ID: 1107033923

View in Genome Browser
Species Human (GRCh38)
Location 13:35881024-35881046
Sequence CTGAATATACAGATGAACAA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 7, 2: 30, 3: 81, 4: 381}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107033921_1107033923 15 Left 1107033921 13:35880986-35881008 CCTCTTAGTCTTTACTGATGTCT 0: 1
1: 0
2: 1
3: 26
4: 207
Right 1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG 0: 1
1: 7
2: 30
3: 81
4: 381
1107033920_1107033923 16 Left 1107033920 13:35880985-35881007 CCCTCTTAGTCTTTACTGATGTC 0: 1
1: 0
2: 0
3: 17
4: 277
Right 1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG 0: 1
1: 7
2: 30
3: 81
4: 381
1107033919_1107033923 29 Left 1107033919 13:35880972-35880994 CCGAAATACAATGCCCTCTTAGT 0: 1
1: 1
2: 0
3: 11
4: 145
Right 1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG 0: 1
1: 7
2: 30
3: 81
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107033923 Original CRISPR CTGAATATACAGATGAACAA TGG Intronic
900485769 1:2921986-2922008 CTGGATAGACAGATGGACAGAGG - Intergenic
900879475 1:5370364-5370386 CTGAATATGCAAACAAACAATGG + Intergenic
902419324 1:16265566-16265588 CTCATTTTACAGATGAATAATGG + Intronic
902794479 1:18792285-18792307 CTGAATATACAAATGGACAATGG + Intergenic
904050866 1:27637467-27637489 AGGAATTAACAGATGAACAAAGG + Intergenic
904346518 1:29875543-29875565 CTGAATATACAAATGGACAATGG + Intergenic
905499174 1:38422549-38422571 AGGAATATACAAATGAACAATGG - Intergenic
905807350 1:40886488-40886510 CTGAATAAACAAGTGAACACTGG + Intergenic
906088205 1:43154593-43154615 TTGAATATAAATATGAATAATGG + Intronic
907644333 1:56226777-56226799 CTTAATATGCAGATGGACATTGG - Intergenic
909021994 1:70441711-70441733 CTGAATATAGAAATGGACAGTGG - Intergenic
909186531 1:72493617-72493639 GTAATTATAAAGATGAACAAAGG + Intergenic
909317157 1:74237578-74237600 CTGAATATTAGGATTAACAATGG + Intronic
910135607 1:83965369-83965391 CAGAAGAGACAGAAGAACAAAGG - Intronic
910625733 1:89304378-89304400 CTGAATGTCCATATGCACAATGG - Intergenic
911436983 1:97872981-97873003 CTGAAAATAAAGATGAAGGAGGG - Intronic
911471942 1:98329937-98329959 CTGATTATACAGTTTAATAAAGG + Intergenic
911561353 1:99409919-99409941 CTGTATTTACACATGAACATGGG - Intergenic
911709206 1:101049922-101049944 CTGAAAATAGAGATGAGCCAAGG + Intergenic
911951457 1:104178095-104178117 CTGAATATTCACAAGAACAATGG - Intergenic
912656863 1:111494002-111494024 CTGAATATACAAGTGGACTATGG + Intronic
912944568 1:114074442-114074464 CTAATTTTACAAATGAACAAAGG + Intergenic
913665922 1:121048845-121048867 CAGAATATACAATCGAACAATGG + Intergenic
914017320 1:143832121-143832143 CAGAATATACAATCGAACAATGG + Intergenic
914655931 1:149740653-149740675 CAGAATATACAATCGAACAATGG + Intergenic
914698375 1:150107222-150107244 CTGAATATACAGATGTCTAGTGG + Intronic
914750393 1:150531162-150531184 CTGATTATACAAATGAACAATGG + Intergenic
917636305 1:176940156-176940178 CTGAATATACAAATGGACAATGG + Intronic
918039741 1:180906753-180906775 CTGAATCTACAGATGCCCAAAGG - Intergenic
918205939 1:182309560-182309582 CTCAATATACTGATCAAAAAGGG - Intergenic
918306183 1:183249190-183249212 TTGAATGTACATAGGAACAAGGG - Exonic
918657235 1:187043308-187043330 CTGAATATATAAATGGACAATGG + Intergenic
918670774 1:187212698-187212720 CAGAATATAAAGAAGAAGAAAGG + Intergenic
919102214 1:193108744-193108766 CTGAATATATAAATGGATAATGG - Intergenic
919362915 1:196617408-196617430 ACAAAGATACAGATGAACAACGG - Intergenic
919761465 1:201100647-201100669 CTGACTAGACAGAGGGACAATGG + Intronic
920215095 1:204357369-204357391 CTGAACAGACAGATGGTCAAGGG + Intronic
922369836 1:224898273-224898295 CTGAATAGACAAATGGACAATGG - Intronic
922745730 1:228042528-228042550 ATGAATGTACAGATGATGAAGGG + Intronic
923164131 1:231343057-231343079 CTAAATATAAAGAAGAAAAAAGG - Intronic
923466551 1:234252541-234252563 CTCAATAGAGAAATGAACAAAGG + Intronic
924272033 1:242343919-242343941 CTGAATAAACAAATGGACAATGG + Intronic
924688559 1:246322571-246322593 GGGGATATACAGATGAACACAGG - Intronic
1063671050 10:8100382-8100404 CTGATTAAACAGATGAACAAAGG - Intergenic
1063764517 10:9122918-9122940 TTGCATATACAGTTGACCAATGG - Intergenic
1063882234 10:10542942-10542964 CTGAAAATACAGACTGACAATGG - Intergenic
1063927209 10:10992187-10992209 ATGAATCTACAGATCAACAATGG + Intergenic
1064336491 10:14448102-14448124 GTGAATAAGCAAATGAACAAGGG + Intronic
1066479716 10:35783881-35783903 CTGAATAAACATTTGCACAACGG + Intergenic
1066533770 10:36367987-36368009 CTGGAAATAAAGATGAAGAAGGG + Intergenic
