ID: 1107039808

View in Genome Browser
Species Human (GRCh38)
Location 13:35936804-35936826
Sequence GCATCTGAGGCCAATAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 160}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107039808 Original CRISPR GCATCTGAGGCCAATAGGGA GGG Intronic
901770055 1:11525386-11525408 GCAGCCCTGGCCAATAGGGAGGG + Intronic
905167240 1:36089861-36089883 GGATCTGAGCCCACAAGGGAAGG - Intronic
906716870 1:47976696-47976718 GCACCTGAGGTAGATAGGGATGG + Intronic
907193228 1:52665816-52665838 GCCTGTGAGGCCATCAGGGAGGG - Intronic
909486368 1:76178863-76178885 GCATCCAAGGCCAATGGGTAAGG - Intronic
909532275 1:76694326-76694348 ACACCTGGGGCCTATAGGGATGG + Intergenic
910051083 1:82974782-82974804 GCATTTGAAGCAAATTGGGAAGG - Intergenic
910749991 1:90618842-90618864 GCATCTGAAGCAAATTGGAAAGG - Intergenic
912509699 1:110180502-110180524 GCAAGTGAGGCCAATGGTGATGG + Intronic
919895073 1:202004589-202004611 TCATCTGAGGCACAGAGGGAGGG + Intronic
920205293 1:204286849-204286871 GCATTTGAGGCCAAGAAAGAAGG - Intronic
920207348 1:204302197-204302219 GAATCTGAGGCCCAGAGAGAAGG + Intronic
920284706 1:204871089-204871111 GGATGAGAGGCCAAGAGGGAGGG - Intronic
921168638 1:212526087-212526109 GCATCAGAGGCCAAAAGGATAGG - Intergenic
923554563 1:234990576-234990598 GAAGCTGAGGTCATTAGGGAGGG - Intergenic
924773126 1:247093956-247093978 GCATTTGAAGCCAATTGGAAAGG + Intergenic
1067523933 10:47027232-47027254 GATCCTGAGGCCAATGGGGAAGG + Intergenic
1067962184 10:50866494-50866516 GCACCTGAGGCCAACAGGGTCGG - Intronic
1069962050 10:72085093-72085115 GCATCTAGGGCCTAGAGGGATGG - Intronic
1070729279 10:78814111-78814133 GCATGTGGGGCCTATAGGGATGG + Intergenic
1071683198 10:87728413-87728435 GAAACTGAGGCCCAGAGGGAGGG - Intronic
1075732586 10:124645172-124645194 GCACCTGAGGCCTCCAGGGAGGG - Intronic
1076896169 10:133313395-133313417 GGATCTGATGCCCACAGGGAGGG + Intronic
1077179802 11:1207225-1207247 GCATCTGAGGCCTCCAGGGTGGG - Intergenic
1078320991 11:10334499-10334521 GCATCTCAGGTCAAGAGAGAAGG + Intronic
1078590835 11:12639683-12639705 ACCTCTGATGCCAATGGGGAAGG - Intergenic
1083287470 11:61669596-61669618 TCCTCAGAGGCCAACAGGGAAGG + Intergenic
1083484392 11:62974336-62974358 GCATCTGAGGCCACTCTGGTGGG + Intronic
1084014154 11:66368914-66368936 GAAACTGAGGCCCACAGGGAGGG - Intronic
1084611789 11:70207840-70207862 GTTTCTGAGGCCAACAGGGCAGG - Intergenic
1084870790 11:72097473-72097495 GACTCTGAGGCCAACAGAGAGGG + Exonic
1089134434 11:116237999-116238021 GCAGCTGAGGCCTAGAGAGATGG - Intergenic
1089683424 11:120132235-120132257 GCCTCAGAGGACAATGGGGAGGG - Intronic
1090216459 11:124969976-124969998 CGATCTTAGACCAATAGGGAAGG - Intronic
1093198319 12:16156184-16156206 GAATCAGAGGCCAAGAGAGAAGG + Intergenic
1096155824 12:49341066-49341088 GTATGTGAGGCCAAAAGGGTTGG + Intergenic
1099295234 12:80821738-80821760 GCAGCTGAGCCCAAGAGGGTGGG - Intronic
1102653127 12:114457438-114457460 GAAACTGAGGCCAAGAGAGAGGG - Intergenic
