ID: 1107031092

View in Genome Browser
Species Human (GRCh38)
Location 13:35854442-35854464
Sequence GTCTCAGCCTTGGTGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107031092_1107031095 27 Left 1107031092 13:35854442-35854464 CCTGTCTGCACCAAGGCTGAGAC 0: 1
1: 1
2: 2
3: 13
4: 143
Right 1107031095 13:35854492-35854514 TCCTTACCCTCTGCTTCCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107031092 Original CRISPR GTCTCAGCCTTGGTGCAGAC AGG (reversed) Intronic
900138005 1:1126687-1126709 TTCTCTGCCTTGGGGGAGACGGG + Intergenic
900925810 1:5705493-5705515 GCCACAGCCTGGGTGCAGACTGG - Intergenic
901429427 1:9203901-9203923 ACCTCAGCCTGGGTGCAGCCAGG - Intergenic
906626868 1:47332822-47332844 AACTGAGCCTTGGTGCATACAGG - Intergenic
917630256 1:176884483-176884505 GTCTCAGCCTGTGTGCAGACAGG + Exonic
918292536 1:183122654-183122676 GTCTCAGTCAGGGTGCAGAAAGG - Intronic
918326865 1:183418257-183418279 GTCTCGGTCATGGTGCAGATGGG + Exonic
920585654 1:207157575-207157597 GTCTCAGCCTGGGTCCAATCAGG + Intergenic
920915310 1:210253781-210253803 GTCTCAGCTTTTCTGCAGAGGGG + Intergenic
921702389 1:218283426-218283448 ATCTCAGCCTTGGAGAAGCCAGG + Intergenic
1064730761 10:18328367-18328389 TTCTCAGCCTTGCTGCAAAGTGG - Intronic
1065045948 10:21747754-21747776 GCCTTTGCCTGGGTGCAGACTGG + Intergenic
1065973652 10:30824236-30824258 CCCTCAGCCTTGCTGCACACGGG - Intronic
1068528887 10:58162699-58162721 GTCTCAGCCTGGGTCCAGTCAGG - Intergenic
1068550005 10:58396910-58396932 TTCTCACTCTGGGTGCAGACAGG + Exonic
1071495558 10:86165391-86165413 CTCTCTGCCTTGGTCTAGACTGG - Intronic
1073474290 10:103742774-103742796 GTCTCAGCCTGAGAGGAGACAGG + Intronic
1074158085 10:110815610-110815632 CTCTCAGCCTTGGGGGAGAGAGG - Intronic
1076808064 10:132869214-132869236 GTCTCGCCCTTGGTGCGGCCAGG - Intronic
1078366683 11:10712366-10712388 GTCACAGCCTGGGATCAGACAGG - Intergenic
1078406997 11:11079145-11079167 GCCCCAGCCTAGGTACAGACAGG + Intergenic
1083635351 11:64117831-64117853 GTCTCTGCCTTGGCACACACGGG - Exonic
1083901158 11:65644218-65644240 GTGTCATCCTTGCTGCAGCCAGG + Intronic
1089205708 11:116760800-116760822 GTCTCCTCCTTGGTGGAGAGAGG + Exonic
1089619364 11:119713634-119713656 CTCTCAGCCTTGGGGGTGACAGG + Intronic
1090441019 11:126725755-126725777 GGCCCTGCCTTTGTGCAGACTGG - Intronic
1090512747 11:127393035-127393057 GTCTCAGCTCTGGAGAAGACTGG + Intergenic
1092231561 12:6778442-6778464 GACTCAGGCTTGCTGCTGACAGG - Exonic
1093576013 12:20730835-20730857 GTCTCAGCCGTTGTGCAGCTGGG - Intronic
1096475852 12:51908247-51908269 GTCCCAGCCTGGGGGGAGACTGG - Intronic
1099480419 12:83158756-83158778 GTGTCAGAGTTGGTGCAGAATGG - Intergenic
1101547538 12:105730587-105730609 GTGTCAGCCTTGGTCCAAGCAGG - Intergenic
1101788772 12:107910125-107910147 GTCTCTGACTTGGAGTAGACTGG - Intergenic
1103536836 12:121639052-121639074 GGCCCAGCCCTGGTGCAGGCTGG - Intronic
1107031092 13:35854442-35854464 GTCTCAGCCTTGGTGCAGACAGG - Intronic