1066712636 10:38252211-38252233 CTGAATAAACAAATGGACAATGG - Intergenic
1068465896 10:57391120-57391142 CTAAATACATAGGTGAACAAAGG - Intergenic
1068690531 10:59909140-59909162 CTGCAAAAACACATGAACAAAGG + Intergenic
1068793577 10:61053260-61053282 CTGGACATAAAGATGAAGAATGG + Intergenic
1069144727 10:64876600-64876622 CTGAATATACAAATGGGCAATGG + Intergenic
1070612021 10:77939899-77939921 CTGAACATACAAATGGGCAATGG + Intergenic
1074674245 10:115830150-115830172 GTGGATATACAAGTGAACAAAGG + Intronic
1074687514 10:115974154-115974176 CCGAATATACAAATGGACAGTGG + Intergenic
1075000379 10:118792565-118792587 CTGAATATACAAATGGACAGTGG + Intergenic
1077440664 11:2567268-2567290 CTGCAAATACAGATGAACCCAGG + Intronic
1079214379 11:18494949-18494971 CTGAATATTTAGATAAAGAAAGG - Intronic
1080300039 11:30773978-30774000 ATGAATATACAGAAGAGCCAAGG - Intergenic
1080337827 11:31219423-31219445 CTGAATATAAACATGAGCAGAGG + Intronic
1080955412 11:37088374-37088396 TTTAATATACAAAGGAACAATGG + Intergenic
1081078180 11:38702516-38702538 TTAAATATACAAATGGACAATGG + Intergenic
1081290230 11:41315862-41315884 CTCAATAAATAGATGTACAAAGG + Intronic
1083539888 11:63505322-63505344 CTCCATGTACAGATGAACAAAGG + Intergenic
1086515133 11:87603071-87603093 CTGAATATACAAATAGACAATGG - Intergenic
1087088374 11:94242840-94242862 CTGAACATAAAAATGGACAATGG + Intergenic
1087095230 11:94311754-94311776 CTGAATCTACAAATGAACAATGG - Intergenic
1087096743 11:94326330-94326352 CTGAATATATAAGTGGACAATGG - Intergenic
1087287364 11:96279440-96279462 TTCAGTATACAGATGAACAAAGG + Intronic
1087670128 11:101096587-101096609 CTGTATATGCAGGTGAAGAAAGG + Intronic
1087882706 11:103437361-103437383 ATGAAAAGACAGAAGAACAAGGG - Intronic
1088340785 11:108763925-108763947 CAGAAAATACAGATTGACAAAGG + Intronic
1089940250 11:122409097-122409119 CTGACTAGACAGATGAAATAAGG - Intergenic
1090148442 11:124354871-124354893 CTGATTAAATAAATGAACAAAGG + Intergenic
1092388581 12:8054950-8054972 CAGAAGACACAGATGAACAAGGG - Exonic
1093512823 12:19949174-19949196 CTGAATATACAAATGGACAATGG + Intergenic
1094794592 12:33956490-33956512 CTAAATATACAAACCAACAATGG + Intergenic
1095106448 12:38239104-38239126 CTAAATATACAAACCAACAATGG + Intergenic
1095724389 12:45435891-45435913 CTGAATATACAAATGGACAATGG + Intronic
1096544251 12:52326893-52326915 CTGAATAGACAGTTCATCAAAGG + Intergenic
1097562102 12:61220321-61220343 CTTACTACACAGAGGAACAAAGG + Intergenic
1098069813 12:66661051-66661073 CATAATATACAGATAAATAATGG + Intronic
1098992569 12:77080117-77080139 CTGAATATACAGACAAAAAAAGG - Intergenic
1099479403 12:83147503-83147525 CTGAATCAACAGACAAACAAGGG - Intergenic
1101779103 12:107819646-107819668 CAGCTTATACAGAAGAACAAAGG + Intergenic
1101803278 12:108041468-108041490 CTGAACATACAAATGGACAGTGG + Intergenic
1104072200 12:125355585-125355607 CTGAATATACAAATGGACAACGG - Intronic
1104356623 12:128092456-128092478 CTGAATATAAAAATGGACAATGG + Intergenic
1104681277 12:130753650-130753672 ATGAATATACAGTTGACCCATGG + Intergenic
1105285177 13:18997590-18997612 CTGAAAATAGAGATGAACATAGG - Intergenic
1106343340 13:28852275-28852297 CTGGAGAGACAGATGAACAAAGG - Intronic
1106863054 13:33932163-33932185 TAGAATAGACAGATGAACAATGG - Intronic
1106871715 13:34029087-34029109 CTGAATATACAGATGGACAATGG + Intergenic
1107033923 13:35881024-35881046 CTGAATATACAGATGAACAATGG + Intronic
1107607532 13:42075482-42075504 TTTTATATACAGATTAACAATGG - Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1107778636 13:43875481-43875503 CTGAATATGCAAATGGACAATGG + Intronic
1107843739 13:44488859-44488881 CTGAATCTACAGATGAATTTGGG - Intronic
1108440514 13:50448461-50448483 CTGAATATACAAATGGATGACGG + Intronic
1109684462 13:65797717-65797739 CTGATTATACAAATGGACAATGG + Intergenic
1109958777 13:69603683-69603705 CTGAATATACAAATGCACAGTGG - Intergenic
1110220030 13:73062158-73062180 CTGAATATACTGGTGAACTCAGG - Exonic
1110372654 13:74757038-74757060 TGGAATGTACAGATTAACAATGG + Intergenic
1111538171 13:89631360-89631382 CAGAAAATACAGATGAAAGAAGG - Intergenic
1111880146 13:93945727-93945749 CTGAATATACAAATGGGCAGTGG - Intronic
1112586093 13:100720285-100720307 CTGAATATACACATAGACAGTGG + Intergenic
1113019947 13:105873742-105873764 ATAAACATACAGATAAACAAAGG + Intergenic
1113128548 13:107008395-107008417 CTGAATATAAAGATGGATTATGG + Intergenic
1113629858 13:111874758-111874780 CTAAATATACCAATGGACAATGG - Intergenic
1114404636 14:22444899-22444921 CTGAAAATACAGAGGGACTACGG - Intergenic
1114662902 14:24360021-24360043 CTGAATATACAGATGGAAAATGG + Intergenic