1104637467 12:130447216-130447238 GCCGCGGAGGCCAAGAGGGAAGG + Intronic
1104803068 12:131568038-131568060 GCAGGTGAGCACAATAGGGAGGG - Intergenic
1107039808 13:35936804-35936826 GCATCTGAGGCCAATAGGGAGGG + Intronic
1107102276 13:36606335-36606357 GCATCTGAAGGCAATGGGGGTGG + Intergenic
1113767306 13:112889359-112889381 GCACCTGGGGCCAAGAGAGAGGG + Intergenic
1117256177 14:53980387-53980409 GCATCTGAGCCCCAGAAGGAAGG + Intergenic
1119170419 14:72530763-72530785 GGCTCTGAGACCATTAGGGATGG + Intronic
1119207206 14:72803266-72803288 GCTTCCAAGGCCAATAGGCATGG + Intronic
1121709916 14:96030226-96030248 GCAGTTGAGGCCAGCAGGGATGG - Intergenic
1121729675 14:96177677-96177699 GCAACTGAGGCCCAAGGGGAGGG - Intergenic
1121805746 14:96820286-96820308 GCATTTGAAGCAAATTGGGAAGG - Intronic
1122984463 14:105205810-105205832 GCAGCTCAGGCCAGTGGGGAGGG + Intergenic
1126054410 15:44716145-44716167 GTATCTGAGGCTAGTAGGAAGGG + Intronic
1128087721 15:64897417-64897439 GCAGCTGAGGCCACGAGTGAAGG - Intronic
1129156431 15:73721250-73721272 TGACCTGAGACCAATAGGGAGGG + Intergenic
1136074858 16:27810074-27810096 GCATCTGGTGCCAACAGAGAAGG - Intronic
1139480252 16:67226747-67226769 TCTTCTGGGGCCGATAGGGAAGG + Intronic
1141009675 16:80385817-80385839 GAAACTGAGGCCAAGAGGGAAGG + Intergenic
1143614626 17:8042510-8042532 GCATCTGAGGCCCAGGGGCAGGG - Intronic
1147791673 17:43017790-43017812 GCATGTGAGGGCAGGAGGGAGGG - Intronic
1148110673 17:45143424-45143446 GCCTCTGCAGCCAAGAGGGAGGG - Exonic
1149037232 17:52148609-52148631 AGATCTGAGGCCATGAGGGAGGG - Intronic
1149285092 17:55154153-55154175 GACTCTGAGGCCATTAGGGAGGG - Intronic
1149792592 17:59492342-59492364 TCATCAGAGGCCAATCAGGAGGG + Intergenic
1151215510 17:72574265-72574287 GCAGCAGAGGGCAATGGGGATGG - Intergenic
1151450028 17:74193020-74193042 TCATCTGAGGCCATCAGGCAGGG + Intergenic
1154229545 18:12542575-12542597 AAATATCAGGCCAATAGGGAAGG - Intronic
1156517051 18:37688896-37688918 GCTTCTTGGGCCAATAAGGAGGG + Intergenic
1156692746 18:39728046-39728068 GGATATGAGGCTAATAGGAAAGG - Intergenic
1158738398 18:60110545-60110567 CCATCTGAGGACAATAAAGAGGG + Intergenic
1159714552 18:71805525-71805547 TCATCTGAGGCCAATAAAGAAGG + Intergenic
1160920648 19:1518673-1518695 GCGTCTGAGGACAAATGGGAAGG + Intergenic
1161301630 19:3545495-3545517 GCATTCCAGGCCAATGGGGAGGG - Intronic
1164859164 19:31549054-31549076 GCCTCTGAAGACAATAAGGATGG + Intergenic
1166259185 19:41626218-41626240 GGATCTGAGGGCAGTGGGGAGGG - Intronic
1166276251 19:41756328-41756350 GGACCTGAGGCCAGTGGGGAGGG + Intronic
1166281513 19:41797350-41797372 GGATCTGAGGGCAGTGGGGAGGG + Intronic
926394649 2:12428464-12428486 GCATGTGAGGCCCAGTGGGAAGG - Intergenic
929955749 2:46457173-46457195 ACATGGGAAGCCAATAGGGAAGG - Intronic
931508165 2:62956082-62956104 GAGACTGAGGCCAATAGGCAAGG + Intronic
932356076 2:71069199-71069221 GCATGGAAGGCCAACAGGGATGG - Intronic
933990777 2:87632599-87632621 GAAACTGGGGCCAATAGGCAGGG + Intergenic
935250266 2:101254482-101254504 GCATCTCAGGCCAATACAAAGGG - Intronic
