ID: 1107028482

View in Genome Browser
Species Human (GRCh38)
Location 13:35826994-35827016
Sequence GAAAATGTCAAATGTATGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 391
Summary {0: 1, 1: 1, 2: 2, 3: 29, 4: 358}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107028478_1107028482 2 Left 1107028478 13:35826969-35826991 CCATTTTTTAAAACTTCTACTTC 0: 1
1: 0
2: 10
3: 108
4: 776
Right 1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG 0: 1
1: 1
2: 2
3: 29
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107028482 Original CRISPR GAAAATGTCAAATGTATGGA AGG Intronic
901832468 1:11901262-11901284 CAAAATGTCAAATATATTTACGG + Intergenic
902052313 1:13573832-13573854 GAAAATATCAAATGTAGGGCTGG - Intergenic
902067036 1:13697110-13697132 GAAAAGGTGAAATGTATTGCAGG - Intergenic
903360898 1:22776327-22776349 GAAAATGCCAAATTTAGGGATGG - Intronic
905118883 1:35666381-35666403 GAAGATGGCAAGTGGATGGACGG - Intergenic
905804158 1:40863816-40863838 GAGAGTGTCAAATGCGTGGAGGG - Intergenic
906055150 1:42910134-42910156 TAAACTGTCAAAGGTATGGTGGG - Intergenic
906948013 1:50312057-50312079 GAAGATGCCAAATTAATGGAAGG - Intergenic
907815107 1:57911050-57911072 CAAAATGTCTGTTGTATGGATGG - Intronic
908700546 1:66895179-66895201 TAAAATGTCTAATTTTTGGATGG + Intronic
909664592 1:78119146-78119168 GAATATGTGAAATGTACAGATGG - Intronic
910370568 1:86511488-86511510 GAAAATGTTCTATATATGGATGG + Intergenic
911413340 1:97539287-97539309 GAAAATGCAAAGTGTAAGGAAGG - Intronic
911484126 1:98484301-98484323 AAAAATGGCAAAGGGATGGATGG - Intergenic
911663608 1:100530548-100530570 GAAATTGCCAAATGTATGCTTGG + Intergenic
915950852 1:160189083-160189105 GAAAATCTCAAAAGCATGGCAGG - Intergenic
916744420 1:167673763-167673785 CAAAGTGTCAAAAGCATGGAAGG - Intronic
917169510 1:172155185-172155207 GAAAATCACAATTGTATGGTTGG - Intronic
917715729 1:177735187-177735209 GCAAATGAAAAATGAATGGAAGG + Intergenic
917945094 1:179961480-179961502 GCAAATATCAAGTGTATTGAAGG - Intronic
918386975 1:184018864-184018886 AAAAATGCCAAATGCAGGGAAGG + Intronic
918405936 1:184212141-184212163 GAAAATGATAAATGTATAGTGGG - Intergenic
919504561 1:198383213-198383235 GGAATGATCAAATGTATGGATGG - Intergenic
921359515 1:214317684-214317706 GAAAGTGTAAAATGGATGGGGGG + Intronic
921555826 1:216597718-216597740 CAAAATGTGAAATGTATGAAGGG + Intronic
1063547550 10:6997220-6997242 GAAAATATAAATTGTTTGGATGG + Intergenic
1064516743 10:16157734-16157756 GAAAATATCAAGTGTTTGCAAGG + Intergenic
1065366857 10:24945277-24945299 AAAAATGTTAAATGAATGAATGG + Intronic
1065391937 10:25191753-25191775 GCAAATTTAAAATGTCTGGAAGG + Intronic
1065410310 10:25419632-25419654 GAAAATGACAAATGTAGGTTAGG - Intronic
1065559825 10:26951446-26951468 GAAAATTTCAAATCTATATAAGG - Intergenic
1065999383 10:31090205-31090227 GAAAATCACAAAAGTATGAAAGG - Intergenic
1066525209 10:36271327-36271349 GACAATATCAAATGTGGGGAAGG + Intergenic
1067341154 10:45405316-45405338 GGTACTGACAAATGTATGGATGG - Intronic
1067927164 10:50521303-50521325 AAAAAAGTCAAATGAATGAATGG - Intronic
1068396565 10:56469637-56469659 TAAAATGTTAAATGAATGTAAGG - Intergenic
1068523183 10:58100029-58100051 CAAAATGTCAAATGAGTAGAAGG + Intergenic
1069020769 10:63485970-63485992 GAAGATATTAAATGGATGGATGG + Intergenic
1069170469 10:65222123-65222145 GAAAATGTCTAAAGTAAGGGAGG + Intergenic
1069341807 10:67418713-67418735 GAAAATTTCAATTAGATGGAAGG + Intronic
1071368198 10:84923069-84923091 GAAATTCTCAGAGGTATGGATGG + Intergenic
