ID: 1107052182

View in Genome Browser
Species Human (GRCh38)
Location 13:36062901-36062923
Sequence TTGCAGATGACACTTGGGTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1009
Summary {0: 1, 1: 0, 2: 1, 3: 36, 4: 971}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107052182_1107052186 17 Left 1107052182 13:36062901-36062923 CCTGACCCAAGTGTCATCTGCAA 0: 1
1: 0
2: 1
3: 36
4: 971
Right 1107052186 13:36062941-36062963 CCTGAGATGACCATAATGCAAGG 0: 1
1: 0
2: 0
3: 13
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107052182 Original CRISPR TTGCAGATGACACTTGGGTC AGG (reversed) Intronic
900628243 1:3619454-3619476 TTGGAGATGACATTTGGGTGGGG - Intergenic
900634739 1:3657462-3657484 TTGCAGATGCCACTTAGGTAAGG - Intronic
900822092 1:4897629-4897651 TTCAAGATGAGACTTGGGTGGGG - Intergenic
900825129 1:4920274-4920296 TTCAAGATGAGACTTGGGTGGGG + Intergenic
901181209 1:7342947-7342969 TTGCAGAGGGCACTTGTCTCAGG - Intronic
901355108 1:8639348-8639370 TTGCAGTTGGCATTTAGGTCAGG - Intronic
901439267 1:9267646-9267668 TTGCAGAAGGCACTTGATTCTGG - Exonic
904044239 1:27600672-27600694 TGGCAGAAGACATTTGGGTAGGG - Intronic
904573894 1:31489593-31489615 TTCAAGATGACATTTGGGTGGGG - Intergenic
904955878 1:34283483-34283505 TTGGAGATGACATTTGGGCAGGG - Intergenic
905047282 1:35015805-35015827 TAGCAGATGAAACTTGGTTGGGG - Intronic
906186665 1:43867265-43867287 TTCAAGATGAAACTTGGGTGGGG + Intronic
906833352 1:49058225-49058247 TTCCAGATGAAATTTGGGTGGGG - Intronic
906857242 1:49321058-49321080 TTGAAGATGAAAATTGGGTGGGG + Intronic
906894791 1:49758906-49758928 TTCCAGATGAGATTTGGGTGGGG - Intronic
907721029 1:56972423-56972445 TTCAAGATGACATTTGGGTGGGG - Intergenic
907808908 1:57849080-57849102 TTGCAGCTGAAACTTGGGACAGG + Intronic
907890769 1:58634754-58634776 TTCCAGATGAGACTTGGGTGGGG - Intergenic
907970707 1:59378175-59378197 TTGAAGATGAAATTTGGGTGGGG - Intronic
908427972 1:64026876-64026898 TTCCAGATGACATTTGGGTGGGG + Intronic
908948376 1:69527480-69527502 TTGGAGATGAGATTTGGGTGGGG - Intergenic
908978978 1:69930952-69930974 TTCAAGATGAGATTTGGGTCAGG + Intronic
909105296 1:71398765-71398787 TTCCAAATGAGACTTGGGTGGGG - Exonic
909352227 1:74667824-74667846 TTGAAGATGAGATTTGGGTGGGG - Intronic
909440464 1:75690408-75690430 TTTGAGATGAGACTTGGGTGGGG + Intergenic
910380105 1:86617262-86617284 TTCAAGATGAGACTTGGGTGGGG + Intergenic
910546105 1:88420906-88420928 TTCCAGATGAGATTTGGGTGGGG + Intergenic
911120049 1:94287223-94287245 TTCCAGATGAGATTTGGGTGGGG - Intergenic
911200119 1:95036161-95036183 TTCAAGATGAGACTTGGGTGGGG - Intronic
911472708 1:98337711-98337733 TTCAAGATGACATTTGGGTGGGG + Intergenic
911678133 1:100682761-100682783 GTGCAGATGACACTTAGCTTTGG + Intergenic
911704063 1:100990318-100990340 TTCAAGATGAGACTTGGGTGGGG + Exonic
911848600 1:102785125-102785147 TTCCAGATGAGATTTGGGTAGGG + Intergenic
911850354 1:102811039-102811061 TTGAAGATGAGATTTGGGTGGGG + Intergenic
912043163 1:105417451-105417473 TTCAAGATGAGACTTGGGTGGGG - Intergenic
912405720 1:109435827-109435849 TTGAAGATGAGATTTGGGTGGGG + Intergenic
912564698 1:110579309-110579331 TTGGACATGACACCTGGGACTGG + Intergenic
913286887 1:117234643-117234665 TTCAAGATGACATTTGGGTGTGG + Intergenic
913307911 1:117451541-117451563 TTGAAGATGAGATTTGGGTGGGG - Intronic
913488393 1:119355267-119355289 TTGCACAGGACACTTTAGTCAGG - Intergenic
913668522 1:121072376-121072398 TTGAAGATGAGATTTGGGTGAGG + Intergenic
914020266 1:143859819-143859841 TTGAAGATGAGATTTGGGTGAGG + Intergenic
914658766 1:149767731-149767753 TTGAAGATGAGATTTGGGTGAGG + Intergenic
915696871 1:157752180-157752202 TTCCAGATGAGATTTGGGTGGGG - Intronic
915873889 1:159591819-159591841 TTTAAGATGAGATTTGGGTCAGG - Intergenic
916429771 1:164716422-164716444 TTGCTGCTGGCACTTAGGTCTGG - Intronic
916494120 1:165329325-165329347 TTCAAGATGAGACTTGGGTGGGG + Intronic
916801525 1:168220751-168220773 TTCCAGATGACATTTGGGTGGGG + Intergenic
916936273 1:169631519-169631541 TTCCAGATGAGATTTGGGTGGGG - Intergenic
917096019 1:171399528-171399550 TTGAAGATGAGATTTGGGTAGGG + Intergenic
917290610 1:173468838-173468860 TTGAAGATGAGATTTGGGTGGGG + Intergenic
917535383 1:175870854-175870876 TCGCAGATGAAACTTGGGCTTGG - Intergenic
917726566 1:177833391-177833413 TTGGAGATGAGATTTGGGTGGGG + Intergenic
918338616 1:183547548-183547570 TTGCAGGTGACACTTCCATCTGG + Intronic
918831712 1:189406530-189406552 TTGAAGATGAGATTTGGGTAGGG + Intergenic
918931568 1:190861688-190861710 TTCCAGATGATATTTGGGTGGGG + Intergenic
919007105 1:191911361-191911383 TTGGAGATGAGATTTGGGTGGGG + Intergenic
919232550 1:194792592-194792614 TTTCAGAAGACATTTGGGTGGGG + Intergenic
919394188 1:197023745-197023767 TTTCAGATGAGATTTGGGTGGGG - Intergenic
919573414 1:199276990-199277012 TTTAAGATGAGACTTGGGTGGGG - Intergenic
919664500 1:200279097-200279119 TTCCAGATGAGATTTGGGGCTGG + Intergenic
920291378 1:204925643-204925665 TAGCAGAAGAAACTTGGGTTGGG - Intronic
920594678 1:207256809-207256831 TTGAAGATGAGATTTGGGTGGGG + Intergenic
921112990 1:212056441-212056463 TTGGAGAGGACACTTGGCTTTGG - Intronic
921438579 1:215157116-215157138 TTGGAGATGAGATTTGGGTGGGG + Intronic