1114734426 14:25029381-25029403 CTGAAGATTCAGATGATCATTGG + Intronic
1114913263 14:27227748-27227770 CTGAATAAATAAATGAATAATGG + Intergenic
1115155191 14:30331079-30331101 CTGAATATACAAATGGACAGTGG + Intergenic
1115193174 14:30768891-30768913 CTGAACAAACAGATGAACTTTGG + Intergenic
1115593993 14:34891635-34891657 CTTAATAGAAAAATGAACAAAGG + Intergenic
1116110672 14:40576610-40576632 CTGAACATACAAATGGACTATGG + Intergenic
1116146083 14:41070788-41070810 CTGAATATACAGATAGAAAATGG - Intergenic
1116364646 14:44044794-44044816 CTGAATAAAGAGCTGAATAAAGG + Intergenic
1116392122 14:44405438-44405460 CTGCACATAGAGATAAACAAGGG + Intergenic
1116992479 14:51291014-51291036 CTGCAAATACAGATTAACATTGG - Intergenic
1117020446 14:51565131-51565153 CTGTGTACACAGAAGAACAAAGG - Intronic
1118250518 14:64155935-64155957 CCGAAGATACAGATCAAAAATGG - Intronic
1119894257 14:78206510-78206532 CTGTAAATAAAGAGGAACAAAGG + Intergenic
1120003471 14:79330198-79330220 GTTAATAGACAGATGAACAAGGG + Intronic
1120352733 14:83383646-83383668 CTGCATAAACAGATTAACAGTGG - Intergenic
1120499171 14:85272696-85272718 TTGAATAAATAAATGAACAATGG + Intergenic
1121577418 14:94999501-94999523 CTGAATAGAAAATTGAACAAAGG + Intergenic
1121780838 14:96621433-96621455 GAGAATATATAGATGAAAAATGG - Intergenic
1123202144 14:106676044-106676066 CTGAAAACACACATGAACCATGG - Intergenic
1202847796 14_GL000009v2_random:197156-197178 CTGAAAATAAAGATTAACCAGGG + Intergenic
1202917270 14_GL000194v1_random:187696-187718 CTGAAAATAAAGATTAACCAGGG + Intergenic
1124063819 15:26320995-26321017 CTGAAGATAAAGATTAAAAATGG + Intergenic
1125006787 15:34825471-34825493 TTGAATATACAAATAAAAAATGG + Intergenic
1125126995 15:36236091-36236113 CAGAATTTACAGATAAGCAAAGG + Intergenic
1125448078 15:39779379-39779401 CAGAAAATACAGATAAGCAAGGG - Intronic
1125989745 15:44094802-44094824 CTGATTAAAGAGATGAAAAATGG - Intronic
1126718028 15:51542969-51542991 ATGAAAATACAGAATAACAAGGG + Intronic
1126944412 15:53803062-53803084 GGGAATATACAGATAAGCAAGGG + Intergenic
1130402872 15:83573752-83573774 ATGAATAAATAAATGAACAAAGG - Intronic
1130815871 15:87432103-87432125 CTGCATTTACAGATGAAGTAAGG + Intergenic
1131970770 15:97890556-97890578 CTGAATATACAAACAGACAATGG - Intergenic
1135492213 16:22919315-22919337 CTGAATGTACCAACGAACAATGG - Intergenic
1135498659 16:22974846-22974868 CTGAATATACAGGTGGACAAAGG + Intergenic
1135896708 16:26412114-26412136 GGGAATTTACAGATCAACAAAGG + Intergenic
1137449446 16:48557127-48557149 CTGGATAGGCAAATGAACAAAGG + Intronic
1137913835 16:52406673-52406695 CTAACTATACAGAGGAAAAATGG + Intergenic
1140694630 16:77520491-77520513 CAGAAGATACTAATGAACAAAGG + Intergenic
1142360388 16:89623490-89623512 CAGAAGGTCCAGATGAACAATGG + Intronic
1143127048 17:4648982-4649004 CTGACTATACAAAAGGACAATGG - Intergenic
1143665857 17:8359673-8359695 CTGCACCTACAGATGAAGAAGGG + Intergenic
1143816597 17:9521078-9521100 GTGAATATAAAGATGCACAGAGG + Intronic
1144061611 17:11587940-11587962 CAAAATAGACAAATGAACAATGG + Intergenic
1144221375 17:13102826-13102848 CTGAATGTACCCATGGACAATGG - Intergenic
1145107668 17:20133123-20133145 AAGAATATACAGATTACCAATGG - Intronic
1148875698 17:50685848-50685870 CTGAATATAAAAATGAAAATAGG - Intronic
1150976666 17:70095230-70095252 CTGAATATACAAATAAATACTGG + Intronic
1153686408 18:7550511-7550533 CTGAATCTACAAATGAACAGTGG - Intergenic
1154103040 18:11494187-11494209 CTGCTTCTACAGATGAACTATGG + Intergenic
1155615217 18:27714348-27714370 CTGAATATACAAATGAACAATGG + Intergenic
1156842686 18:41628058-41628080 CTGAGTATCCAGTTGAAGAAGGG - Intergenic
1156975594 18:43218385-43218407 ATCAATATACATGTGAACAAAGG - Intergenic
1157139117 18:45088106-45088128 CTGAATATACAAATGGACAATGG + Intergenic
1157147595 18:45180274-45180296 CTCATTTTACAGATGAACAGAGG - Intergenic
1157992027 18:52508820-52508842 CACAATTTACAGATGAAAAAAGG + Intronic
1158063586 18:53377871-53377893 CTGAATCTTTTGATGAACAATGG - Intronic
1158066801 18:53420308-53420330 CTGAATATTCTAAAGAACAAGGG + Intronic
1158161408 18:54488648-54488670 TTGAATATACAGATGGACAATGG - Intergenic
1158487272 18:57878687-57878709 ATGAAGACACAGAGGAACAATGG + Intergenic
1158789128 18:60754447-60754469 CTGAATATACAAATGGACAAGGG + Intergenic
1158901201 18:61963349-61963371 CTGGTTAAACAGATGAAAAAAGG + Intergenic
1159017361 18:63112209-63112231 CTGAATATACAAATGGGCAATGG + Intergenic
1159254154 18:65924034-65924056 CAGGATACACATATGAACAATGG + Intergenic
1159389833 18:67776452-67776474 CTCAATATACATGTGAACAAAGG + Intergenic
