ID: 1107031520

View in Genome Browser
Species Human (GRCh38)
Location 13:35858624-35858646
Sequence CACTCGGATCTGCCTCCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 89}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107031514_1107031520 4 Left 1107031514 13:35858597-35858619 CCTAGGCTTCTCTCTCTACCACC 0: 1
1: 0
2: 6
3: 43
4: 377
Right 1107031520 13:35858624-35858646 CACTCGGATCTGCCTCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 89
1107031512_1107031520 29 Left 1107031512 13:35858572-35858594 CCTAGCATCTGCAGGGCTGAGGA 0: 1
1: 0
2: 2
3: 30
4: 328
Right 1107031520 13:35858624-35858646 CACTCGGATCTGCCTCCTTTAGG 0: 1
1: 0
2: 0
3: 10
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107031520 Original CRISPR CACTCGGATCTGCCTCCTTT AGG Intronic
901123512 1:6913371-6913393 CTCCCAGATCTGCCTGCTTTTGG + Intronic
904207722 1:28865572-28865594 CCCGGGGATGTGCCTCCTTTGGG + Intergenic
908528062 1:65007230-65007252 CACCCGGATCTTCTTCCTTTCGG - Intergenic
909417789 1:75426988-75427010 CACTTGGTTCTGCCTCTTTTTGG + Intronic
915772121 1:158436639-158436661 CACTTGGGTTTGACTCCTTTTGG - Intergenic
917725181 1:177821174-177821196 CACTTGGCTCTGCCTGCTGTGGG - Intergenic
918523380 1:185439301-185439323 CACTCACATCTCCCTCCTTGTGG - Intergenic
918723782 1:187891486-187891508 CTCACGGATCTGCTTCCTCTAGG + Intergenic
919743757 1:200995895-200995917 CACTTGGTGCTGCCTCCTGTTGG - Intronic
1064745585 10:18475199-18475221 CTCTCAGATCTCCATCCTTTTGG + Intronic
1070442404 10:76459716-76459738 CACCCGAATTTTCCTCCTTTTGG + Intronic
1077123327 11:921094-921116 CACCCGCCTCTGCCTCCTATGGG + Intergenic
1090425168 11:126602571-126602593 AACTGGGACCTGCCTCCCTTTGG + Intronic
1090440121 11:126718476-126718498 CACTTGGCTGTGCCTGCTTTTGG + Intronic
1092171608 12:6376781-6376803 CACTCTGGGCTGCCTCCTGTGGG - Intronic
1096037084 12:48481952-48481974 CTCTGGGACCTGCTTCCTTTTGG - Intergenic
1097084072 12:56454584-56454606 AACTGCGATCAGCCTCCTTTTGG - Exonic
1098996154 12:77123049-77123071 CACTCATATCAGCCTCCTCTAGG - Intergenic
1103982012 12:124742717-124742739 GATTCGGATCTGGCTTCTTTAGG - Intergenic
1107031520 13:35858624-35858646 CACTCGGATCTGCCTCCTTTAGG + Intronic
1107347130 13:39473609-39473631 CACTCAGATCTTCTTTCTTTCGG + Intronic
1117504674 14:56390270-56390292 CACATGGCTCTCCCTCCTTTAGG + Intergenic
1118093419 14:62508923-62508945 GCCTTGGTTCTGCCTCCTTTTGG - Intergenic
1122120299 14:99549645-99549667 CACTCCGCTCTGCCTAATTTCGG - Intronic
1125380239 15:39079525-39079547 CACCCTCATCTGCCTGCTTTAGG - Intergenic
1125855291 15:42942552-42942574 CAATCCAATCTGCATCCTTTTGG - Intergenic
1126784081 15:52162742-52162764 CACTCGGATCAGCCTGTTTGAGG - Intronic
1132282377 15:100631371-100631393 CACACAGATCTGCCTGCCTTGGG + Intronic
1134274751 16:12766146-12766168 CACCCGCCTCTGCCTCCCTTTGG - Intronic
1137337048 16:47559878-47559900 CACTTGGATTTTACTCCTTTAGG + Intronic
1138229164 16:55324930-55324952 CCCTCGGCTCTGCCTCCACTGGG + Exonic
1151957661 17:77388467-77388489 TACACGGATCTGCCTGGTTTAGG - Intronic
929770709 2:44889201-44889223 CTCTCTGAACTTCCTCCTTTAGG + Intergenic
929999110 2:46849141-46849163 CTCTCGGCTCTGCCTCCACTAGG + Intronic
931667158 2:64617716-64617738 CACTTGGATCTGCTGCCTTTTGG - Intergenic
933802698 2:85975840-85975862 CATTCGCATCTGCATCATTTGGG + Intergenic
933918171 2:87017688-87017710 CACTTGGATCTCCCACCTCTAGG - Exonic
934004823 2:87752225-87752247 CACTTGGATCTCCCACCTCTAGG + Exonic
935456038 2:103268677-103268699 CCCACGTATTTGCCTCCTTTTGG - Intergenic
935767782 2:106386258-106386280 CACTTGGATCTCCCACCTCTAGG + Intergenic
937778947 2:125814390-125814412 GGCTGGGTTCTGCCTCCTTTTGG - Intergenic
937782337 2:125853466-125853488 CTCTCGCCTCTGCCTCCTTTAGG - Intergenic
944539510 2:200742595-200742617 CACCCGGAGCTGCCTGCTCTTGG - Intergenic
945668751 2:212776237-212776259 CAGTCGAATCTGCATCCTTTAGG - Intergenic