921484795 1:215703272-215703294 TTTCAGAAGACACAGGGGTCAGG + Intronic
922192133 1:223328725-223328747 TAGCTGCTGACACATGGGTCTGG - Intronic
923690944 1:236192352-236192374 TTCCAGATGCCACTGGGGTATGG + Intronic
923719147 1:236452341-236452363 TTTGAGATGAGACTTGGGTGGGG - Intronic
923883577 1:238130550-238130572 TTCGAGATGAGACTTGGGTGGGG - Intergenic
924648659 1:245903702-245903724 TTCCAGATGAGATTTGGGTAAGG - Intronic
924789141 1:247227904-247227926 TTTCAGATGAGATTTGGGTGGGG + Intergenic
924819083 1:247471003-247471025 CTGGAGATGACACTCGGGCCAGG + Intergenic
1062770642 10:97756-97778 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1063065624 10:2605767-2605789 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1063098746 10:2931472-2931494 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1063172035 10:3517649-3517671 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1063260849 10:4387216-4387238 TTTGAGATGACATTTGGGTGGGG + Intergenic
1063549815 10:7020193-7020215 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1063715495 10:8522576-8522598 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1063738885 10:8795117-8795139 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1063909222 10:10812395-10812417 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1064515804 10:16146818-16146840 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1064564053 10:16621825-16621847 TTCAAGATGAGACTTGGGTGGGG + Intronic
1064635995 10:17367466-17367488 TTCAAGATGAGACTTGGGTGAGG + Intronic
1064821515 10:19340106-19340128 TTTGAGATGACATTTGGGTACGG + Intronic
1065207696 10:23372861-23372883 TTGCACATGACATTTGGGTGGGG + Intergenic
1065267677 10:23994261-23994283 TGGCATATTACACTTGGGTTGGG + Intronic
1065277731 10:24102814-24102836 TTCAAGATGAGACTTGGGTAGGG - Intronic
1065438597 10:25726599-25726621 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1065751288 10:28890195-28890217 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1065906901 10:30263032-30263054 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1065908253 10:30278870-30278892 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1066018458 10:31271995-31272017 TTCAAGATGAGACTTGGGTGAGG + Intergenic
1066472231 10:35710343-35710365 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1067200056 10:44160823-44160845 CTGCAGGTGACACTTGGATTTGG + Intergenic
1067351378 10:45479474-45479496 TTGAAGATGAGATTTGGGTGGGG - Intronic
1068301190 10:55142915-55142937 TTGGAAATGAGACTTGGGTAGGG - Intronic
1068653825 10:59554154-59554176 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1069198684 10:65586608-65586630 TTCAAGATGACATTTGGGTGCGG - Intergenic
1069224346 10:65923098-65923120 TTGAAGATGAGATTTGGGTGGGG + Intronic
1069582920 10:69577556-69577578 TGGCAGATGAAATATGGGTCTGG - Intergenic
1069921974 10:71821120-71821142 TTCCAGCTGACACTTCGGCCTGG + Intronic
1070038791 10:72754452-72754474 TTACAGATGACACTGGAGGCGGG + Intronic
1070115439 10:73524253-73524275 TTCCGGATGGCACTTGGGCCAGG + Intronic
1070323063 10:75369299-75369321 TTCAAGATGAGATTTGGGTCTGG - Intergenic
1071050039 10:81436205-81436227 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1071367235 10:84911653-84911675 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1071721272 10:88148776-88148798 TTCAAGATGACATTTGGGTGGGG + Intergenic
1071791846 10:88963155-88963177 TTCAAGATGAGACTTGGGTGGGG + Intronic
1073386857 10:103133010-103133032 TTCAAGATGACATTTGGGTGGGG - Intronic
1073387157 10:103135228-103135250 TTGAAGATGAGATTTGGGTGGGG - Intronic
1073926216 10:108519492-108519514 TTGAAGATGAGACTGGGGTGGGG - Intergenic
1074207770 10:111299044-111299066 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1074223744 10:111462999-111463021 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1074237680 10:111602507-111602529 TTCAAGATGACATTTGGGTGGGG - Intergenic
1074609619 10:115008978-115009000 TTCAAGATGACATTTGGGTGGGG + Intergenic
1074640358 10:115371842-115371864 TTCAAGATGAGACTTGGGTGGGG - Intronic
1074877494 10:117625505-117625527 TTAGAGATGAGACTTGGGTAGGG + Intergenic
1074910381 10:117903111-117903133 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1075499175 10:122956616-122956638 TTCAAGATGACATTTGGGTGGGG - Intronic
1075499344 10:122958169-122958191 TTCAAGATGACATTTGGGTGGGG + Intronic
1075531049 10:123230142-123230164 TTCAAGATGACATTTGGGTGGGG + Intergenic
1075678474 10:124314732-124314754 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1075812865 10:125238636-125238658 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1076388321 10:130075626-130075648 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1076528764 10:131130347-131130369 TTCAAGATGAGACTTGGGTGGGG + Intronic
1078206572 11:9234995-9235017 TTGCGGATGCCAGCTGGGTCAGG - Intronic
1079567817 11:21904288-21904310 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1079739295 11:24037084-24037106 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1079855001 11:25591856-25591878 TTCAAGATGACATTTGGGTGGGG - Intergenic
1080205567 11:29725034-29725056 TTCAAGATGACACTTGAGTGGGG + Intergenic