1071824370 10:89310046-89310068 GAGAATGTGAAATGTATTGAAGG - Intronic
1071832706 10:89387753-89387775 GAAAATATAAAATAAATGGATGG + Intronic
1072644499 10:97242052-97242074 TAAAAAATAAAATGTATGGAAGG + Intronic
1073524991 10:104172185-104172207 GCAAATGTCAGATGTCTGGCTGG + Intronic
1074977034 10:118589410-118589432 GGAAATGTAAAATATTTGGATGG - Intergenic
1076588025 10:131562984-131563006 AAATAAGACAAATGTATGGAAGG - Intergenic
1077768350 11:5186970-5186992 GAAAATCACAGATATATGGAAGG - Intergenic
1078439091 11:11349440-11349462 GACAATGTCAAATGTTGGCAAGG - Intronic
1078738456 11:14043642-14043664 GAAAATGTCAGATCTATGTGAGG + Intronic
1079358707 11:19752438-19752460 GAAAATGTCAACCATAGGGATGG + Intronic
1079371236 11:19854621-19854643 AAAAACGTCAAATGTGTGCAGGG - Intronic
1081082887 11:38765515-38765537 GAAATTGTTAAATGTATGGTAGG + Intergenic
1082612473 11:55318232-55318254 GAAATTATGAAATGTATGAATGG + Intergenic
1082624475 11:55466451-55466473 GAAGTTATAAAATGTATGGATGG + Intergenic
1086332133 11:85764616-85764638 GACAAAGTCAAATGTACAGAGGG - Intronic
1086523011 11:87692855-87692877 GAAAATGTGATATGTATACATGG - Intergenic
1086581152 11:88400408-88400430 GAAAATGACATATGTATATATGG - Intergenic
1087711651 11:101560506-101560528 AAAAATGTTCAATGCATGGAAGG - Intronic
1087866546 11:103234773-103234795 GCAAATGTCTAATGTATAGTTGG - Intronic
1087883427 11:103447223-103447245 AAAAATACCAAATCTATGGATGG + Intronic
1088548812 11:110989354-110989376 TAGAATGTAAAATATATGGAGGG - Intergenic
1089230130 11:116966701-116966723 AAAAATGTCAAAGTTATGGTGGG + Intronic
1093294824 12:17376292-17376314 GTAAATGTCAAATTTAAGTAAGG - Intergenic
1093523291 12:20075711-20075733 GAGTATGTAAAATGTATAGAAGG + Intergenic
1095624646 12:44300403-44300425 GAAAATGTCTAACAAATGGATGG - Intronic
1098409318 12:70163355-70163377 GAAATTGATAAATGCATGGATGG + Intergenic
1098853151 12:75621786-75621808 GAAAATGCCAGATGTTTGCAAGG + Intergenic
1099001900 12:77188048-77188070 GAAAATGTTAATTTCATGGAAGG - Intergenic
1099175610 12:79418310-79418332 AAAAATGTCCACTGGATGGAAGG + Intronic
1099214167 12:79834016-79834038 GTATATATTAAATGTATGGATGG - Intronic
1099937525 12:89145389-89145411 GAAAAAGACAAATGAAAGGAGGG + Intergenic
1100313605 12:93421510-93421532 GTAAATGTCTAATGTTTGGCAGG + Intronic
1100508206 12:95241642-95241664 GAAATTGCCAAATGTGGGGAGGG + Intronic
1102043029 12:109812804-109812826 GAAAATGGTAGATGAATGGAAGG + Intronic
1102405254 12:112667915-112667937 TAAAATGTTGAATGAATGGATGG + Intronic
1102632953 12:114298157-114298179 GTAAGAGTCCAATGTATGGAAGG - Intergenic
1102661020 12:114528629-114528651 GCAAATCTCAAATGTAAGAAGGG - Intergenic
1107028482 13:35826994-35827016 GAAAATGTCAAATGTATGGAAGG + Intronic
1107629168 13:42325947-42325969 GAGAATGTCAAATCTGTGGCTGG - Intergenic
1108142728 13:47442338-47442360 GTGTATATCAAATGTATGGATGG + Intergenic
1108703413 13:52963150-52963172 GGACTTGTCAAATGAATGGATGG - Intergenic
1108740657 13:53334522-53334544 AAAAATCTCAAATGTAAAGAAGG + Intergenic
1109582205 13:64355481-64355503 GGAAATATGTAATGTATGGAGGG - Intergenic
1110127745 13:71968023-71968045 GACAATGTCAGAGGTATTGAGGG + Intergenic
1110307913 13:74011700-74011722 GAGAATGTAAAGTGTATGGGAGG + Intronic
1111185918 13:84735604-84735626 GAAAATGCCAAATGTGGGCATGG - Intergenic
1112755116 13:102624196-102624218 GAAAATGTTAAATATATAGATGG + Intronic
1112845927 13:103643694-103643716 GAAAATAACAGATGTATGTAAGG - Intergenic
1114523932 14:23356388-23356410 GCAAATGTCGAATCTATGGCAGG + Exonic
1114895325 14:26982805-26982827 GAAAATTTAAAATACATGGAAGG + Intergenic
