGGCAACTACACACAGG + Intronic
955146415 3:56324608-56324630 AAGGTCAGGCTGCTTCAAAACGG + Intronic
955790627 3:62585426-62585448 CAGGTATGGCTGCTCCACAGTGG - Intronic
959779824 3:110217185-110217207 TAGGTAAATCTGCTACTCACAGG - Intergenic
959914667 3:111803312-111803334 AATGTAAGGTTGCTACTAACAGG + Intronic
963849745 3:150199250-150199272 AAAGTAAGCCTGCTTCATACAGG - Intergenic
984408280 4:179363224-179363246 AAGGTAATGCTGCTTCAAAGAGG - Intergenic
984609511 4:181821555-181821577 ACAGCAAGGCTGCTACAAACAGG - Intergenic
987690534 5:21260798-21260820 AATGTCATGCTCCTACACACAGG - Intergenic
990206650 5:53436915-53436937 AAGGTTAAAATGCTACACACTGG + Intergenic
991466803 5:66922019-66922041 ATGTTAAGCCTCCTACACACAGG + Intronic
995206393 5:109486119-109486141 ATGTGAAAGCTGCTACACACGGG - Intergenic
995401010 5:111741671-111741693 AAGGTAAGCCTGCAGAACACTGG + Intronic
996708288 5:126519119-126519141 AAGGTAAGGCTGCTATTAAGGGG + Intergenic
997487868 5:134246903-134246925 CAGGTATGGCTGCAGCACACTGG + Intergenic
999282208 5:150373418-150373440 AAGTGCAGGCTGCTCCACACAGG - Intronic
1005496032 6:26388625-26388647 AAGGGATGGCTGCAACATACAGG - Intronic
1008154731 6:48000032-48000054 GAGGTAAGGCTGTTACAAATAGG + Intronic
1014059108 6:117050401-117050423 GAGGTAGGGCTGCTGCACAGTGG - Intergenic
1016121230 6:140343852-140343874 AAGGTAAAGTTTCTACGCACAGG - Intergenic
1017467638 6:154709321-154709343 AAGGCAGGACTGCTTCACACTGG - Intergenic
1018940642 6:168307392-168307414 AAGAGAAGCCTGCTGCACACAGG - Exonic
1020736141 7:11950863-11950885 TACATGAGGCTGCTACACACTGG - Intergenic
1021871364 7:25009453-25009475 AAGGAAAGGCAGTTACACAAGGG + Intergenic
1022341599 7:29473517-29473539 CAGGCAAGGCTGCGACCCACAGG + Intronic
1023495101 7:40787158-40787180 AGGGTTAGTGTGCTACACACTGG - Intronic
1023737858 7:43250596-43250618 AAGGCAGGGCAGGTACACACAGG - Intronic
1024608736 7:51045279-51045301 AAGGTAATGCTGCTGCCCACAGG + Intronic
1027919314 7:84372195-84372217 AAGATAAGGCAGCTAAACAGAGG - Intronic
1028933846 7:96443636-96443658 AAGGTGAGGGTGCTACATCCAGG + Intergenic
1034753982 7:153597136-153597158 AAGGGAAGGCTGCAAGAAACAGG - Intergenic
1035249275 7:157586544-157586566 AAGGAGAGGCTGCCAGACACCGG + Intronic
1036999897 8:13705630-13705652 AAAGCAAGGCTGTTAAACACTGG - Intergenic
1037614752 8:20508664-20508686 AATGTCAGGGTGCCACACACAGG + Intergenic
1038411482 8:27362672-27362694 AAGGGGAGGCTGCTACAAAGGGG - Intronic
1039977150 8:42376915-42376937 AAGGTAAGGCTGCTAGGGAGGGG - Exonic
1041420189 8:57659367-57659389 AAAGTATGGCTGATACACAGGGG - Intergenic
1042914696 8:73864023-73864045 AAGGTAATGTTGCTACATCCAGG - Intronic
1046036752 8:108852123-108852145 AAGGTAAGCCTCCTTCTCACAGG - Intergenic
1047022362 8:120788242-120788264 AACAAAAGGCTGCTACACATTGG + Intronic
1055994424 9:82141837-82141859 AGTGGAAGGCTGCTTCACACAGG - Intergenic
1056296417 9:85197842-85197864 AAGGCAAGGCTTCTTCACATAGG + Intergenic
1057230126 9:93316990-93317012 AAGGCAAGGCTGCTGGCCACGGG - Intronic
1187080162 X:15977484-15977506 AGGGAAAGGCTTCTAAACACTGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1194647615 X:96477077-96477099 AAGGTACTTCTGCTGCACACTGG - Intergenic
1196047726 X:111273836-111273858 AAGGTAAGGCAGGAACACTCTGG - Intergenic
1197022365 X:121706543-121706565 ATGGAAAGACTCCTACACACAGG - Intergenic