1080359211 11:31493485-31493507 TTCAAGATGACATTTGGGTGGGG + Intronic
1080430661 11:32195834-32195856 TTGCAGATGACACTTGTGCAAGG + Intergenic
1080941823 11:36927141-36927163 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1081277026 11:41162925-41162947 TTCCAGATGAGATTTGGGTGGGG - Intronic
1081298679 11:41423872-41423894 TTCAAGATGAGATTTGGGTCGGG - Intronic
1081452431 11:43184355-43184377 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1081507313 11:43732006-43732028 TTCAAGATGAGACTTAGGTCAGG - Intronic
1082934744 11:58645103-58645125 TTCAAGATGAGACTTGGGTGGGG + Intronic
1083361938 11:62115141-62115163 TTCGAGATGAGACTTGGGTGGGG + Intergenic
1083371715 11:62187664-62187686 TTACAGATGACAGATGGGTGAGG - Intergenic
1084452021 11:69244740-69244762 TTCCAGATGAAAGTTGGGTGGGG - Intergenic
1084895381 11:72263589-72263611 TTACAGATGAGATTTGGGTAGGG - Intergenic
1085172045 11:74457720-74457742 TTCCAGATGAGATTTGGGTGGGG - Intronic
1085744780 11:79105591-79105613 TTGCAGATGAGGCTCAGGTCAGG + Intronic
1085814587 11:79724038-79724060 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1086309857 11:85523035-85523057 TTCAAGATGACATTTGGGTGGGG - Intronic
1086323142 11:85671334-85671356 TTCAAGATGACATTTGGGTGGGG + Intronic
1086638629 11:89123432-89123454 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1086790041 11:91025717-91025739 ATTCAGATGAGATTTGGGTCGGG - Intergenic
1086910737 11:92468842-92468864 TTGAAGATGAGATTTGGGTGGGG + Intronic
1087379151 11:97382214-97382236 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1087436400 11:98124109-98124131 TTGGAGATGACATTTGGGTGGGG + Intergenic
1087619176 11:100522673-100522695 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1087644038 11:100786857-100786879 TTCCAGATGAGATTTGGGTGAGG - Intronic
1087818456 11:102684710-102684732 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1088090011 11:106026820-106026842 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1088998456 11:115026616-115026638 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1090288989 11:125525388-125525410 TTTGAGATGAGACTTGGGTGGGG - Intergenic
1090320590 11:125839832-125839854 TTGAAGATGAAATTTGGGTGGGG + Exonic
1090727285 11:129539419-129539441 TTTCAGATGAGACTTTGGACCGG - Intergenic
1091144676 11:133267654-133267676 TTCCAGATGAGATTTGGGTAGGG - Intronic
1093185256 12:16013282-16013304 TTCAAGATGACATTTGGGTGGGG - Intronic
1093208451 12:16279528-16279550 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1093350903 12:18102488-18102510 TTACAGATGAGATTTGGGTGGGG + Intronic
1094325777 12:29236727-29236749 TTCCAGATGAGATTTGGGTGGGG + Intronic
1094677798 12:32637894-32637916 TTGAAGATGAGATTTGGGTGGGG + Intronic
1095395553 12:41758154-41758176 TTGGAGATGAGATTTGGGTAGGG + Intergenic
1095651514 12:44616375-44616397 TTCCAGAAAACACTTGGGTTAGG - Intronic
1096534353 12:52261617-52261639 TTGGAGATGACACTTTGGTTTGG + Intronic
1096969285 12:55652426-55652448 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1097283330 12:57859403-57859425 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1097458821 12:59834408-59834430 TTCCGGATGAGACTTGGGTGGGG + Intergenic
1097481138 12:60127024-60127046 TTCAAGATGACATTTGGGTAGGG - Intergenic
1098109034 12:67102255-67102277 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1098203589 12:68083122-68083144 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1098476343 12:70908631-70908653 TTCAAGATGAGACTTGGGTGAGG + Intronic
1099004214 12:77217328-77217350 TTTAAGATGAGATTTGGGTCGGG - Intergenic
1099386192 12:82016858-82016880 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1099474950 12:83096734-83096756 TTCCAGATGAGATTTGGGTGGGG + Intronic
1099501317 12:83417861-83417883 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1099706360 12:86157881-86157903 TTCCAGATGAGATTTGGGTGAGG + Intronic
1099996815 12:89787332-89787354 TTCCAGATGAGAGTTGGGTGGGG - Intergenic
1100123526 12:91395974-91395996 TTCGAGATGACATTTGGGTGGGG - Intergenic
1100335232 12:93623078-93623100 TTCGAGATGAGACTTGGGTGGGG - Intergenic
1100348183 12:93753084-93753106 TTCAAGATGACATTTGGGTGGGG + Intronic
1100725218 12:97401093-97401115 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1100810178 12:98329978-98330000 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1101752719 12:107596222-107596244 TTGCAAATGCCACTAGGGCCAGG + Intronic
1101842991 12:108341312-108341334 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1102184387 12:110936451-110936473 TTGGAGATGAAATTTGGGTGGGG - Intergenic
1102671483 12:114623132-114623154 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1102741341 12:115210203-115210225 TTCAAGATGAGACTTGGGTGTGG - Intergenic
1102810465 12:115819756-115819778 TTGAACATGACAGTTGGGTGGGG + Intergenic
1103358352 12:120338484-120338506 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1103617035 12:122160775-122160797 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1104115778 12:125747869-125747891 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1104210380 12:126683247-126683269 TTTGAGATGAGACTTGGGTAGGG + Intergenic