1116982888 14:51190054-51190076 GAAAATGTCAAATGTATAGTGGG + Intergenic
1117262776 14:54053740-54053762 GACAATGACAACTGTATTGAGGG + Intergenic
1119045129 14:71311981-71312003 GAAAAGGTCAAAAGTATTGGTGG + Intergenic
1120616361 14:86710214-86710236 GAAAATGTAAAATCTGTGGAAGG - Intergenic
1121383560 14:93495681-93495703 GAAAATGTCCATTGGATTGAAGG + Intronic
1121660352 14:95630723-95630745 GAAAATGTACAATGTATAGGTGG + Intergenic
1122046070 14:99024937-99024959 GAGAATGTGCAATGCATGGAGGG + Intergenic
1122416097 14:101550229-101550251 GCAGATGCCAAATGGATGGATGG + Intergenic
1125792077 15:42374519-42374541 GAAAAGGCCAAAGGTAGGGATGG + Intronic
1126320670 15:47419432-47419454 TAAAATCTCCAATGAATGGAGGG + Intronic
1131075995 15:89495328-89495350 GAGAATGTCTAAGGTGTGGAGGG + Intronic
1131534974 15:93229415-93229437 GAAAATGTGGAATTTCTGGAAGG - Intergenic
1133417606 16:5618707-5618729 GAGAATTTCAAAGGGATGGATGG - Intergenic
1134422492 16:14107423-14107445 GAAAATGACAGATGTGTGGTTGG - Intronic
1135479235 16:22807959-22807981 GAAAATGCTAGATGTAAGGATGG - Intergenic
1136646758 16:31626351-31626373 GATAATGTAAAATGTGTGAAGGG + Intergenic
1141250310 16:82350321-82350343 GAAAATGTCCAATCCATGAATGG - Intergenic
1143211176 17:5189041-5189063 AAAAATGTCAAATTTTTGGCTGG - Intronic
1143940680 17:10537977-10537999 TAAAAGGTGAAAAGTATGGAAGG + Intronic
1145180568 17:20747225-20747247 AAAAATGTCAAATGGATTGAAGG + Intergenic
1145199286 17:20927315-20927337 GAAAATACTAAATGTATGTAAGG - Intergenic
1146698235 17:34928842-34928864 AAAATTGTCAAGTGTATGAAAGG - Intronic
1146701571 17:34965179-34965201 GAAAATGTAAAATTTATCTATGG - Intronic
1146785253 17:35714511-35714533 CAAAATGCCAAATTTATGGAAGG + Intronic
1147847523 17:43415097-43415119 GAAAATGACGGATGCATGGAAGG + Intergenic
1148033181 17:44637128-44637150 GAAAATGTCAAACATTTGGTGGG - Intergenic
1149043605 17:52219320-52219342 GTAAATGTTAAATGGATGAATGG - Intergenic
1149274913 17:55023001-55023023 GAAAATTTCAAATGTATATCTGG + Intronic
1152488903 17:80615459-80615481 GAAATTGTCAAATATATGGAAGG + Intronic
1153295153 18:3538623-3538645 CAAAATGTCAACTGTTTGCAAGG - Intronic
1153621397 18:6981611-6981633 GAAAATGTATAATGTGTTGATGG - Intronic
1153739201 18:8105590-8105612 GAAAATGTGAAAAGTAGGGGAGG - Intronic
1154443119 18:14410628-14410650 GAAAATGTAAAATTTTAGGAAGG - Intergenic
1155727981 18:29113784-29113806 TAAAGTGTCAAATGAATTGAAGG + Intergenic
1156942230 18:42782168-42782190 CTAAATGTCAATTGAATGGATGG - Intronic
1157206505 18:45704693-45704715 TAACATGTAAAATGTTTGGATGG + Intergenic
1157997894 18:52581590-52581612 GAAAAAGTGACATGTATAGATGG - Intronic
1159294669 18:66469115-66469137 CAAAATGTCAATTTTATGGCAGG - Intergenic
1159443786 18:68514142-68514164 GAAAATAGCAAATGCATGAAGGG - Intergenic
1159893016 18:73970563-73970585 GAAGGTGTCAATTGTCTGGAAGG + Intergenic
1161776445 19:6264960-6264982 GAAACTGTCAAATAAATAGAAGG + Intronic
1166784452 19:45359291-45359313 GAGAATGACAAAGGTAGGGATGG + Intronic
1167189933 19:47978774-47978796 GAAAATGGAAAATATATGTATGG - Intronic
927140517 2:20127243-20127265 TAAAATATCATATGTCTGGAAGG - Intergenic
927379562 2:22463201-22463223 GGAAGTGTCACATGGATGGAGGG + Intergenic
929263986 2:39898220-39898242 GAAAATAGCAAATGTTTGCAAGG - Intergenic
929875639 2:45794377-45794399 GAAAATGGCAAATGCATTGACGG + Intronic
930258431 2:49118089-49118111 GAAAATGTTAATTTGATGGATGG + Intronic
931329060 2:61261015-61261037 GAAAATGTCAAGTGTTAGCAAGG + Intronic
931878556 2:66541462-66541484 GAAAATGACATAGGTGTGGAAGG - Intronic
