ID: 1107031092

View in Genome Browser
Species Human (GRCh38)
Location 13:35854442-35854464
Sequence GTCTCAGCCTTGGTGCAGAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 160
Summary {0: 1, 1: 1, 2: 2, 3: 13, 4: 143}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107031092_1107031095 27 Left 1107031092 13:35854442-35854464 CCTGTCTGCACCAAGGCTGAGAC 0: 1
1: 1
2: 2
3: 13
4: 143
Right 1107031095 13:35854492-35854514 TCCTTACCCTCTGCTTCCGCAGG 0: 1
1: 0
2: 0
3: 14
4: 139

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107031092 Original CRISPR GTCTCAGCCTTGGTGCAGAC AGG (reversed) Intronic