1104304780 12:127599902-127599924 TTCAAGATGACATTTGGGTGGGG - Intergenic
1104378071 12:128282606-128282628 TTCCAGATGAGATTTGGGTGGGG + Intronic
1104486883 12:129159065-129159087 TTCCAGATGAGATTTGGGTGGGG + Intronic
1104594656 12:130112918-130112940 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1105576376 13:21656810-21656832 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1105950268 13:25223818-25223840 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1106067168 13:26365171-26365193 TTGCAGATAAAACATGGGTTTGG + Intronic
1106478469 13:30118040-30118062 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1106947991 13:34849921-34849943 TTCAAGATGACATTTGGGTGGGG - Intergenic
1107039328 13:35932764-35932786 TTGAAGATGAGATTTGGGTGGGG + Intronic
1107052182 13:36062901-36062923 TTGCAGATGACACTTGGGTCAGG - Intronic
1107330553 13:39295447-39295469 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1107541621 13:41394348-41394370 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1108707166 13:53000155-53000177 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1108790803 13:53967069-53967091 TTCAAGATGACATTTGGGTGGGG - Intergenic
1109133858 13:58623361-58623383 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1109344465 13:61098638-61098660 TTCAAGATGACATTTGGGTGGGG - Intergenic
1109579928 13:64316761-64316783 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1109672373 13:65626040-65626062 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1110086013 13:71380541-71380563 TTCAAGATGAGACTTGGGTGAGG + Intergenic
1110157966 13:72341732-72341754 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1110170255 13:72491981-72492003 TTACAGATGAGATTTGGGTGAGG - Intergenic
1110334454 13:74310696-74310718 TTGAAGATGAGATTTGGGTGAGG + Intergenic
1110462371 13:75759251-75759273 TTTCAGATGAGAATTGGGTGGGG + Intronic
1110566112 13:76959179-76959201 TTCAAGATGACATTTGGGTGGGG + Intergenic
1111015635 13:82377933-82377955 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1111074440 13:83214997-83215019 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1111180184 13:84653667-84653689 TTCCAGATGAGATTTGGGTGAGG - Intergenic
1111334108 13:86799489-86799511 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1111471931 13:88695042-88695064 TTCAAGATGACATTTGGGTGGGG + Intergenic
1111553577 13:89849585-89849607 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1111560561 13:89939599-89939621 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1111569511 13:90064226-90064248 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1111706581 13:91757420-91757442 TTCGAGATGAGACTTGGGTGGGG - Intronic
1111832115 13:93342572-93342594 TTCAAGATGAGACTTGGGTGGGG + Intronic
1112106605 13:96247305-96247327 TTTGAGATGAGACTTGGGTAGGG - Intronic
1112284604 13:98093249-98093271 TTCAAGATGAGATTTGGGTCAGG + Intergenic
1112457398 13:99575188-99575210 TTTCAGATGAGACTGGGGGCTGG - Intergenic
1112499824 13:99934197-99934219 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1112637254 13:101228383-101228405 TTCAAGATGACATTTGGGTGGGG - Intronic
1112742358 13:102489639-102489661 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1112784942 13:102941200-102941222 TTGAGGATGCCATTTGGGTCTGG + Intergenic
1112799481 13:103094168-103094190 TTCAAGATGATACTTGGGTGGGG + Intergenic
1112849371 13:103685817-103685839 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1113035761 13:106047191-106047213 TTCAAGATGAAACTTGGGTGAGG - Intergenic
1113327428 13:109295403-109295425 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1113893387 13:113748328-113748350 TTGCAGATGGGATTAGGGTCAGG - Intergenic
1114261751 14:21042079-21042101 TTTCAGTTGACACCTGGGTCAGG + Intronic
1114991732 14:28296877-28296899 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1115004361 14:28463774-28463796 TTAAAGATGAGACTTGGGTGGGG + Intergenic
1115112523 14:29840888-29840910 TTCAAGATGACATTTGGGTGGGG + Intronic
1115298350 14:31856372-31856394 TTGAAGATGAGATTTGGGTGGGG + Intronic
1115298617 14:31858300-31858322 TTGAAGATGAGATTTGGGTGGGG + Intronic
1115526183 14:34283017-34283039 TTCCAGATGAGATTTGGGTGGGG - Intronic
1116378541 14:44233630-44233652 TTCAAGATGACATTTGGGTGGGG + Intergenic
1116393562 14:44422036-44422058 TTGAAGATGAAATTTGGGTGGGG + Intergenic
1116625262 14:47255075-47255097 TTCAAGATGACATTTGGGTGGGG + Intronic
1116712949 14:48392140-48392162 TTCAAGATGACATTTGGGTGGGG + Intergenic
1116854352 14:49938572-49938594 TTCAAGATGACATTTGGGTGGGG - Intergenic
1116920914 14:50573153-50573175 TTCAAGATGACATTTGGGTGGGG + Intronic
1116944039 14:50819300-50819322 TTCAAGATGACATTTGGGTGGGG - Intronic
1117092443 14:52264679-52264701 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1117158482 14:52964230-52964252 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1117500323 14:56344789-56344811 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1117662406 14:58021195-58021217 TTCAAGATGAAACTTGGGTGAGG - Intronic