932251195 2:70245577-70245599 GAAAATTTCAAATTTATATATGG + Intronic
932562509 2:72885943-72885965 ACAAATGTCAAATGAATGGATGG + Intergenic
932643412 2:73475378-73475400 GAAAATGACAAATGTTGGAAAGG - Intronic
935191015 2:100778960-100778982 GCAGATCTCAAATGTAGGGATGG + Intergenic
935470537 2:103454502-103454524 GAAAATGAAAAATGTAGGGCTGG - Intergenic
939386793 2:141510803-141510825 GTAAATGTATAATGTAAGGATGG - Intronic
941453711 2:165691469-165691491 GAAAATAACAAATGGACGGAAGG + Intergenic
941499893 2:166261131-166261153 GAAAATGTCAAAAGAATTGAAGG - Intronic
942381534 2:175396506-175396528 TTAAATGTCAAATGTCTGAATGG - Intergenic
942539485 2:177000998-177001020 GAAAATGTCAAAGTTAAGAAAGG + Intergenic
943665430 2:190603909-190603931 GAATATGGAAAATGTATGGATGG - Intergenic
944273534 2:197809238-197809260 GAAACTCTCTAAAGTATGGAAGG + Intronic
944852336 2:203732782-203732804 GAAAATGACAGATGCATGGCTGG - Intronic
944954752 2:204795771-204795793 GAAAATATCAAATGTAAAGTAGG - Intronic
945029079 2:205646995-205647017 GACAATGACAAAGGTATGCATGG - Intergenic
945541587 2:211094053-211094075 ATAAATGTCAAATGTGTGGCAGG + Intergenic
945752487 2:213805078-213805100 GAGATTGTCAAATGTATTTATGG + Intronic
945850201 2:214996821-214996843 GAAAAGGACAAGTGGATGGACGG + Intronic
945892215 2:215442135-215442157 GCAAATGTCAAATGAATGAATGG + Intergenic
945911721 2:215657449-215657471 ATAAATGTCAAATGAATGAATGG + Intergenic
945972821 2:216246867-216246889 GAGAATGTCATAGGCATGGAAGG - Intergenic
1169175633 20:3510106-3510128 TACAATGTCAAATATATTGAAGG - Intronic
1169282232 20:4277771-4277793 GAAACTTTCAAATGTTTTGAAGG - Intergenic
1169884145 20:10379437-10379459 GAAAATATCAAATATTGGGAAGG + Intergenic
1171323672 20:24270482-24270504 AACAATGTCAGAGGTATGGAAGG - Intergenic
1174270740 20:49366471-49366493 GAAAATTTCTATTGTATGAAAGG - Exonic
1174302465 20:49592517-49592539 GTAAATGTTACATGGATGGATGG - Intergenic
1174491592 20:50901653-50901675 GAAAAGCTTAAATGTAAGGAAGG + Intronic
1175636399 20:60587738-60587760 GAAAAAGTAGAAGGTATGGATGG + Intergenic
1176452974 21:6880571-6880593 GAAAATGTAAAATTTTAGGAAGG + Intergenic
1176720284 21:10387179-10387201 GAAAATGTGCCATGTATGCATGG + Intergenic
1176831147 21:13745619-13745641 GAAAATGTAAAATTTTAGGAAGG + Intergenic
1177934469 21:27326184-27326206 TAAAATGGCTAATGTATAGATGG + Intergenic
1178127754 21:29533884-29533906 AAAAGTGACAAATGTATGCAGGG - Intronic
1178207862 21:30490930-30490952 GAAAATGTCAAATAAATTAATGG + Intronic
1178286418 21:31329030-31329052 GATGATTTCAAATGTGTGGAAGG + Intronic
1179527598 21:41993011-41993033 GAAGATTTCAAATCTATGGAAGG + Exonic
1180845215 22:18977260-18977282 GAAAATATCAAGTGTTAGGAAGG + Intergenic
1203323872 22_KI270737v1_random:97795-97817 AAAAATGTGACATGTATAGATGG - Intergenic
951708548 3:25567759-25567781 GAAAAAGTCAAATCTAAGCAGGG - Intronic
951905962 3:27707803-27707825 AAAAATGTCAAAAGCATGGCCGG - Intergenic
952032282 3:29158182-29158204 AAAAATATAAAATGTGTGGAGGG - Intergenic
952109950 3:30110861-30110883 GAAAATGTCAATTATATCTAGGG + Intergenic
952360254 3:32624051-32624073 GAAAATGACAAATGTTGGTAAGG - Intergenic
952475434 3:33704886-33704908 GAAAATGTCAAATGTTGGTAAGG + Intronic
952746911 3:36790350-36790372 ACAAATGTCAAGGGTATGGAGGG - Intergenic
952978594 3:38717289-38717311 CAAAAGGTGAAATGTATGGAAGG + Intronic
953495125 3:43379381-43379403 GAAAATGGCAAATAGAAGGAAGG + Intronic
955125871 3:56111470-56111492 GATAATGTCAAAAGTATCAAAGG + Intronic
955505148 3:59625196-59625218 GAATATGTTCAATGCATGGAGGG + Intergenic