1159638185 18:70831426-70831448 CTGAATACACAAATGGACAATGG + Intergenic
1160096865 18:75881621-75881643 ATGATTTTACAGATGAACATTGG - Intergenic
1160439857 18:78881348-78881370 TTGAATATAGAGAAGTACAAAGG - Intergenic
1160611965 18:80095867-80095889 GTGAATATACAAATGAACAATGG + Exonic
1161879113 19:6934935-6934957 CTGGATATACAAATAGACAAGGG - Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1164957235 19:32397081-32397103 GTTAATATAAAGTTGAACAAAGG + Intergenic
1165009847 19:32836901-32836923 ATGAATATACAGAAAAACAGGGG - Intronic
1167704466 19:51071070-51071092 CTGAATAAATAAATGAACTATGG + Intergenic
925701258 2:6640645-6640667 CTGAAAATATAGATGAACTCAGG - Intergenic
927061319 2:19424946-19424968 CTGGATATACAGATGGAGACTGG - Intergenic
927209761 2:20631861-20631883 CTGAATACACAAAGGGACAATGG + Intronic
928109838 2:28497698-28497720 GAGAATATACAAATGGACAACGG - Intronic
928265603 2:29808896-29808918 CTGTACATAAAGATGAATAATGG - Intronic
929011747 2:37451854-37451876 CTGAATATACAAAGGGACAATGG - Intergenic
929029160 2:37634872-37634894 CTGAATATCCAGATGAGCCCTGG - Intergenic
929227358 2:39524605-39524627 CTGAATATACAGTTGAGACATGG + Intergenic
929240016 2:39644303-39644325 CTAAATATACATTTGAAAAAAGG + Intergenic
930258831 2:49121853-49121875 CTGAAGATACAGATCACGAAAGG - Intronic
930998153 2:57747853-57747875 TTGATAATACAGATGAATAATGG - Intergenic
931856049 2:66302727-66302749 ATGAGTAAACAGATGAATAAAGG - Intergenic
932200873 2:69827564-69827586 CTGAATTTACATCTGAAGAAGGG - Intergenic
932792078 2:74662510-74662532 AGGAATAAACTGATGAACAAAGG + Intronic
932865351 2:75335675-75335697 CTGAATATACAAATGGACAATGG - Intergenic
932971587 2:76549776-76549798 CTGAATATACAAACGAACAATGG - Intergenic
933178002 2:79197546-79197568 TTGAATATACAAATGGACAATGG - Intronic
933413741 2:81957722-81957744 CTGAATAGAAGGATGAAAAATGG - Intergenic
933551807 2:83787308-83787330 TTCAATATACAGCTGGACAATGG + Intergenic
935199683 2:100845417-100845439 CTGAATGTACAAATGGACAATGG - Intronic
935590188 2:104841072-104841094 GTAAATATACATATGCACAAGGG - Intergenic
935782981 2:106524270-106524292 ATGAATATACAAAGGGACAATGG - Intergenic
935930432 2:108118201-108118223 CTGAATATACATATGAACAAGGG - Intergenic
936699920 2:114999128-114999150 CTGAAGATACAGCAAAACAAAGG - Intronic
937804777 2:126126570-126126592 CTGAATACACACAGGAAAAAAGG - Intergenic
937813198 2:126221587-126221609 CTGAATATACAGATGGACAATGG + Intergenic
938171070 2:129077162-129077184 CTGAATATACACATACACAATGG - Intergenic
938449341 2:131402809-131402831 CAGAATATTCAAATGAACACAGG - Intergenic
938977843 2:136496166-136496188 CTGAATATACAAATGGACAGTGG - Intergenic
939234302 2:139471080-139471102 CTGAATATACCAATGGACCATGG - Intergenic
939514060 2:143144218-143144240 ATGAATATACACATGCATAAAGG + Intronic
940127959 2:150348254-150348276 CTGTATATACAAATGACCAAAGG + Intergenic
940178818 2:150908789-150908811 CTGAATATACAAGTGAACAATGG - Intergenic
941908164 2:170737049-170737071 CTGAATATACATACAGACAATGG + Intergenic
942303341 2:174583531-174583553 TAGAATATAGAGATGAAGAAAGG - Intronic
942413192 2:175732981-175733003 CTGACTTTACAAATGAAGAAAGG + Intergenic
942718453 2:178921862-178921884 CTGAACAGACAGAAGAAGAAAGG - Intronic
943156835 2:184190478-184190500 CTGATAATGCAGATGAATAATGG + Intergenic
943532813 2:189107346-189107368 ATGAAGATACAGTTGAATAAAGG + Intronic
943768301 2:191687309-191687331 ATGAATATGCATATGAACAAAGG - Intronic
943936945 2:193931433-193931455 ATGAAAATATAGATGAATAAGGG + Intergenic
943977011 2:194495454-194495476 ATGAATATAATGATGAACTATGG - Intergenic
944779078 2:202999051-202999073 GTGAATAATCAGATGAAAAATGG - Intronic
944782270 2:203031917-203031939 CTGATCACACAGATCAACAATGG - Intronic
945279925 2:208026348-208026370 CTGAATAAATGAATGAACAAAGG + Intergenic
945501566 2:210581972-210581994 CTCAAGATACAGCTGAAAAAAGG + Intronic
945567281 2:211416451-211416473 CTGAATATACAAAGGGACAATGG + Intronic
948580481 2:238984398-238984420 CTGACTACACAGATGGACACTGG - Intergenic
1169045618 20:2532546-2532568 CTCGATATACAGATGAACAGTGG + Intergenic
1169229032 20:3874792-3874814 CTGAACATACAACTGGACAATGG - Exonic
1169753035 20:9014906-9014928 CTGACAAAACAGATGAACAAAGG + Intergenic
1169875398 20:10291786-10291808 ATGAAAATACAGATGAAAAGAGG + Intronic
1170563609 20:17579995-17580017 CAGAATATAAAGATGAATACAGG - Intronic
1170590636 20:17768751-17768773 ATAAATAAACAGATGAAAAAGGG + Intergenic
1170819410 20:19743658-19743680 CTGAATATATAAAGGGACAATGG + Intergenic
1171723354 20:28589616-28589638 CTGAATAGAAAAATGGACAAGGG - Intergenic