1118811302 14:69276169-69276191 TTGAAGATGAGATTTGGGTGGGG + Intronic
1119413333 14:74452311-74452333 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1120152247 14:81049668-81049690 TTCAAGATGAGACTTGGGTAGGG - Intronic
1120268105 14:82276794-82276816 TTGAACATGAGACTTGGGTGGGG - Intergenic
1120326624 14:83037601-83037623 TTTGAGATGACACTTGGGTGGGG + Intergenic
1120354052 14:83405725-83405747 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1120947683 14:90013292-90013314 TTCAAGATGACATTTGGGTGAGG - Intronic
1121151375 14:91638282-91638304 TTACAGATGACACTTGATACCGG - Intronic
1121267217 14:92612136-92612158 TTGCACATGAGATTTGGGTGGGG + Intronic
1121574317 14:94970777-94970799 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1121588169 14:95078266-95078288 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1121846836 14:97179609-97179631 TTCAAGATGACATTTGGGTTGGG - Intergenic
1122801628 14:104233274-104233296 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1123697097 15:22886240-22886262 TTTCAGATGAGATTTGGGTGTGG + Intronic
1123876268 15:24626996-24627018 TTCAAGATGACATTTGGGTGGGG - Intergenic
1124158337 15:27247930-27247952 TTGAAGATGAGATTTGGGTGGGG + Intronic
1124559215 15:30756502-30756524 TACCAGATCAAACTTGGGTCTGG + Intronic
1125065967 15:35486634-35486656 TTCCAGATGAGATTTGGGTGGGG + Intronic
1125140287 15:36398462-36398484 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1125233601 15:37485282-37485304 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1125278387 15:38017778-38017800 TTGGAGATAAGACTTGGGTGGGG - Intergenic
1125338296 15:38650120-38650142 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1126049475 15:44673265-44673287 CTGCAGAAGAGAGTTGGGTCTGG + Exonic
1126514855 15:49523231-49523253 TTGAAGATGAGATTTGGGTGGGG - Intronic
1126733593 15:51709340-51709362 TTCAAGATGAGACTTGGGTGGGG + Intronic
1126955542 15:53929321-53929343 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1127006074 15:54571463-54571485 TTCCAGATGAGATTTGGGTGGGG + Intronic
1127044674 15:55013107-55013129 TTGGAGATGAGATTTGGGTAGGG - Intergenic
1127557974 15:60106902-60106924 TTTCAGATGAGATTTGGGTGAGG + Intergenic
1127652581 15:61023534-61023556 TTCCAGATGAGATTTGGGTAGGG + Intronic
1128816897 15:70616617-70616639 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1129774993 15:78230567-78230589 TTCCAGATGAGATTTGGGTGGGG - Intronic
1130050045 15:80476861-80476883 TTGAACATGACATTTGGGTGAGG - Intronic
1130089073 15:80804195-80804217 TTGAAGATGAGATTTGGGTGGGG + Intronic
1130292216 15:82612943-82612965 TTGCTGAAGCCACTTGGGCCTGG - Intronic
1130416740 15:83701493-83701515 TTGAAGATGAGATTTGGGTGGGG - Intronic
1130671605 15:85917859-85917881 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1131448726 15:92521224-92521246 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1131653415 15:94427640-94427662 TTGGAGATGAGATTTGGGTGGGG + Intronic
1131743794 15:95422602-95422624 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1133096413 16:3449702-3449724 TTGCAGATGAGATTTGGGTGGGG - Intronic
1133103322 16:3492184-3492206 TTGGAGATGAAATTTGGGTGGGG + Intergenic
1133160578 16:3909038-3909060 TTCCAGGTGACACTTGGATCGGG + Intergenic
1133343486 16:5054651-5054673 TTCAAGATGAGACTTGGGTGGGG - Intronic
1133433775 16:5761713-5761735 TTCAAGATGACATTTGGGTGGGG + Intergenic
1133601871 16:7347521-7347543 TTCAAGATGAGACTTGGGTGAGG + Intronic
1133641858 16:7724847-7724869 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1133731910 16:8585267-8585289 TTCAAGATGACATTTGGGTGGGG + Intronic
1134359710 16:13519911-13519933 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1134801642 16:17090254-17090276 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1134885845 16:17790698-17790720 TTCAAGATGACATTTGGGTGGGG + Intergenic
1135732187 16:24904213-24904235 TTGGAGATGAGATTTGGGTGGGG + Intronic
1135806224 16:25545340-25545362 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1136653633 16:31695319-31695341 TTCGAGATGAGACTTGGGTAGGG + Intergenic
1137018621 16:35400193-35400215 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1137888775 16:52136057-52136079 GTGGAGATGACATTTGGGTGGGG - Intergenic
1137932447 16:52601984-52602006 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1138225641 16:55292094-55292116 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1138848103 16:60591764-60591786 TTTAAGATGAGACTTGGGTGGGG + Intergenic
1138908957 16:61373601-61373623 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1139041170 16:63000986-63001008 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1139297592 16:65916709-65916731 TTCAAGATGACATTTGGGTGGGG + Intergenic
1139351869 16:66342166-66342188 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1141345204 16:83238487-83238509 TTCAAGATGAGATTTGGGTCAGG + Intronic
1141401059 16:83747226-83747248 TTCAAGATGAGACTTGGGTGAGG - Intronic
1141411212 16:83834482-83834504 TTTGAGATGACATTTGGGTGGGG - Intergenic
1142106325 16:88304954-88304976 TTCCAGATGGAACTTGGGTGTGG - Intergenic
1142471682 17:166498-166520 CTCCAGATGAGACTTGGGTGGGG - Intronic