955997276 3:64689539-64689561 GGATATGTAAAATGTAAGGATGG + Intergenic
956871130 3:73419255-73419277 GATTATGTCAAATGTAAGGCTGG + Intronic
957206705 3:77207845-77207867 TAAAATGTCAGCTGCATGGAAGG - Intronic
957777379 3:84771036-84771058 TAAAATGTCAAGTGTTTGGCTGG + Intergenic
957807917 3:85175139-85175161 GAAAATAACAAGTGTATGTAAGG + Intronic
960199893 3:114819795-114819817 GAAAATGTTAAATATTTGTATGG - Intronic
961999885 3:131284863-131284885 CAAAATCTCAAAAGTAGGGAGGG - Intronic
963633437 3:147762986-147763008 AGAAATGTCAAATGTATGTGTGG - Intergenic
963822445 3:149912567-149912589 GAAAAAGTAAGATGTATTGATGG + Intronic
964377293 3:156060758-156060780 GAGAAGGTCAAATATAAGGAGGG + Intronic
965863025 3:173170014-173170036 GAAATTGACAAATGTGTGGGAGG + Intergenic
966265595 3:178038041-178038063 GAAAATGTCATGGGCATGGAAGG + Intergenic
966277877 3:178197602-178197624 GAAAATGTCACCTGGAGGGAAGG - Intergenic
966580832 3:181560718-181560740 GAAAATATCCAATGCAAGGAAGG + Intergenic
966699033 3:182824475-182824497 GAAAATGTCCAAAATATAGATGG - Intronic
966707248 3:182930019-182930041 GAAAATAACAAATGTTTGAAAGG + Intergenic
967778596 3:193411116-193411138 AAAAATGTCACATATATTGACGG + Intronic
970812773 4:20114710-20114732 GATAATTTCAAATGTATTCAGGG - Intergenic
971793089 4:31194403-31194425 GAAAATGTCAACTTTATTAATGG - Intergenic
971895523 4:32588714-32588736 GAAAAAGTCAAGTGTATAAATGG - Intergenic
972195746 4:36651695-36651717 GAAGATGTCTAAGGTAGGGAAGG + Intergenic
973259956 4:48153061-48153083 GAAAGGGTAAAATGTATAGAGGG - Intronic
974043367 4:56877106-56877128 AAAAATGATAAATGTTTGGATGG - Intergenic
974448237 4:62014452-62014474 AAAAATGTCAGAAGAATGGAAGG + Intronic
975107410 4:70583107-70583129 GAAAAAGCTAAATGTATGAAAGG - Intergenic
975380358 4:73693247-73693269 GAAAAAGAGAAATGTATGAAAGG + Intergenic
975949381 4:79749528-79749550 AAAAATGTAAAATGTTGGGAAGG + Intergenic
976826949 4:89271478-89271500 AAAAATGTAAAATACATGGAAGG - Intronic
977140948 4:93371490-93371512 GAAAATATCTAATGGATGAAGGG + Intronic
978225811 4:106333721-106333743 GAATATGTGAAAAGTATTGATGG + Intronic
978274365 4:106931444-106931466 TTAAGTGTCAAATGTATTGAAGG - Intronic
978536077 4:109765061-109765083 GAAAATGTAAAATGTAGAAAGGG + Intronic
979733288 4:124051626-124051648 CTAAATGTGAAATGTTTGGAGGG + Intergenic
980770928 4:137372124-137372146 GAAAATGGGAAAGGAATGGAAGG + Intergenic
980788549 4:137587530-137587552 AAAAATGTCAAATGTGTTCATGG + Intergenic
980818778 4:137984595-137984617 AAAAATGTCAAATTTTTGGAAGG - Intergenic
981209518 4:142086242-142086264 GAAAATGTGAAATATCTGAAGGG + Exonic
981789032 4:148515128-148515150 GAAAATGTCAAGTGAAATGAAGG - Intergenic
982166418 4:152617639-152617661 GATAAGGCCAAATGTATGGGTGG + Intergenic
984314521 4:178110086-178110108 TAACATGTCAAAAGTATGAAGGG - Intergenic
986309184 5:6539106-6539128 GAAGTTGTTAAATGAATGGAGGG + Intergenic
986618332 5:9643424-9643446 AAAAATGTCATATGTGTGTAGGG + Intronic
986913070 5:12581507-12581529 GAGAATGTAAAATGTGTAGATGG + Intergenic
988158228 5:27482831-27482853 CAAAATGGCAAATGCATAGAGGG + Intergenic
988164792 5:27573112-27573134 GAAGATGTCACATGTATCTATGG - Intergenic
988710076 5:33764416-33764438 GGAAATGTCAAATGGTTGAAAGG - Intronic
988752897 5:34209092-34209114 AAAAATGTCAATAGTATTGAAGG + Intergenic
988812875 5:34802523-34802545 GCTAATTTCAAATGTCTGGATGG - Intronic
988932646 5:36051754-36051776 GAAAGTGACGAATGGATGGATGG - Intronic
989034978 5:37161099-37161121 GAAACTGTCTAATGTATAGCTGG + Intronic