1110050507 13:70891414-70891436 GTCTCAGTATTAGTTCAGACTGG - Intergenic
1113553722 13:111214299-111214321 GCCTCAGCCCTGGTGCTGGCTGG + Intronic
1118752107 14:68815066-68815088 TTCACAGCCTTGGAGAAGACTGG - Intergenic
1119873421 14:78036083-78036105 GTCTGGGCCTGGGTGCTGACTGG - Intergenic
1120177115 14:81306342-81306364 GTCTCAGCCTCTGAGCAGATGGG + Intronic
1120758285 14:88264421-88264443 GTCTCTGTCATGGTGCAGGCTGG + Intronic
1120832100 14:89006586-89006608 GTCTGAGCCTGGATCCAGACTGG + Intergenic
1125032722 15:35088711-35088733 GTCTCAGCCTGACTGCACACAGG - Intergenic
1125513245 15:40303916-40303938 GCCTCCACCTTGGTGCAGCCAGG + Intronic
1126881181 15:53099916-53099938 TTTTAAGCCTTGGTGAAGACTGG + Intergenic
1128568108 15:68714519-68714541 GTCTCAGCCTCTCTGCAGGCAGG - Intronic
1129894653 15:79094401-79094423 GTCTCAGCCCTGGTGCACTTTGG + Intergenic
1130205006 15:81867680-81867702 GTGTCTGCCATGGTGCAGAGAGG + Intergenic
1131149347 15:90037133-90037155 GTCTCAATCCTGGTGCACACTGG + Intronic
1135640278 16:24113821-24113843 GTCTAAGCCTGAATGCAGACAGG - Intronic
1137339339 16:47584592-47584614 ACCACAGCCTTGGTGCAGAAGGG + Intronic
1137900616 16:52264000-52264022 ATTGCAGCCTTGATGCAGACTGG + Intergenic
1138578691 16:57925561-57925583 TCCTCAGCCTTGGTGAACACAGG + Intronic
1139095765 16:63703284-63703306 GTCTCAGGCTTCCTGCACACAGG - Intergenic
1140494772 16:75375674-75375696 GTCTCAGCCTTGGAGTAGCTGGG - Intronic
1141564933 16:84894991-84895013 GTCCCAGCCTCGGGGCAGCCTGG - Intronic
1141839969 16:86568002-86568024 GTCTCCACCTTGGTGATGACCGG - Exonic
1143056810 17:4168897-4168919 ATCTCAGCTTTGGTGCAGGCAGG + Intronic
1144211333 17:13017951-13017973 TTCTCAGTTTTGGTGGAGACGGG - Exonic
1146786240 17:35724429-35724451 CTGTCAGCTTTGGTGCTGACAGG - Intronic
1148344638 17:46895080-46895102 GTCTCTGCTGTGGTGCAGGCAGG - Intergenic
1149608120 17:57939292-57939314 ATCTCAGTCTGGGTGAAGACTGG + Intronic
1150955433 17:69854114-69854136 GTCTTAGCATTAGTGTAGACAGG - Intergenic
1152019220 17:77771751-77771773 GCCTCGGCCTTGGGGCTGACAGG + Intergenic
1152158114 17:78648243-78648265 GCCTCGGCCTTGCTGCAGTCCGG - Intergenic
1152532239 17:80925412-80925434 ATCTCCGCCACGGTGCAGACGGG + Exonic
1152808776 17:82371542-82371564 GGGTCAGCCTTGGGGCAGCCGGG + Intergenic
1153770893 18:8415787-8415809 GGATCAGTCTGGGTGCAGACTGG - Intergenic
1158497665 18:57970891-57970913 TTCTCAGCCTGGCTGCATACTGG + Intergenic
1161456709 19:4373255-4373277 GCCTCTGCCTTGGGGCTGACTGG + Intronic
1162742135 19:12779292-12779314 TTCTCAGCCCTGATGAAGACTGG - Intronic
1165493151 19:36136942-36136964 GTCTCAGGTTGGGTGGAGACAGG + Intergenic
1166541177 19:43607147-43607169 GTCTCCCCCATGGTCCAGACTGG - Intronic
1166694157 19:44843112-44843134 GTCTCAGGCTTGGCACAAACTGG - Intergenic
925302179 2:2825331-2825353 GTATCAGCCTCGGTGGAGAGCGG + Intergenic
925372695 2:3358763-3358785 GGCTCAGCCTTGGAGTAGTCAGG - Intronic