1171754702 20:29093468-29093490 CTGAATAGAAAAATGGACAAGGG + Intergenic
1171859988 20:30390330-30390352 CTGAATAGAAAAATGGACAAGGG + Intronic
1172601390 20:36186011-36186033 GTGCATATACAGGTGAAAAATGG - Intronic
1173791382 20:45829905-45829927 TTGAATAAACAAAAGAACAAAGG - Intronic
1173794606 20:45850534-45850556 CTGAATATACAAACAGACAATGG - Intronic
1173965672 20:47110717-47110739 TTGAATAAACAAATAAACAAAGG + Intronic
1174935083 20:54858598-54858620 CTGAATATACAGGGGAATACTGG - Intergenic
1175358829 20:58390921-58390943 CTGAATTTACAGAGAACCAAAGG + Intronic
1175504788 20:59473953-59473975 CTGAATATACAAATGGACCATGG - Intergenic
1175534849 20:59702374-59702396 CTGAATAAAAAGAAGAAAAAAGG - Intronic
1175880926 20:62258554-62258576 CAGAAAATACAGATGAGCAAAGG - Intronic
1176524285 21:7853688-7853710 CTAAATATACAAATGGACAATGG - Intergenic
1176994807 21:15543190-15543212 CTAAATATATATTTGAACAAAGG - Intergenic
1177093785 21:16805277-16805299 ATAAATAAACAGATGAAAAAAGG + Intergenic
1177488053 21:21784153-21784175 CTGACTCTACAGATCAATAATGG + Intergenic
1177650889 21:23961010-23961032 CTGAATATACAAAGGGACAATGG - Intergenic
1177671558 21:24237307-24237329 CTGATTCTACAGATCAATAATGG + Intergenic
1178658305 21:34483701-34483723 CTAAATATACAAATGGACAATGG - Intergenic
1179010414 21:37552028-37552050 CTGAACATACAAATGGACAATGG + Intergenic
1179559052 21:42201201-42201223 CTGCAAATACAGATTAACATTGG - Intronic
1179650809 21:42807359-42807381 CTGAATATACAAATGAACAATGG - Intergenic
1180296907 22:10948273-10948295 CTGAATAGAAAAATGGACAAGGG - Intergenic
1184964620 22:47962138-47962160 TTGAATATACAGATGAATCTGGG - Intergenic
951811358 3:26703752-26703774 CTGAATATACAAACGGACAGTGG - Intronic
953097503 3:39792979-39793001 CTGAATTTACAAATGGACAATGG - Intergenic
953375449 3:42424383-42424405 CTGAATATATAAATGGATAATGG - Intergenic
953439213 3:42903859-42903881 TTGAATATACAAATGGGCAATGG + Intronic
953578477 3:44132268-44132290 CAGCATTTACAGATGAGCAATGG - Intergenic
953813821 3:46136779-46136801 CCCAATTTAAAGATGAACAAAGG - Intergenic
954605194 3:51904154-51904176 ATGAATATAAAGAAGAAAAAAGG + Intergenic
954896172 3:53976887-53976909 CCGAATATCCAGACAAACAATGG - Intergenic
955895011 3:63689558-63689580 CTGAATATACAAATGAACAATGG - Intergenic
956010349 3:64824213-64824235 CGGAATATAAAGATGAACAGGGG + Intergenic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956697890 3:71934152-71934174 CTGAATATACAAATAGACCATGG + Intergenic
956867611 3:73384931-73384953 CTGCATAAACACAAGAACAAAGG + Intronic
957430442 3:80098627-80098649 CACAATATATAAATGAACAAGGG + Intergenic
957514449 3:81232548-81232570 CTGTATAGCCACATGAACAAGGG - Intergenic
957682189 3:83451275-83451297 CTGTATATGCAAATAAACAATGG + Intergenic
959710574 3:109381921-109381943 CTGAATGTACAAATGAAAAATGG + Intergenic
959793478 3:110393473-110393495 CTGAATCTATAGATAAAGAAGGG - Intergenic
960073272 3:113455632-113455654 CAGAATATGCAGATGAAAATGGG - Intronic
960475990 3:118129547-118129569 CTGAATATACACATTGACAGTGG + Intergenic
961471931 3:127120612-127120634 CTGAATCTACAGGCAAACAATGG - Intergenic
962243474 3:133771336-133771358 CTGATTAAACAAATGAAGAAGGG + Intronic
964314054 3:155424635-155424657 CTAAATATACAGATGGACAATGG + Intronic
964975036 3:162607612-162607634 TTGAATACACAGATGCACAGAGG - Intergenic
965247482 3:166292166-166292188 CTGAACATCCAGAGGAACAGAGG - Intergenic
965362416 3:167757594-167757616 CTGTATATTCAAATGAACCAGGG + Intronic
965742701 3:171892595-171892617 CTGAATTTCCAGATGGAGAAAGG - Intronic
966056684 3:175701419-175701441 CTGAATATACAAATTGACGATGG - Intronic
967498469 3:190169103-190169125 CTGAATCTACAGTTTAAAAAAGG + Intergenic
967507821 3:190272989-190273011 CTGAATGTACAAATGAACAATGG - Intergenic
968537519 4:1143834-1143856 CTGAATATATAAAGGAACACGGG + Intergenic
969598909 4:8164177-8164199 CTGTATTTAGAGATGAAGAAAGG - Intergenic
969964674 4:10982062-10982084 TTGAATAAATAGATGAACAAAGG - Intergenic
970124125 4:12790225-12790247 TAGAATAAAAAGATGAACAAAGG - Intergenic
970301791 4:14689067-14689089 CTGCAGATACAGATGTACATAGG - Intergenic
970314248 4:14814374-14814396 CTGAATTTACAGATAATCAATGG + Intergenic
970341516 4:15112268-15112290 TTGATTTTACAGATGAAGAAAGG + Intergenic
970438631 4:16060166-16060188 CTGAAAATTCAGAAGTACAAAGG - Intronic
970632760 4:17969712-17969734 CTGAGTTTACGAATGAACAAAGG - Intronic
971202814 4:24528122-24528144 ATTAATATACTGATGAACCAAGG + Intronic
971224893 4:24742898-24742920 CTGAATGTACACGTGAACAGTGG + Intergenic