989376564 5:40769372-40769394 GACAATTTCAAATGTATTGAGGG + Intronic
989439438 5:41453203-41453225 AAAAATGTCAAAGTCATGGAAGG - Intronic
989500477 5:42160842-42160864 GAAAATATCAAATGTTTGTGAGG - Intergenic
989684763 5:44072617-44072639 CAAAATGTCAAGTGTATTGATGG - Intergenic
989836462 5:46000073-46000095 GAAAAAGCCACATGTTTGGAGGG - Intergenic
990180610 5:53156329-53156351 GAAAAGGTCAAATTTCTAGAAGG - Intergenic
990713425 5:58609285-58609307 TAAAATGTAAAAAGTATGAAGGG - Intronic
990811743 5:59733229-59733251 GAGAATTTCAAGTATATGGAAGG + Intronic
991714200 5:69436378-69436400 CTAAATGTCAAATTTATGTATGG + Intronic
991740671 5:69669906-69669928 AAAAATGTCAATAGTATTGAAGG + Intergenic
991756949 5:69884544-69884566 AAAAATGTCAATAGTATTGAAGG - Intergenic
991792245 5:70249647-70249669 AAAAATGTCAATAGTATTGAAGG + Intergenic
991820131 5:70546012-70546034 AAAAATGTCAATAGTATTGAAGG + Intergenic
991836352 5:70760426-70760448 AAAAATGTCAATAGTATTGAAGG - Intergenic
991884692 5:71249972-71249994 AAAAATGTCAATAGTATTGAAGG + Intergenic
992569076 5:78034541-78034563 GAAACTGTGAAATGTAATGATGG + Intronic
992745678 5:79818118-79818140 GATAATGTCAAATATTTGCAAGG + Intergenic
993499362 5:88647707-88647729 GACAATGTCAAACGTATGCAAGG - Intergenic
993786414 5:92143691-92143713 GAATATGACAAATGTATAAAAGG + Intergenic
993808760 5:92447016-92447038 GAAAATATCAAAAGTATGTTAGG - Intergenic
994214880 5:97126508-97126530 GAAAATGTTAAAAGTAGTGAGGG + Intronic
995647704 5:114331206-114331228 GAAAATGAAAAATGAATGAAAGG + Intergenic
996491416 5:124102303-124102325 GACAATATCAAATGTTGGGAGGG - Intergenic
996826975 5:127694566-127694588 TATAAAGTCAAATGTATGTATGG + Intergenic
996986169 5:129567461-129567483 GCATATTTCAAATGAATGGAAGG + Intronic
997012904 5:129900509-129900531 AAAAATGTCAATTGGATGTAAGG - Intergenic
997055048 5:130433232-130433254 GAAACGGTCAAATTTATAGAAGG + Intergenic
997083902 5:130773725-130773747 GAAAATGTTAATGGAATGGAAGG - Intergenic
997705274 5:135944800-135944822 ATAAATGTCAAATGGATGCAAGG + Intronic
998554714 5:143112115-143112137 GAAAATGTCAATTCCATGAATGG + Intronic
999391211 5:151193033-151193055 GATGATTTAAAATGTATGGAAGG + Intronic
999545244 5:152622018-152622040 AAATATGTCACATGTCTGGATGG - Intergenic
1000150772 5:158498472-158498494 GAAAATGTGAAAAGGAAGGAGGG - Intergenic
1000502797 5:162073135-162073157 CAAAATGTCGAATCTATAGAAGG + Intronic
1001621827 5:173093165-173093187 GGAAATGGCAAATGTGGGGAAGG + Intronic
1001883263 5:175264315-175264337 GAAAATTTCAAACTTATGCAAGG - Intergenic
1002022582 5:176373487-176373509 GTAAATGTCAAATGAAATGAAGG - Exonic
1003586695 6:7396176-7396198 GAAAATGTAAGAGGGATGGAGGG + Intronic
1005551061 6:26915871-26915893 AAAAATGTCAACAGTATTGAAGG + Intergenic
1005834901 6:29701596-29701618 GGAAATGCCAAATATATGGTGGG - Intergenic
1009920675 6:70055942-70055964 GAAAATTTGAAAAATATGGAAGG - Intronic
1010649697 6:78438146-78438168 GAAAATGTCAAATATATATCAGG + Intergenic
1010655205 6:78503610-78503632 GAAAATGTGAATTGTAATGATGG + Intergenic
1011416742 6:87129776-87129798 GAAAATGGCAAAAATATTGATGG - Intergenic
1011963098 6:93116236-93116258 GAAAATGTCATTTGCCTGGAAGG - Intergenic
1013702132 6:112784843-112784865 AAAAATTTCAAATTTATGAAAGG - Intergenic
1014141121 6:117943978-117944000 GAAAAGATCAGATCTATGGATGG - Intronic
1014338151 6:120165798-120165820 AAAAATGTGAATTATATGGATGG - Intergenic
1014618896 6:123640820-123640842 GACAATGTCAAATGTGTGTGAGG - Intergenic
1014631105 6:123790757-123790779 GAAAATGACAAATCTTAGGAAGG - Intergenic