1143737916 17:8926726-8926748 TTGGAGATGAGATTTGGGTGGGG + Intronic
1143760875 17:9103335-9103357 TTCAAGATGAAACTTGGGTGGGG - Intronic
1143832786 17:9665606-9665628 TTGAAGATGAGATTTGGGTAGGG + Intronic
1143972973 17:10809107-10809129 TTTGAAATGAGACTTGGGTCGGG - Intergenic
1144138576 17:12322742-12322764 TTGCAGATGAAATTTGGTTTTGG - Intergenic
1144338247 17:14291468-14291490 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1144874734 17:18391466-18391488 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1145157491 17:20552955-20552977 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1146448488 17:32952551-32952573 TTCAAGATGACATTTGGGTGGGG - Intergenic
1146806043 17:35865750-35865772 TTGAAAATGACACTTGAGTAGGG + Intronic
1146873503 17:36390357-36390379 TTCCAGATGAGATTTGGGTGGGG + Intronic
1147065885 17:37922516-37922538 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1147417996 17:40307496-40307518 TTGCAGCTGACACTGGGGTGGGG - Intergenic
1147496492 17:40921553-40921575 TTCAAGATGACAATTGGGTGGGG - Intergenic
1147834211 17:43318400-43318422 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1147892213 17:43725360-43725382 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1148244355 17:46020828-46020850 TTCAAGATGACATTTGGGTGGGG + Intronic
1148542577 17:48492382-48492404 TTGCAGTAGACCCTTGGGCCAGG + Intergenic
1149862976 17:60134419-60134441 TTTAAGATGAGACTTGGGTGGGG + Intergenic
1150411799 17:64950526-64950548 TTCCAGGTGAGACTTGGGTGGGG + Intergenic
1150446592 17:65231348-65231370 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1150629063 17:66864791-66864813 TAGAAGATGACACATGGTTCTGG - Intronic
1150853833 17:68731683-68731705 TTCGAGATGAGACTTGGGTGGGG + Intergenic
1150888123 17:69111393-69111415 TTCAAGATGACATTTGGGTGGGG - Intronic
1150972956 17:70050855-70050877 TTGCTGATGAAACTTGTGTGAGG + Intergenic
1151052347 17:70992714-70992736 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1151066693 17:71159166-71159188 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1151077796 17:71294121-71294143 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1151198313 17:72447687-72447709 TTGCAGATGAAGATTGGATCAGG + Intergenic
1151205773 17:72505635-72505657 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1151874897 17:76862198-76862220 TTCCAGATGAGATTTGGGTAGGG + Intergenic
1152109612 17:78350457-78350479 TCCCAGGTGACACCTGGGTCAGG + Intergenic
1152268420 17:79309643-79309665 TTCCAGATGAGACTTGGGTGGGG - Intronic
1153150527 18:2087645-2087667 TTCAAGATGACATTTGGGTGGGG - Intergenic
1153388813 18:4532138-4532160 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1153405653 18:4735538-4735560 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1153757043 18:8294570-8294592 TTGAAGATGAGATTTGGGTGGGG + Intronic
1155773195 18:29725855-29725877 TTCAAGATGACACTTGAGTGGGG + Intergenic
1156090306 18:33460244-33460266 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1156152909 18:34265234-34265256 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1156352260 18:36311570-36311592 TTGCACATGGCACCTGGGGCTGG - Intronic
1156812640 18:41271611-41271633 TTGAACATGAGACTTGGGTGGGG - Intergenic
1157077098 18:44478252-44478274 TTAGAGATGAGACTTGGGTGGGG - Intergenic
1157226936 18:45874725-45874747 TTCAAGATGACATTTGGGTGGGG + Intronic
1157470245 18:47982987-47983009 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1157549141 18:48568930-48568952 TTGAAGATGAGATTTGGGTGGGG + Intronic
1157584831 18:48794375-48794397 TTGCAGATGGCCCTTAGATCTGG - Intronic
1158195171 18:54876978-54877000 TTCAAGATGACATTTGGGTAGGG - Intronic
1158734367 18:60062888-60062910 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1158766587 18:60457558-60457580 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1158879164 18:61760219-61760241 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1158903153 18:61985239-61985261 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1159283066 18:66311634-66311656 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1159377175 18:67607063-67607085 TTTGAGATGAGATTTGGGTCGGG + Intergenic
1159499301 18:69248564-69248586 TTCCAGATGAGATTTGGGTAGGG + Intergenic
1159755698 18:72361212-72361234 TTCAAGATGACATTTGGGTGGGG + Intergenic
1159803194 18:72925202-72925224 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1160006737 18:75073887-75073909 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1160126977 18:76184404-76184426 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1160383190 18:78476292-78476314 TTTCAAATGAGACTTGGGTGGGG - Intergenic
1160536070 18:79593058-79593080 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1161094129 19:2379027-2379049 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1161759780 19:6162703-6162725 TTGCTGTTGACATTTGGGGCAGG + Intronic
1161785482 19:6322691-6322713 TTTAAGATGACATTTGGGTGGGG - Intronic
1162274841 19:9644840-9644862 TTCAAGATGACATTTGGGTGGGG + Intronic
1162544643 19:11321476-11321498 TTCCAGATGAGATTTGGGTGGGG + Intronic
1163605939 19:18275236-18275258 TGGCAGATGGCAGTTGGGTGGGG + Intergenic