925675051 2:6353263-6353285 GTCTCAGCCTTGGACCTGAGGGG + Intergenic
925906850 2:8544845-8544867 GGGTCTGCCTTGGTGCAGAGAGG - Intergenic
926104911 2:10143997-10144019 GAGACAGCCTTGGTGGAGACGGG - Intronic
926616837 2:15004529-15004551 GTCTCACCCTCTGTCCAGACTGG + Intergenic
928427766 2:31192927-31192949 GACTCTGCCTTGGTGCACATTGG + Intronic
929945845 2:46371241-46371263 GTCTTAGCCTTGGGGTAGATGGG - Intronic
931648788 2:64450213-64450235 GTCTGTGCCTTGGTCCAGAGAGG - Intergenic
932453624 2:71832062-71832084 GGCTCAGCCTGGGAGGAGACTGG - Intergenic
934859822 2:97755358-97755380 AACGGAGCCTTGGTGCAGACTGG - Intergenic
936484593 2:112915403-112915425 CTCTCACCCCTGGTGCACACTGG - Intronic
938117117 2:128609551-128609573 ATCTAGGCCTGGGTGCAGACAGG - Intergenic
943459014 2:188146474-188146496 GTCTCACCCTTGCTGCTGTCTGG + Intergenic
943787243 2:191891711-191891733 CTGTCTGCCTTGGTGCAGAAAGG - Intergenic
948477099 2:238227259-238227281 GACTCAGCCTTGGTGCAGACTGG + Intronic
1170036033 20:11991152-11991174 GTGTCAGCCTGGGGGCAGGCTGG + Intergenic
1170784944 20:19459815-19459837 ATCTCAGCCTTGGTCCAAATGGG - Intronic
1174055286 20:47794425-47794447 TTCTCAGCCCTGGCGCAGGCTGG - Intergenic
1176861361 21:14013138-14013160 GTGTCAGCCTTGCTGGAGGCCGG + Intergenic
1178763637 21:35428622-35428644 GTGTCAGACATGGGGCAGACAGG - Intronic
1180600632 22:17012927-17012949 GACTGAGCCATGGTGAAGACAGG - Intergenic
1183489258 22:38108076-38108098 GTCCCAGCCTGGGAGCAGCCCGG + Intronic
1184122172 22:42458986-42459008 GTCTCAGCCTGTGTACAGACTGG - Intergenic
1184314507 22:43674358-43674380 GTCTCTGCCTTTGTGGAGACAGG + Intronic
1185100367 22:48837013-48837035 GTCTGAGCCTTGGGGCAGCCTGG + Intronic
1185140149 22:49095548-49095570 TTCCCAGCCTGGGTGCAGGCTGG + Intergenic
950329314 3:12143971-12143993 ATCTCAGCCTGGGTGCAGCTGGG + Intronic
950717896 3:14862719-14862741 GGCTCAACCTTGGTGAGGACTGG + Intronic
950920304 3:16687317-16687339 TTCTCATCCCTGGTGCAGACAGG - Intergenic
953430837 3:42839107-42839129 CTCCCTTCCTTGGTGCAGACGGG + Intronic
953901141 3:46845021-46845043 TTGTCAGCCTTGGGGGAGACAGG - Intergenic
956174961 3:66464346-66464368 GTGTCAGCCTTGTTACACACAGG - Intronic
959579724 3:107971108-107971130 GTCTCAGTCTTTGTGCTGATTGG + Intergenic
962005327 3:131343745-131343767 GTTTCAGCCTTGGTTCAAAGAGG - Intronic
964433606 3:156630102-156630124 GTCTCAGCCATGCTGTGGACTGG - Intergenic
968723545 4:2226281-2226303 GGCTCAGTCTTGTTGCAGTCAGG - Intronic
969707402 4:8819279-8819301 GGCTCAGCCTGGGTGCACACTGG + Intergenic
972229813 4:37058471-37058493 GTCTCTGCTTTTGTGGAGACTGG - Intergenic
976641166 4:87339849-87339871 CTCTCAACTTTGGTGCACACTGG - Intronic
980978317 4:139632270-139632292 GTGTCAGCCTGGGTCCAGCCAGG + Intergenic
981575637 4:146201978-146202000 GTCTCAGCCTTGCCACATACTGG + Intergenic
983979212 4:173973530-173973552 GGCTCAGCCTAAGTGAAGACTGG + Intergenic
989571468 5:42950013-42950035 GTCTCAGACTTGCTGCTGCCAGG - Intergenic