1016210325 6:141524494-141524516 GAATATGTGGAATGCATGGAAGG + Intergenic
1016443593 6:144109702-144109724 GAAAATGTCAAAAGAATGGGTGG - Intergenic
1016685280 6:146874413-146874435 CAAAGTGTCAAATGAGTGGAAGG - Intergenic
1017362975 6:153598210-153598232 GAAAAGATCAAATGCATTGATGG - Intergenic
1017487273 6:154914874-154914896 GAAAATGTTAAATATGTCGAAGG - Intronic
1017975227 6:159351052-159351074 GTTAATGTCAAAAGTATGCATGG + Intergenic
1018492755 6:164312589-164312611 TAAAATGTAAAATGTTTGGCTGG + Intergenic
1018563542 6:165127830-165127852 TAAAATAACAAATGAATGGATGG + Intergenic
1018768231 6:166950852-166950874 TAAAATGTCCAATACATGGAGGG + Intronic
1021493432 7:21245892-21245914 GAAAAATACAGATGTATGGATGG + Intergenic
1022378574 7:29838585-29838607 GAAAATGACAAATGTTGGCAAGG + Intronic
1022607408 7:31829235-31829257 TAAAAACTAAAATGTATGGAAGG - Intronic
1023299248 7:38751570-38751592 GTAAATGTCTAATGTGTGGTGGG + Intronic
1024876597 7:54031805-54031827 GAAAATGTATAATGTATAAATGG - Intergenic
1025786826 7:64651522-64651544 CACAATGTAAAATGTATGCAGGG - Intergenic
1026814092 7:73495475-73495497 GAAAAAGTCAAAGGAATGGCAGG + Intronic
1027410708 7:77914761-77914783 GAAAATGTCAAATTTCTGGTAGG - Intronic
1027675326 7:81150508-81150530 AATAATGTCAAATATATGAATGG - Intergenic
1027694629 7:81394897-81394919 GAAAATAGAAAATATATGGAAGG + Intergenic
1029898879 7:104019140-104019162 GAAAATGTCCACACTATGGAAGG - Intergenic
1030356928 7:108553516-108553538 CAAAATTTCAAATCCATGGAAGG - Intronic
1030504769 7:110407573-110407595 GAAAATGAAAAATAAATGGAGGG + Intergenic
1030836068 7:114287393-114287415 AAATATGTTAAATGTATTGAAGG - Intronic
1030961011 7:115922996-115923018 CAAAATGTTAAATTTTTGGAGGG + Intergenic
1032406076 7:131656625-131656647 GAAAATTTCAAATGCAGAGAGGG + Intergenic
1032563870 7:132920215-132920237 GAAAATGAGTAATGAATGGATGG - Intronic
1032567820 7:132966296-132966318 GAAAATGTCCAATGTCTTTATGG + Intronic
1033004733 7:137549087-137549109 GAACAGGACAAATGAATGGATGG + Intronic
1033301087 7:140186343-140186365 AATAATGACAAATGAATGGATGG - Intergenic
1033629776 7:143146306-143146328 GAAAATTCAAAATGAATGGATGG + Intergenic
1033717717 7:144020099-144020121 GAATGTGTCAACTGTATGGTTGG - Intergenic
1035228677 7:157447982-157448004 GAAAATGACAAGTGTTTGCAAGG - Intergenic
1036628657 8:10494819-10494841 GAAGATTTAAAGTGTATGGAAGG + Intergenic
1036823838 8:11960850-11960872 AAAAATGGCAATTGTTTGGAAGG - Intergenic
1037561258 8:20076521-20076543 AAAAATATCAGATGTATGAAAGG + Intergenic
1037952147 8:23026229-23026251 GAAAATGTCAAATGTTTATATGG - Intronic
1038060612 8:23908044-23908066 GAAAATGTCACATGGAGGCATGG + Intergenic
1039248121 8:35632003-35632025 GACAATGTCAGATGCATGCACGG - Intronic
1042390231 8:68226091-68226113 GATAATGTCAACTTTATGGCTGG - Intronic
1042457046 8:69017627-69017649 AAAAATTTCAAATGTAGGGAAGG - Intergenic
1042512361 8:69625341-69625363 CAAAATGTCACATGGGTGGATGG - Intronic
1042545685 8:69949239-69949261 GAAAATGCAAAATTTATGCATGG + Intergenic
1042579864 8:70264650-70264672 GAAACTGTCATATCTATGTAAGG + Intronic
1043674151 8:82928804-82928826 AAAAGTGTCAAATCTCTGGAAGG + Intergenic
1043792665 8:84492816-84492838 GAAAATGTAAAATTTATTAAAGG - Intronic
1044171170 8:89053573-89053595 GAGAATTTCAAATGTAAGGTTGG + Intergenic
1044512714 8:93101262-93101284 GAAAATGACACATCCATGGAAGG - Intergenic
1044641511 8:94387217-94387239 GAAAATGCTAAAATTATGGAAGG + Intronic
1044672437 8:94696299-94696321 GAAAATGTAAAAGGCATTGATGG - Intronic
1044843443 8:96357783-96357805 GAAAATGTAAAATGTATTTGTGG - Intergenic