936303065 2:111318224-111318246 GAAACTGGGGCCAATAGGCAGGG - Intergenic
936501462 2:113070151-113070173 TCATTTGAGGAAAATAGGGAGGG + Intronic
938303561 2:130232602-130232624 GCATCTAAAGCCAATTGGGTTGG - Intergenic
938453117 2:131441658-131441680 GCATCTAAAGCCAATTGGGTTGG + Intergenic
939682222 2:145151766-145151788 GCATTTGAAGCAAATTGGGAAGG + Intergenic
944213274 2:197228563-197228585 GCATCTGGGGCCCCTAGAGATGG - Intronic
946234900 2:218318119-218318141 ACCTCTCAGGCCAGTAGGGAAGG + Intronic
1169900890 20:10550675-10550697 GCAGATGGGGCCAATAGGGCAGG - Intronic
1172872045 20:38142021-38142043 GGATCGGAGCCCAGTAGGGAGGG - Intronic
1173151161 20:40567726-40567748 GCAAATGAGGTCAATAGGGTTGG + Intergenic
1173196779 20:40920592-40920614 GCATGTGAGGTCAATAGGTTTGG - Intergenic
1173565451 20:44035288-44035310 GCTTCAGAGGCCAGCAGGGATGG - Intronic
1175401710 20:58703763-58703785 GCAGCTGTGGCCTCTAGGGAAGG - Intronic
1175430863 20:58902123-58902145 GAAACTGAGGCCAAGAGGGGGGG - Intronic
1179286728 21:39983901-39983923 GCTTCAGAGGACAATGGGGAAGG - Intergenic
1179458691 21:41518367-41518389 GCATCTGATGGCATTTGGGAAGG - Intronic
1179522041 21:41952062-41952084 GGATGTGAGGCCAACAGGGGTGG + Intronic
1182795358 22:32987687-32987709 GCCTCTGAGAACAATAGAGAAGG + Intronic
1184104560 22:42359934-42359956 GCAACTGAGGCCCAGAGAGAGGG + Intergenic
1184879535 22:47296219-47296241 GAAACTGAGGCCCAGAGGGATGG - Intergenic
949694038 3:6673649-6673671 GCATTTGAGGCAAATTGGAAAGG + Intergenic
951711077 3:25585315-25585337 GCAGCTGAGGCCCAAGGGGAAGG + Intronic
952954718 3:38549779-38549801 GCATCTCAGGTCAAGTGGGAGGG + Exonic
954368704 3:50159212-50159234 GCATCTGTGGCCAATAAAGTGGG - Intronic
956849564 3:73216585-73216607 GCACCTGAGGGAAAGAGGGAGGG - Intergenic
960483399 3:118221376-118221398 GAATTTGAGGCCAAGAGAGAAGG + Intergenic
961676518 3:128570432-128570454 GCAGCTGGGGCCAATGGGCATGG + Intergenic
961777755 3:129301819-129301841 GCATGTGAGGCGCAGAGGGAGGG + Intronic
961808828 3:129509258-129509280 GCATTTGAAGCAAATTGGGAAGG - Intronic
965044422 3:163557359-163557381 CCATCTGAAGACACTAGGGAAGG + Intergenic
965521161 3:169669171-169669193 GCACCTGGTGCCAATAGGCACGG - Intergenic
967235863 3:187383089-187383111 TCAGCTGAGGCCAAAAGGCACGG + Intergenic
967316372 3:188154635-188154657 GCAGCTGAGGCCCAGAGAGAAGG + Intronic
969092615 4:4706575-4706597 GCATCTGAGGCCCAGCAGGATGG + Intergenic
970717852 4:18948132-18948154 GCATCTGACGCCAGTCAGGATGG - Intergenic
971931595 4:33090861-33090883 GCCTCTGAGGCCAAAAGCTATGG - Intergenic
973031562 4:45348430-45348452 CCATCTCACGCCAATTGGGATGG + Intergenic
974671449 4:65035630-65035652 CCACATGAGGCCAATAGAGAAGG - Intergenic
984089771 4:175358391-175358413 GCATCTGAAGCAAATTGGAAAGG + Intergenic
984734404 4:183097674-183097696 GCATCTGCGGCCAATCTCGAAGG - Intergenic
997786560 5:136718966-136718988 CCATCTGAGCCCAAAAAGGAAGG + Intergenic
999696808 5:154194454-154194476 AAATCTGATGCCACTAGGGAAGG + Intronic
999706029 5:154273034-154273056 TCAGCTGAGGCCAAGAGGGCAGG + Intronic