1164234524 19:23320670-23320692 TTGTAGATGAGATTTGGGTGAGG + Intronic
1164249294 19:23463075-23463097 TTGTAGATGAGATTTGGGTGAGG + Intergenic
1164285853 19:23816932-23816954 TTAAAGATGAGACTTGGGTTGGG + Intronic
1164318882 19:24120282-24120304 TTAAAGATGAGACTTGGGTTGGG + Intronic
1164325001 19:24183518-24183540 TTGTAGATGAGATTTGGGTGAGG - Intergenic
1164900733 19:31919952-31919974 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1165120547 19:33556041-33556063 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1165290476 19:34880362-34880384 TTCAAGATGAGATTTGGGTCAGG - Intergenic
1166169325 19:41016551-41016573 TTGCAGTGGACATTTGTGTCTGG + Intronic
1168452246 19:56475705-56475727 TTCCATATAACACATGGGTCTGG - Intronic
1168521136 19:57051397-57051419 TTTGAGATGAGACTTGGGTAGGG - Intergenic
925844451 2:8022985-8023007 TTGAAGATGAGATTTGGGTGGGG - Intergenic
925873278 2:8289375-8289397 TTCAAGATGACATTTGGGTGGGG + Intergenic
925897479 2:8483764-8483786 TTGGAGATGAGACTTGGGTGGGG + Intergenic
925969533 2:9096773-9096795 AAGCAGGTGACACTTGGGCCAGG + Intergenic
925972373 2:9114766-9114788 TTGAAGATGAGATTTGGGTGGGG - Intergenic
926045276 2:9705272-9705294 TTCCAGATGAGATTTGGGTGGGG - Intergenic
926539928 2:14163210-14163232 TTGAAGGTGACATTTGGGTGGGG + Intergenic
926692724 2:15748308-15748330 TTGCAGATGAGACCTGGCACGGG + Intergenic
927184218 2:20470551-20470573 TTCAAGATGACACTTGGGTAGGG + Intergenic
927294423 2:21438153-21438175 TTGAAGATGAGATTTGGGTGGGG - Intergenic
927508721 2:23631036-23631058 TTACAGATGACCCTTGGGGCTGG + Intronic
927529935 2:23787103-23787125 TTACATATGACACTTAGGACTGG - Intronic
927797818 2:26066732-26066754 TTCAAGATGACATTTGGGTGGGG + Intronic
928239114 2:29571290-29571312 TTGGAGATGAGATTTGGGTGGGG - Intronic
928332915 2:30371336-30371358 TTCCAGATGAGATTTGGGTGGGG - Intergenic
928433761 2:31240539-31240561 TTGCTGACCACACATGGGTCTGG - Intronic
928697014 2:33859494-33859516 TTCGAGATGAGACTTGGGTGGGG + Intergenic
929070983 2:38030098-38030120 TTCCAGATGAGATTTGGGTGGGG + Intronic
929117476 2:38456563-38456585 TTCCAGATGAGATTTGGGTAGGG + Intergenic
929358229 2:41051494-41051516 TTCAAGATGACATTTGGGTGGGG - Intergenic
929687647 2:44048201-44048223 TTCAAGATGAGACTTGGGTGGGG + Intergenic
929702788 2:44178992-44179014 TTCAAGATGAGACTTGGGTGGGG - Intronic
930446693 2:51482487-51482509 TTCAAGATGACATTTGGGTGAGG - Intergenic
930523707 2:52499103-52499125 TGGGAGCTGACACTTGGGTAAGG + Intergenic
930687650 2:54326289-54326311 TTCCAGATGATATTTGGGTGGGG - Intergenic
931033385 2:58210453-58210475 TTCAAGATGAGACTTGGGTAGGG + Intronic
931604092 2:64034427-64034449 TTCAAGATGAGACTTGGGTGGGG - Intergenic
932141908 2:69286448-69286470 TTAGAGATGAGACTTGGGTGAGG + Intergenic
932878684 2:75478877-75478899 TTCCAGATGAGATTTGGGTGGGG + Intronic
933344393 2:81065322-81065344 TTCAAGATGAGACTTGGGTGGGG + Intergenic
933356599 2:81218166-81218188 TTCCAGATGAGATTTGGGTGGGG - Intergenic
933362523 2:81305934-81305956 TTCCAGATGAGATTTGGGTGGGG - Intergenic
934698300 2:96416403-96416425 TTGAAGATGAGATTTGGGTGGGG + Intergenic
934930442 2:98418012-98418034 TTCAAGATGACATTTGGGTGGGG + Intergenic
934959638 2:98659508-98659530 TTCGAGATGAGACTTGGGTGGGG - Intronic
935156516 2:100488158-100488180 CTGCAGAGGACACTTGGAACAGG - Intergenic
935443937 2:103136911-103136933 TTCCAGATGAGATTTGGGTGGGG + Intergenic
935548889 2:104430728-104430750 TTACAGAAGACAATTGGATCAGG + Intergenic
935723901 2:106006584-106006606 TTCAAGATGAGATTTGGGTCGGG - Intergenic
935927137 2:108081902-108081924 TTCCAGATGAGATTTGGGTGGGG - Intergenic
937495187 2:122411756-122411778 TTCAAGATGAGATTTGGGTCGGG + Intergenic
937762392 2:125621783-125621805 TAGAAGATGACATTTGGGTGGGG - Intergenic
938544250 2:132313611-132313633 TTCAAGATGAGACTTGGGTAGGG - Intergenic
938564540 2:132506783-132506805 TTCAAGATGAGACTTGGGTAGGG + Intronic
938687786 2:133757053-133757075 TTAAAGATGACATTTGGGTGGGG + Intergenic
939599786 2:144174563-144174585 TTGAAGATGAAATTTGGGTAGGG - Intronic
940322123 2:152388573-152388595 TTCAAGATGACATTTGGGTGGGG + Intronic
940402768 2:153266742-153266764 TTGGAGATGAGATTTGGGTGGGG + Intergenic
940489928 2:154346392-154346414 TTCAAGATGAGACTTGGGTAGGG - Intronic
940502072 2:154505241-154505263 TTCAAGATGAGACTTGGGTGGGG - Intergenic
940665400 2:156602442-156602464 TTGCAGATGACACCGGGGTGGGG + Intronic
940852864 2:158704766-158704788 TTCAAGATGAGACTTGGGTGGGG - Intergenic
941545972 2:166851773-166851795 TTCAAGATGACATTTGGGTAGGG + Intergenic
941881169 2:170481992-170482014 TTCAAGATGAGACTTGGGTGAGG - Intronic
942169499 2:173276126-173276148 TTCCAGATGAGATTTGGGTGGGG + Intergenic
942212151 2:173681886-173681908 TTCCAGATGAGATTTGGGTAGGG + Intergenic
942367249 2:175240368-175240390 TTCCAGATGAGATTTGGGTGGGG + Intergenic
942749323 2:179269784-179269806 TTCCAGATGAGATTTGGGTGGGG + Intergenic
943272147 2:185820076-185820098 TTGAAGATGAGATTTGGGTGGGG - Intronic
943297710 2:186159821-186159843 TTTGAGATGAGATTTGGGTCAGG - Intergenic
943313084 2:186352272-186352294 TTGAAGATGAGATTTGGGTGGGG - Intergenic
943480656 2:188412565-188412587 TTGAAGATGAGATTTGGGTGGGG + Intronic