1045135353 8:99211126-99211148 GAAAATTTCACATTTAGGGACGG - Intronic
1045141446 8:99289153-99289175 GAAAATTTCAACTTTATCGAAGG - Intronic
1045184134 8:99818902-99818924 GAAAATGTAAAATGTATGGAAGG - Intronic
1045751842 8:105494555-105494577 GAAAATGTCAAGGATATAGATGG - Intronic
1046977028 8:120290992-120291014 GAGAATGTGAAAGCTATGGAAGG + Intronic
1047343798 8:124007743-124007765 AAAAATATCAGATGGATGGATGG + Intronic
1048607469 8:135984615-135984637 GAAAAGGCCAAGTGCATGGATGG + Intergenic
1050785116 9:9391114-9391136 AAAAATATGAAATGAATGGAGGG + Intronic
1050800190 9:9601398-9601420 GAAAATTACAAATGTTTAGAAGG + Intronic
1050932811 9:11350988-11351010 GAAAATGTCATAACTTTGGAGGG + Intergenic
1052617518 9:30860777-30860799 GAAATTGTGTAATGGATGGATGG + Intergenic
1055187991 9:73479601-73479623 AAAAATGTAAAATGTTTGGAAGG - Intergenic
1055740203 9:79380053-79380075 GAATATGTAACTTGTATGGAAGG - Intergenic
1056508354 9:87279167-87279189 AAAAATTTCAAATATTTGGAAGG + Intergenic
1057193790 9:93103382-93103404 GATAATTTAAAATATATGGAAGG - Intronic
1057398178 9:94699062-94699084 GAAAATGTAAAATTTAAGGAGGG + Intergenic
1059017568 9:110536388-110536410 GCAAATGAGAAATGTATGTAAGG + Intronic
1060609872 9:124953754-124953776 GGAAATTTTAAATGTATGGCAGG - Intronic
1061457573 9:130710248-130710270 GAAAATGACTAAAGTATGAATGG + Intergenic
1203516207 Un_GL000213v1:3944-3966 GAAAATGTAAAATTTTAGGAAGG - Intergenic
1186846279 X:13534154-13534176 GAAAATGGTAAATTTCTGGAAGG - Intergenic
1186998291 X:15148033-15148055 AGAAATGTCAAATGTAGGAAAGG + Intergenic
1187708380 X:22029727-22029749 GAAAATCACAAATGGATAGATGG - Intergenic
1188086239 X:25905201-25905223 CAAAGTGTTAAATGTAGGGATGG - Intergenic
1188169594 X:26908249-26908271 GAAATTGTCAAATTTATTGAAGG - Intergenic
1188542326 X:31264792-31264814 GAAAATTTAAATTGTATGGTAGG - Intronic
1188605054 X:32017973-32017995 TAAATTGTCAAATGGATGCATGG - Intronic
1189181365 X:39007820-39007842 CAAGATCTCAAATGAATGGAAGG - Intergenic
1189568233 X:42266216-42266238 TAAAATGGCAAATGTATCCATGG - Intergenic
1189954990 X:46268789-46268811 AAAGATGTCAACTGTATGGTAGG - Intergenic
1191666119 X:63704565-63704587 GAAAAAGACATATGGATGGATGG + Intronic
1193137320 X:77986227-77986249 GAAAATGTGAAATGTACCCATGG - Intronic
1193826838 X:86236707-86236729 GAAAATGGCACATGTATATAGGG + Intronic
1193955524 X:87856218-87856240 GAAAATGTCTAATGTCAGCAAGG - Intergenic
1194295146 X:92118019-92118041 ATAAATGTCAAATGTATTTATGG + Intronic
1194740048 X:97561835-97561857 GAAAATGTAAAATGAAAAGAAGG + Intronic
1194842159 X:98755935-98755957 AAAAATGTCAAATGGATTGGTGG - Intergenic
1194865920 X:99066697-99066719 TAAAATATCAAATGCATAGAAGG + Intergenic
1194928216 X:99853957-99853979 GAACATCTAAAATTTATGGAAGG - Intergenic
1197163231 X:123346889-123346911 TAAAATCTCAAGTGGATGGAAGG - Intronic
1197596922 X:128475716-128475738 GCAAAGGTGAAATGTATAGAAGG - Intergenic
1198185271 X:134248514-134248536 GAAAACCTTAAATGTATGGTTGG - Intergenic
1198606741 X:138348069-138348091 GGAAATGTCAGATATGTGGAGGG + Intergenic
1198726157 X:139679336-139679358 GAAGATGTGAAATGTAAGGAAGG + Intronic
1199382091 X:147182862-147182884 GAAAATAAAAAATGTCTGGAGGG - Intergenic
1200612646 Y:5342543-5342565 ATAAATGTCAAATGTATTTATGG + Intronic
1200690146 Y:6299422-6299444 GAAAATGTAAAATCTGTGAAAGG - Intergenic
1201045127 Y:9875294-9875316 GAAAATGTAAAATCTGTGAAAGG + Intergenic
1201917342 Y:19196336-19196358 GAAAAGGATAAATGGATGGATGG + Intergenic
1201989973 Y:20012966-20012988 GAAAATGTCATATTTTAGGATGG - Intergenic