946885507 2:224218459-224218481 CACTCTGAGCTGCCTATTTTAGG + Intergenic
1176364864 21:6026676-6026698 CACTCAGCTCTGCCTCTTCTGGG + Intergenic
1179371450 21:40809633-40809655 CACTTGGATCTGGGTCCTCTAGG + Intronic
1179485301 21:41706144-41706166 TACTCCCACCTGCCTCCTTTGGG - Intergenic
1179758654 21:43511869-43511891 CACTCAGCTCTGCCTCTTCTGGG - Intergenic
1180815475 22:18786852-18786874 CACTCTATTGTGCCTCCTTTGGG + Intergenic
1183160651 22:36110768-36110790 AACTGGGGTCGGCCTCCTTTGGG - Intergenic
952171130 3:30808054-30808076 CAGTCTGATTTGCTTCCTTTTGG - Intronic
952393625 3:32902530-32902552 CATTCGTTTCTGTCTCCTTTAGG - Intergenic
952457838 3:33490805-33490827 CACTCTGCTCTACCTCCCTTGGG + Intergenic
955966302 3:64392569-64392591 CACCTGAATCTACCTCCTTTGGG - Intronic
958856509 3:99392482-99392504 CAATCATCTCTGCCTCCTTTAGG + Intergenic
964328284 3:155572497-155572519 CACTCTGATTTGCCTCTTTGTGG + Intronic
964623042 3:158734212-158734234 CACTTGGCTCTGCCTCCTTCAGG - Intronic
969630398 4:8332633-8332655 CTCTCGGATCTCCATCCTTGTGG - Intergenic
973867002 4:55124751-55124773 CACTCGGTTCTGCCTCTTTGCGG - Intronic
975048505 4:69831091-69831113 CACTCGGATTTAACTCCTTGTGG + Intronic
978190030 4:105899931-105899953 CAATCTGATCAGCCTCTTTTTGG - Intronic
982380252 4:154742029-154742051 CACTCTGAACTGGCTCCTCTGGG - Intronic
987012140 5:13778346-13778368 CTCTCGGATCTCACTTCTTTAGG - Intronic
987746781 5:21984510-21984532 CACTCGCATGTAGCTCCTTTGGG + Intronic
989258963 5:39397724-39397746 CACTTGAATCTGCCACATTTAGG - Intronic
991766954 5:69994271-69994293 CACTCGCATATAGCTCCTTTGGG + Intergenic
991846186 5:70869348-70869370 CACTCGCATATAGCTCCTTTGGG + Intergenic
1004511472 6:16287427-16287449 CACTCAGCTCAGTCTCCTTTGGG + Intronic
1006824799 6:36926887-36926909 GACTCAGATGTGCCTCCGTTGGG + Intronic
1007739409 6:44001716-44001738 CTCTCAGAGCTGCCTTCTTTAGG + Intronic
1007909994 6:45504063-45504085 CACTCGGGTCTGTCTCCTGCTGG + Intronic
1014263795 6:119251449-119251471 CACTCTCTTCTGCCTCCTTTTGG + Intronic
1017954560 6:159167974-159167996 CACCCGGCTCTGCCTATTTTGGG - Intergenic
1018128617 6:160706385-160706407 CACTTGGATCTCCCACCTCTAGG + Exonic
1019139708 6:169935717-169935739 CACTCAGGTCTTCCTCCTCTTGG + Intergenic
1021733317 7:23618399-23618421 CACTCTGAGTTGCCTCCTTAAGG + Intronic
1022413885 7:30161515-30161537 CTCTCAGATCTGCCTGCATTTGG - Exonic
1023002592 7:35826421-35826443 AACTCCAATCTGCCTCCCTTTGG - Intronic
1024093207 7:45964716-45964738 GCCTGGGATCTGCCTCCTTGGGG + Intergenic
1028309600 7:89314752-89314774 AACTCGGATCTGCCTGATTTGGG + Intronic
1034442517 7:151093581-151093603 CAGTCGGATGTGCATCCTTCTGG + Intronic
1035745173 8:1956882-1956904 CACTCGGAAGTGCGTCCTTCTGG - Exonic
1039775299 8:40730603-40730625 CACTTAGATCTGAATCCTTTGGG - Intronic
1041051725 8:53940887-53940909 CACTGGTGTCTTCCTCCTTTAGG - Intronic
1042347887 8:67746444-67746466 CACTGGGTGCTGCTTCCTTTGGG + Intergenic
1044471701 8:92577374-92577396 CACTTGGATCGGCTTCATTTTGG + Intergenic
1044772693 8:95653861-95653883 CACTTGTACCTGCCACCTTTAGG + Intergenic
1045010234 8:97952474-97952496 CCCTCAGTTCTGCCTCCTTCCGG + Intronic
1045820024 8:106325708-106325730 CACTCAGATCTGAATGCTTTAGG + Intronic
1055804559 9:80077865-80077887 CACTCCCATCTGAATCCTTTGGG - Intergenic
1057448726 9:95137734-95137756 CACTCAGAGCTTCCTCCCTTGGG - Intronic
1059633858 9:116154109-116154131 CACCCGGAGCTGCCAGCTTTGGG - Exonic
1060593788 9:124835659-124835681 CCCTGGGTTCTGCCTCCTTGGGG + Intergenic
1061083717 9:128387119-128387141 CACTGAGATCTGCCTCCTTGTGG - Intronic
1062080189 9:134619684-134619706 CTCCCGGGTCTGCCTCCTCTTGG - Intergenic
1186432904 X:9520204-9520226 AAGTGGGATTTGCCTCCTTTGGG - Intronic
1190427612 X:50347408-50347430 CAGTGGGATTTGCCACCTTTAGG - Intronic
1192226402 X:69231192-69231214 CCCTGTGATCTGGCTCCTTTGGG + Intergenic
1200152522 X:153958249-153958271 CACTCGTCTCTGCCTCCTCCAGG - Exonic