971272455 4:25163343-25163365 CTGACTATACAAATGGACAATGG + Intronic
971299485 4:25430001-25430023 CTGAGTATACAAATGGACAATGG - Intergenic
972112570 4:35583324-35583346 CTGAAAAAACTGATGAACAAAGG - Intergenic
972694125 4:41427978-41428000 CTGAATACACAGAGGTAAAAAGG - Intronic
973587917 4:52410837-52410859 GTGAATATATAAATGGACAATGG - Intergenic
974201227 4:58643370-58643392 CTGAATTTGCCTATGAACAATGG + Intergenic
975189305 4:71441057-71441079 CTGGTTTTACAGATGAAAAAAGG + Intronic
976775602 4:88702869-88702891 CTGAATATTCCTATGGACAATGG + Intronic
976866794 4:89738159-89738181 TTGAATATACTAATGCACAAAGG + Intronic
977231855 4:94460986-94461008 GTGAATACACAGTTGAACAGTGG + Intronic
977910147 4:102524891-102524913 CTGTATATACAGATGAAGCTTGG + Intronic
977967214 4:103167462-103167484 TTGTATATACATATGAAAAATGG + Intronic
978316127 4:107439479-107439501 CTGCAAATACAGATTAACATTGG - Intergenic
978329405 4:107596454-107596476 CAGAAAATACATATGAACTAGGG + Intronic
979425317 4:120557242-120557264 CTGAAAATTCAGATGTGCAATGG - Intergenic
979623458 4:122821330-122821352 CTGCAAATACAGATTAACATTGG - Intergenic
979781454 4:124656014-124656036 CTGAATCTACAGATAAACTGCGG - Intergenic
979990467 4:127368975-127368997 CTGAATACACAGAAGAAAACAGG + Intergenic
980140845 4:128914666-128914688 CTGACTATAGAGGTGCACAAAGG + Intronic
980734360 4:136866167-136866189 TTGAATATAAAAATGAAGAAAGG - Intergenic
981340875 4:143619977-143619999 CTGAATATACAGATGGAAAATGG + Intronic
982039959 4:151387556-151387578 CTGCAAATACAGATTAACATTGG - Intergenic
982270432 4:153580512-153580534 CTAAATATACACAGGAACACTGG - Intronic
982387787 4:154831099-154831121 CTGAATAGGCAGATGACAAATGG + Intergenic
983647133 4:170003420-170003442 CTCAATACACAGATGAAGGAGGG + Intronic
984042945 4:174759513-174759535 TTGAATATAAAGATGAGCACTGG - Intronic
984494138 4:180473148-180473170 CTGAACATAAAAATCAACAAAGG - Intergenic
986399474 5:7366417-7366439 ATGGATATACAGATGGAAAAGGG - Intergenic
986779418 5:11050575-11050597 CTGAATATGCAAATGGACAATGG + Intronic
987532278 5:19136811-19136833 CTGATTAAATAGATCAACAAGGG + Intergenic
987819634 5:22946331-22946353 CTGAATCTACAGAGGAACTTGGG + Intergenic
987904488 5:24058369-24058391 CTGAATACACAGTTGAGAAAAGG + Intronic
987949032 5:24652379-24652401 CTGAAAAAACAGATGGAAAAGGG + Intergenic
988675292 5:33427303-33427325 CAGAATATACATAGGAATAAAGG - Intergenic
988897978 5:35698827-35698849 CTCAAACTACAGCTGAACAAAGG + Intronic
989459626 5:41682578-41682600 ATGAATAAACAAATGATCAATGG + Intergenic
990598669 5:57335770-57335792 GTGAATTTACAGAGAAACAAAGG + Intergenic
992169216 5:74085687-74085709 ATGAATATACAGATTATAAATGG - Intergenic
992202540 5:74398615-74398637 CTGAATATGAAGAGGAACAGAGG - Intergenic
993028779 5:82678873-82678895 CTTAATACAAAAATGAACAATGG + Intergenic
993453346 5:88099116-88099138 CTGACTTTAGAGATGAATAAAGG + Intergenic
994244703 5:97466702-97466724 CTGAAGAGAGAGAGGAACAAAGG - Intergenic
994572627 5:101533581-101533603 CTGAATGTACAGAATAAGAAAGG - Intergenic
994780866 5:104088417-104088439 TTGAATCTGCAGATGAAGAATGG - Intergenic
995217550 5:109612961-109612983 TAGAAAATACAGATGAATAAAGG - Intergenic
995963287 5:117872137-117872159 TTGCTTATACAAATGAACAATGG + Intergenic
996662714 5:126023004-126023026 CTGAATATACAAATGAAAAATGG - Intergenic
996670892 5:126115572-126115594 CTGAATATACAAATGGACAGTGG - Intergenic
997684638 5:135780077-135780099 CTTAATATACAGGGGAAAAAAGG + Intergenic
998379712 5:141715641-141715663 CTAAAAATACAGAGGAGCAAGGG - Intergenic
998674512 5:144391996-144392018 GTGAATTTACAGAGGAAGAAAGG + Intronic
999054502 5:148559588-148559610 CTAAACATACAAATGGACAATGG + Intronic
999625492 5:153516451-153516473 CTGATTTTACCAATGAACAAAGG + Intronic
999927543 5:156395587-156395609 CTGAATATACAAATGGATGATGG - Intronic
1000544835 5:162586006-162586028 TTTAATATACACATGCACAAAGG - Intergenic
1000766171 5:165293088-165293110 CTGAATATACAGTTCAACTGGGG - Intergenic
1000846612 5:166289568-166289590 CAGGATATACAGATGAATAAGGG + Intergenic
1001782059 5:174377571-174377593 ATGAATATATAGTTGCACAATGG + Intergenic
1002758886 6:186562-186584 CTGAAAACACAGAAGTACAAAGG + Intergenic
1003730350 6:8815050-8815072 CTGTATATACACATTAACAAAGG - Intergenic
1004332419 6:14734069-14734091 CTGAATATACAAATGGACAACGG + Intergenic
1005215030 6:23516034-23516056 CTTAATATAAAGTGGAACAAAGG + Intergenic
1005247220 6:23901102-23901124 CTGTATATACTGAAAAACAAAGG + Intergenic
1005583878 6:27257743-27257765 TTGAATATACAAATGGATAATGG - Intergenic
1005795223 6:29353339-29353361 CTGAATAAATATATGAACATGGG - Intergenic