992173165 5:74124025-74124047 TCCTCAGCCTTGGTGCAGTCAGG - Intergenic
996399483 5:123046245-123046267 ATCCCAGCCTTGGTGGAGAAGGG + Intergenic
1004135908 6:12966205-12966227 GACTCAGGCTGGGGGCAGACGGG + Intronic
1005151397 6:22755881-22755903 GAGACAGCCTTGGTGCAGAAAGG - Intergenic
1005325331 6:24694567-24694589 ATCTCAGCCTTGGTAAAGATGGG - Intronic
1005619764 6:27608989-27609011 GTATCAGTCTTGGTGCAATCAGG + Intergenic
1007320016 6:41021354-41021376 CTCTCACCCTTGGTGCAGTCAGG - Intergenic
1013834140 6:114312832-114312854 GTTTCAGCGTTGTTGCAGGCTGG - Intronic
1017846388 6:158262113-158262135 GTCTCTGCCTTGGTGTGGAAAGG + Intronic
1019038849 6:169086201-169086223 GTCTCAGCCTTGTTTCACTCAGG - Intergenic
1019670397 7:2274929-2274951 AGCCCAGCCTTGGTGCAGGCAGG - Intronic
1019724403 7:2593202-2593224 GTCTCAGCCTTGCTGCCAGCCGG + Intronic
1021621734 7:22555914-22555936 GCCTCAGCCCTGGTGCAGGGAGG + Intronic
1025142636 7:56478705-56478727 TTCCCATCCTTGGTGCAGACAGG - Intergenic
1025237703 7:57245717-57245739 TTCTCAGCCCTGGTGCAGGCTGG + Intergenic
1025708696 7:63889307-63889329 TCCCCATCCTTGGTGCAGACAGG - Intergenic
1026084403 7:67251101-67251123 CTCTGAGCCTTCATGCAGACAGG + Intergenic
1026448490 7:70506536-70506558 CTCTCAGTCTTGGTGGAGAGTGG - Intronic
1032395823 7:131588893-131588915 TTCTTAGCCTGGGTGCAGGCAGG - Intergenic
1033271974 7:139940183-139940205 CTCTAAGCCATGGTGTAGACAGG + Intronic
1034552710 7:151831818-151831840 GCCCCAGCCTCGGTGCAGGCAGG - Intronic
1035455319 7:159005183-159005205 GTCTCACTCTGTGTGCAGACTGG - Intergenic
1036460109 8:8945089-8945111 GTCTCAGCCTTGGTTTACCCAGG - Intergenic
1037660703 8:20924212-20924234 GTCTCTGCCTTTGAGCACACTGG - Intergenic
1037911779 8:22747965-22747987 GTCCCAGCCTGGGTGGAGAGCGG + Intronic
1038455450 8:27669602-27669624 ATCTCAGCCTTGCTGCTGGCAGG + Intronic
1044736732 8:95286444-95286466 GTCTCAACCCTGGTGTAGATTGG - Intergenic
1048713058 8:137233523-137233545 GTCTCAGCTTTGGTGCTACCTGG - Intergenic
1049455611 8:142684801-142684823 GTCGCAGCCCTGGTGCACTCAGG + Intergenic
1049712034 8:144069211-144069233 CACTCAGCCTGGGTGCAGCCTGG - Intergenic
1051875485 9:21788618-21788640 GATTCAGCCTTGGTGAAAACAGG + Intergenic
1052337851 9:27337981-27338003 TTCTGGGCCTTGGTGCATACTGG - Intronic
1055183247 9:73416717-73416739 GACTCTGACTTTGTGCAGACAGG + Intergenic
1057577428 9:96254683-96254705 GTGTCAGCTTTAGTGCACACTGG - Intronic
1060803450 9:126558997-126559019 GTCTCATCCCAGGTGAAGACTGG - Intergenic
1061322757 9:129841612-129841634 TTCTCAGCCTTGGTGGAGAAAGG + Intronic
1061669908 9:132182835-132182857 CTCTCAGCCGGGGTGCACACTGG + Intronic
1203581151 Un_KI270746v1:6309-6331 GAATCAGCCTTGATGCAGCCAGG - Intergenic
1187124033 X:16436680-16436702 GTCTTAGCGGTGGTGCTGACAGG + Intergenic
1189190429 X:39097242-39097264 GTCTCAGCCTGCATGCCGACTGG + Intergenic
1192296336 X:69852741-69852763 GTCTCAGTCTTGGTGCTGACTGG + Intronic
1198145236 X:133849644-133849666 GCCTGATCCTTGCTGCAGACAGG + Intronic