1000405920 5:160888322-160888344 GCAGCAGAGGCCAAGAGAGAAGG + Intergenic
1000595560 5:163211536-163211558 GCATGTAAAGCAAATAGGGATGG - Intergenic
1002621013 5:180488270-180488292 GCATCAGATGGCAACAGGGATGG + Intergenic
1009040108 6:58165881-58165903 CCATCTCAGGCCATTAGAGAAGG + Intergenic
1010580206 6:77587153-77587175 GCATTTGAAGCAAATTGGGAAGG + Intergenic
1011355021 6:86465080-86465102 GCATCTCAGGCCAATTAGAATGG + Intergenic
1017975239 6:159351213-159351235 GCATTAGCTGCCAATAGGGAGGG + Intergenic
1018172276 6:161152397-161152419 GCAGCAGAGGCCAGCAGGGAGGG + Intronic
1018995572 6:168707528-168707550 GCAACTGAAGCAAATGGGGAGGG - Intergenic
1022024080 7:26429465-26429487 GCCTCTGAAGCCAGTGGGGAAGG - Intergenic
1022230089 7:28406164-28406186 CCATCTGAGGCCTCTTGGGATGG + Intronic
1024797053 7:53033385-53033407 CCATCTGAGGACATTAGAGAAGG - Intergenic
1025113950 7:56241987-56242009 CCATCTCAGGCCAATCAGGATGG - Intergenic
1026809048 7:73446938-73446960 GCATATGGGGACAATGGGGAAGG - Intronic
1031214579 7:118873806-118873828 TCATCTGAGGCCATTAGCAAAGG + Intergenic
1032921200 7:136550249-136550271 GCATCTGAAGGAAACAGGGATGG - Intergenic
1034479424 7:151308240-151308262 CCCTCTGAGGGCACTAGGGAAGG - Intergenic
1035062870 7:156082170-156082192 GCATCAGAGGCCCAGAGGGCAGG - Intergenic
1035298018 7:157877709-157877731 GGCTCTGAGGCCCACAGGGAGGG - Intronic
1036219031 8:6905227-6905249 GCATCTGAAGCAAATTGGAAAGG - Intergenic
1037765587 8:21770500-21770522 GAAACTGAGGCCCAGAGGGAAGG - Intronic
1040941851 8:52842461-52842483 GTATCTGAGGACAATGGGGGAGG + Intergenic
1043018529 8:74970808-74970830 GCATCTGTGGCTCAGAGGGAAGG - Intergenic
1043349356 8:79341548-79341570 TCATCTGGGGCCAACAGAGAAGG - Intergenic
1045520202 8:102896756-102896778 GCATCTGAGACTAATAGGACTGG - Intronic
1045996348 8:108366852-108366874 GCATCTAAGGGGGATAGGGAGGG - Intronic
1046053621 8:109053431-109053453 GGATCTAAGAGCAATAGGGAAGG - Intergenic
1047909645 8:129514033-129514055 GCATCTGTGGCCAAGTGGCAGGG - Intergenic
1048062914 8:130938767-130938789 GCATCTGGGCCCATTTGGGAAGG - Intronic
1049572795 8:143377555-143377577 GAAACTGAGGCCCAGAGGGAGGG + Intronic
1052345005 9:27400520-27400542 TCACCTGAGGACATTAGGGAAGG - Intronic
1056792892 9:89637727-89637749 GCCTATGTGGACAATAGGGAGGG - Intergenic
1057915173 9:99049783-99049805 CCAGCTTAGGCCAATCGGGAAGG - Intronic
1059260572 9:112972169-112972191 AAATCTGAGGCCTATAGGGGAGG + Intergenic
1060940977 9:127542657-127542679 GCACCTGAGGCCAGCAGGGGGGG - Intronic
1061303486 9:129719524-129719546 GCATCTGAGGCCAGGAGGACGGG + Intronic
1062011720 9:134270786-134270808 GCATCTGAGGAACAGAGGGAAGG + Intergenic
1186368927 X:8926722-8926744 TAATCTAAGCCCAATAGGGAAGG + Intergenic
1188177538 X:27010254-27010276 GCATTTGAGGCAAATTGGAAAGG - Intergenic
1192204769 X:69088565-69088587 GAAACTGAGGCCACTAGAGAAGG + Intergenic
1194348179 X:92792846-92792868 GCATCTCTGGGCACTAGGGAAGG + Intergenic
1200656508 Y:5909475-5909497 GCATCTCTGGGCACTAGGGAAGG + Intergenic