1007150062 6:39681376-39681398 ATGAAAATATACATGAACAAGGG - Intronic
1008876481 6:56335238-56335260 CTAAATATACAAATGGACAATGG + Intronic
1008952954 6:57180893-57180915 TTGAGTATACAAATCAACAAGGG + Intronic
1009478995 6:64131656-64131678 CTGAATATGCAGATGAAAAATGG + Intronic
1010040173 6:71372449-71372471 CTGAATCTACAGATCAACTTGGG + Intergenic
1010079637 6:71845062-71845084 CGGAATTTAAAGATAAACAAAGG - Intergenic
1010886496 6:81249482-81249504 CAGAATTTTCAGTTGAACAAAGG + Intergenic
1011447870 6:87462209-87462231 CTGAATATACAAATGGACAAAGG - Intronic
1011943725 6:92874345-92874367 CTTAATAGATAAATGAACAAAGG - Intergenic
1012140425 6:95620119-95620141 AAGAATATACTGAAGAACAAAGG + Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1012442671 6:99276081-99276103 CTGCATATAAAGGAGAACAAAGG + Exonic
1013072947 6:106745467-106745489 CTGAATTCACAGCTGAACACAGG - Intergenic
1013078552 6:106792227-106792249 CTGGATAAACAGATGCACAGGGG + Intergenic
1013462636 6:110389963-110389985 CTGAATGTACAAATGGACAATGG - Intergenic
1013661547 6:112302396-112302418 CTAGATATACAGATGAGCCAAGG - Intergenic
1014096192 6:117464787-117464809 GTGAACATACAGAAGAACAAGGG + Intronic
1014236408 6:118960864-118960886 CTGAACATACCCATGCACAAGGG + Intronic
1014593453 6:123302398-123302420 CTGAATATGCAAAGGATCAATGG - Intronic
1014767264 6:125421307-125421329 CTGAATATATAAATGGACAATGG - Intergenic
1015022177 6:128489859-128489881 CTGAAAATGCAGATGCAGAATGG - Intronic
1015276945 6:131392504-131392526 CTCAATTTACCAATGAACAAAGG + Intergenic
1015689366 6:135904344-135904366 CTGATTATACATATGAAAAATGG + Intronic
1016114889 6:140268116-140268138 GTAAATATAATGATGAACAAAGG - Intergenic
1016573153 6:145537288-145537310 TTGAATATACAAATTGACAATGG - Intronic
1016797956 6:148137970-148137992 CTGTATATGCAAATGGACAATGG - Intergenic
1016964986 6:149710499-149710521 CTGAATATACAGATGGACAATGG - Intronic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018968130 6:168504574-168504596 CTGTAAATACAGATGAATACAGG + Intronic
1020985526 7:15129289-15129311 CTGGATATACAACTGAACAATGG - Intergenic
1021259600 7:18438154-18438176 CTGAATATAAACATGAACAAAGG + Intronic
1021880231 7:25088190-25088212 GTGACTATACAGATGATGAAAGG - Intergenic
1022038998 7:26562001-26562023 CTAAATATCCACATGAAAAATGG - Intergenic
1022769011 7:33449076-33449098 ATAAATATTGAGATGAACAAGGG + Intronic
1023497229 7:40810706-40810728 CAGAATAAACAGATGACCTATGG - Intronic
1023576990 7:41638890-41638912 CTCAGTATAAAAATGAACAATGG + Intergenic
1023776424 7:43612045-43612067 CTGAATATACTGAGGAGAAAGGG - Intronic
1023971584 7:44995207-44995229 CTGAATATACAAATAGACAATGG + Intergenic
1024232896 7:47376250-47376272 CCGAATAGACAGATCAACAGAGG + Intronic
1024467210 7:49723862-49723884 CTGGAATTACAGATCAACAAGGG - Intergenic
1024961484 7:54981381-54981403 CTGAGTACACAAATGGACAATGG + Intergenic
1024995305 7:55269656-55269678 CTGAGTACACAAATGGACAATGG + Intergenic
1026080239 7:67211666-67211688 GGGAATTTACAGATGAGCAAGGG - Intronic
1026696849 7:72602337-72602359 GGGAATTTACAGATGAGCAAGGG + Intronic
1027536836 7:79413885-79413907 TGGAATAAACAGATGAATAATGG - Intronic
1027597325 7:80190039-80190061 CTGAATATACAGAATTATAAAGG - Intronic
1028270825 7:88786885-88786907 CTAAATATACAAATGAAAAAAGG + Intronic
1028781899 7:94746754-94746776 CTGAATATACAAATGGACAATGG + Intergenic
1029209899 7:98898630-98898652 CTCAAAATACAGATGGGCAATGG - Intronic
1030419935 7:109296210-109296232 ATGAATAGACAGTTGACCAAGGG + Intergenic
1030634675 7:111935430-111935452 GTGAATAGACAGAAAAACAAAGG + Intronic
1030881326 7:114883393-114883415 AGGAATATGGAGATGAACAAAGG - Intergenic
1030891445 7:115003903-115003925 CTCATTTTACAGATGAAAAACGG - Intronic
1031639834 7:124148537-124148559 CAGAATATATAAATGAGCAATGG - Intergenic
1031692882 7:124812651-124812673 CTGAAAGCACAGATGAACACAGG - Intergenic
1032915960 7:136490314-136490336 CTGAATCTAGAAATGAACTATGG - Intergenic
1034672263 7:152867682-152867704 CTGAATACACAAATGGACAATGG - Intergenic
1034784254 7:153910739-153910761 CTGAATATTAGGATGAACAATGG - Intronic
1036059024 8:5294257-5294279 CTGAAGATTCAGGAGAACAAGGG - Intergenic
1036727101 8:11230167-11230189 ATGAATAAACAAATGAACACAGG + Intergenic
1036990549 8:13588180-13588202 CAGAGAAAACAGATGAACAATGG + Intergenic
1038210520 8:25515287-25515309 CCGAATACTCAGTTGAACAAGGG - Intergenic
1038511112 8:28136430-28136452 CTGAATCTACATTTGAACATGGG - Intronic
1038627523 8:29208631-29208653 CTGAATATTCAAATAGACAACGG + Intronic
1038843867 8:31211044-31211066 CTGAATGTACAAATAGACAATGG + Intergenic
1039781372 8:40789442-40789464 CTGAATATGCAAATGGACAATGG + Intronic
1040522040 8:48186065-48186087 ATGAATATACAGAGCAAGAAGGG - Intergenic
1040627305 8:49163474-49163496 CTAAAGATACAGTTTAACAATGG + Intergenic
1040652239 8:49462269-49462291 CTCATTTTACAGATGAAAAATGG + Intergenic
1040960995 8:53032646-53032668 TTGAAGATACAAATGGACAATGG - Intergenic
1041443914 8:57929437-57929459 CTGAATATACCAATGGATAATGG - Intergenic
1041661497 8:60405753-60405775 CTGACTATAAACATTAACAAAGG + Intergenic
1041724642 8:61006550-61006572 CTGAGCAGACAGATGAAGAAGGG + Intergenic
1042017720 8:64334575-64334597 CTTAATAGATAAATGAACAAAGG + Intergenic
1042209462 8:66365130-66365152 CTGAATACAGAGAGGAACAAAGG - Intergenic
1042791603 8:72613796-72613818 CTGAATTTACAGCAGAAGAAAGG - Intronic
1043235285 8:77857347-77857369 TTGAAAATAAAGATAAACAAAGG + Intergenic
1043359387 8:79453630-79453652 CTAGATATACAGAGTAACAATGG + Intergenic
1043429974 8:80185240-80185262 CTGAATATACAAATGGACATTGG + Intronic
1043860427 8:85310176-85310198 ATGAATGTATAGATGAACTAAGG - Intergenic
1044240671 8:89884869-89884891 CTGAATATGCAAATGGACAATGG + Intergenic
1044605892 8:94047102-94047124 CTGAATATGCAAATGGACAATGG + Intergenic
1045213354 8:100122031-100122053 CTGAATATACAAATGGACAGTGG + Intronic
1045923636 8:107562745-107562767 CTGTATATTCAGAATAACAAAGG - Intergenic
1046793468 8:118346033-118346055 CAGAATAAACAGATGCACCAAGG - Intronic
1047364217 8:124197528-124197550 CTGAATAAATGAATGAACAAAGG + Intergenic
1047906415 8:129477744-129477766 CAGAATTCACAGTTGAACAAAGG - Intergenic
1048839585 8:138553049-138553071 CTGAATATACAGAACAAAATAGG - Intergenic
1048894256 8:138975278-138975300 CTGAATACACAGATGGACAATGG - Intergenic
1050116948 9:2272853-2272875 CTGAATATACAGAGAAACTTAGG - Intergenic
1050483638 9:6111900-6111922 CTGAATATACAAATAAACACTGG + Intergenic
1050980266 9:12002533-12002555 CTGAAAATACAGAAGAATAGTGG + Intergenic
1051001814 9:12291157-12291179 CTGAATATACAAACAAACAATGG - Intergenic
1051014454 9:12458720-12458742 CTGAATATACAAATAGACAATGG + Intergenic
1051498366 9:17750289-17750311 CCGAGAATACAGATGAGCAAAGG - Intronic
1051741529 9:20257181-20257203 CTGTGTATACTGCTGAACAAGGG - Intergenic
1051983570 9:23054848-23054870 CTGGATATCCAGATGCAAAAAGG + Intergenic
1053726747 9:41010739-41010761 CTGAATAGAAAAATGGACAAGGG + Intergenic
1054877422 9:70111452-70111474 CTCATTTTACAGATGAGCAATGG - Intronic
1055778161 9:79789003-79789025 ATAAATATACAAATGAACAATGG - Intergenic
1055953025 9:81748404-81748426 CTGAATTTACATTTGAACTATGG - Intergenic
1056100997 9:83300798-83300820 GTGAATGTACAGATGTACGAAGG + Intronic
1057736769 9:97669844-97669866 CTAAATATTCTGATGAGCAATGG - Intronic
1057741908 9:97719414-97719436 CTGGATAAAAAGATGAAGAAAGG + Intergenic
1058595953 9:106615836-106615858 CTGCATAAGCAGATGAAAAAAGG + Intergenic
1059175996 9:112170663-112170685 CTGAATATACAAATGGACAATGG + Intronic
1060083832 9:120678854-120678876 CTGAACAGACACATGAAAAAAGG + Intronic
1061718477 9:132536722-132536744 CGGAATATCCAAATGGACAATGG - Intronic
1185933727 X:4232239-4232261 CTGTACATAAAGATGAAGAATGG - Intergenic
1188295408 X:28441198-28441220 TTGAATATACAAAGGAACAAGGG - Intergenic
1189162418 X:38823361-38823383 CTGAAGATAAAGATGTAAAAGGG + Intergenic
1189540888 X:41987139-41987161 CTGATTAAAAAAATGAACAAAGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190281051 X:48930380-48930402 GGGAATTTGCAGATGAACAAGGG + Intronic
1192339879 X:70255174-70255196 ATCAATAGTCAGATGAACAAAGG + Intergenic
1192988182 X:76422998-76423020 TTGAATGTACAAATGGACAATGG - Intergenic
1193710890 X:84878363-84878385 CTTAATATGCCAATGAACAATGG - Intergenic
1194001688 X:88437616-88437638 CTGAATACATAAATGGACAATGG + Intergenic
1195279189 X:103313526-103313548 CTGAATTTACAGATGAATTTGGG - Intergenic
1195837350 X:109131939-109131961 CTGGTTAGATAGATGAACAAAGG + Intergenic
1196093498 X:111772879-111772901 CTGAAAATACAAATGACCATTGG - Intergenic
1196578104 X:117345031-117345053 CTGTTTATGCAGATCAACAATGG + Intergenic
1197221029 X:123914183-123914205 ATGTATATATATATGAACAATGG + Intergenic
1197397856 X:125949478-125949500 CCGAATATACAGATAATCAATGG - Intergenic
1197634365 X:128898144-128898166 CTGAATATAGAGCAGAGCAAAGG + Intergenic
1199560175 X:149153262-149153284 CTAAATGAACAAATGAACAAAGG - Intergenic
1200841794 Y:7789243-7789265 CTGAATAGACATATCACCAAAGG - Intergenic
1201315650 Y:12643070-12643092 CTGAATATACAAATGGACATTGG + Intergenic
1201603817 Y:15763100-15763122 CTGAATACACAGAACAACACAGG + Intergenic