943933358 2:193883255-193883277 TTCCAGATGACATTTGAGTGGGG + Intergenic
944272374 2:197797580-197797602 TTGAAGATGAGATTTGGGTGGGG + Intergenic
944454957 2:199883841-199883863 TTGAAGATGAGATTTGGGTGGGG - Intergenic
944999755 2:205335993-205336015 TTCAAGATGACATTTGGGTGGGG + Intronic
945001526 2:205356007-205356029 TTCCAGATGAGATTTGGGTGGGG + Intronic
945292121 2:208136904-208136926 GGGCAGATGACAATTCGGTCTGG + Intergenic
945570346 2:211459460-211459482 TTCAAGATGACATTTGGGTGAGG - Intronic
946518224 2:220436767-220436789 TTCAAGATGAGACTTGGGTGGGG - Intergenic
946803494 2:223446568-223446590 TTCCAGATGAGATTTGGGTGGGG - Intergenic
947031592 2:225802089-225802111 TTCAAGATGACATTTGGGTAGGG - Intergenic
947289980 2:228562123-228562145 TTCAAGATGACATTTGGGTGGGG + Intergenic
947338890 2:229116446-229116468 TTCCAGATGAGATTTGGGTGGGG - Intronic
947955494 2:234186949-234186971 TTCAAGATGAGACTTGGGTGGGG - Intergenic
948248278 2:236504648-236504670 TTTAAGATGAGATTTGGGTCGGG - Intronic
948294938 2:236853681-236853703 TCTCAAATGACACTGGGGTCAGG + Intergenic
948409633 2:237749130-237749152 TTCCAGATGAGATTTGGGTGGGG + Intronic
948724703 2:239927094-239927116 TTCAAGATGAGACTTGGGTGGGG + Intronic
948726218 2:239935598-239935620 TTCCAGATGAGATTTGGGTGGGG - Intronic
948785902 2:240352825-240352847 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1169742642 20:8912124-8912146 TTCAAGATGAGACTTGGGTGGGG - Intronic
1169986461 20:11450546-11450568 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1169991327 20:11506440-11506462 TTCTAGATGACATTTGGGTGGGG - Intergenic
1170076740 20:12427942-12427964 TTACAGATGAGATTTGGGTGAGG - Intergenic
1170444598 20:16412755-16412777 TTCCAGATGAAATTTGGGTGGGG + Intronic
1170754615 20:19188894-19188916 TTCAAGATGAGATTTGGGTCAGG - Intergenic
1171873113 20:30546348-30546370 TTCAAGATGAGACTTGGGTAGGG - Intergenic
1173537803 20:43829313-43829335 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1174308598 20:49632656-49632678 TTGCATAAGACACTTGAGTGAGG - Intergenic
1174685709 20:52453038-52453060 TTGGAGATGAAATTTGGGTGGGG - Intergenic
1174855147 20:54037431-54037453 TTCCAGATGAGATTTGGGTGGGG + Intronic
1175183354 20:57163907-57163929 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1175390045 20:58621353-58621375 TTGCAGATGTCACTAAGGTAAGG + Intergenic
1175861615 20:62153297-62153319 TTGAAGATGAGATTTGGGTGGGG + Intronic
1176889306 21:14294808-14294830 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1176988458 21:15465096-15465118 TTGAAGATGAGATTTGGGTGAGG - Intergenic
1177233306 21:18351386-18351408 TTGGAGATGAGATTTGGGTGGGG - Intronic
1177275657 21:18910083-18910105 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1177649015 21:23936865-23936887 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1177681980 21:24383299-24383321 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1177839556 21:26220460-26220482 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1177972914 21:27812326-27812348 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1178099474 21:29252455-29252477 TTCAAGATGAGACTTGGGTGGGG + Intronic
1179193423 21:39142883-39142905 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1179288802 21:40000620-40000642 TTCAAGATGAGACTTGGGTGTGG - Intergenic
1179310294 21:40189548-40189570 TTCCAGATGAGATTTGGGTGGGG - Intronic
1181129444 22:20721871-20721893 TTCAAGATGACATTTGGGTGGGG - Intronic
1181976172 22:26731795-26731817 TTCCAGATGAGAGTTGGGTGGGG + Intergenic
1182022940 22:27096357-27096379 TTGGAGGTGAGACTTGGGTGGGG + Intergenic
1182207088 22:28639493-28639515 TTCAAGATGAGACTTGGGTGGGG - Intronic
1182506617 22:30787773-30787795 TTGAAGATGAGATTTGGGTGGGG + Intronic
1182608463 22:31526516-31526538 TTGCAGATGCGATTTGGGTGGGG + Intronic
1182816645 22:33170443-33170465 TTCCAGATGAGATTTGGGTAGGG - Intronic
1183004613 22:34890786-34890808 TTGAAGATGAAATTTGGGTGGGG - Intergenic
1183283308 22:36945779-36945801 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1183805905 22:40210820-40210842 TTGGAAATGACATTTGGGGCTGG + Intronic
1184588593 22:45464867-45464889 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1184826723 22:46957581-46957603 TTGGAGATGAGACTTGGGTGGGG + Intronic
1185386061 22:50531806-50531828 TTGCAGATGGGGCTTGGGGCTGG - Intronic
949239694 3:1855660-1855682 TAACAGATGACAGTTGGGGCGGG + Intergenic
949808934 3:7985222-7985244 TTGCAGATGAGATTTGGGTAGGG - Intergenic
950468341 3:13169105-13169127 TTCAAGATGAGACTTGGGTGGGG - Intergenic
951354515 3:21648096-21648118 TTCGAGATGACATTTGGGTGGGG - Intronic
951426129 3:22547141-22547163 TTTGAGATGAGACTTGGGTGGGG - Intergenic
951735717 3:25860908-25860930 TTGAAGATGAGATTTGGGTGGGG + Intronic
951744801 3:25966057-25966079 TTCCAGATGACATTTGGATGGGG - Intergenic
952457455 3:33486916-33486938 TTCAAGATGAGACTTGGGTGGGG + Intergenic
953184817 3:40628171-40628193 TTCCAGATGAGATTTGGGTGGGG - Intergenic
953185085 3:40630135-40630157 TTGGAGATGAGATTTGGGTTGGG - Intergenic
953446465 3:42973010-42973032 TTGAAGATGAGATTTGGGTGGGG - Intronic
955162983 3:56483510-56483532 TTGCAGATGAAGCGTGGGTAAGG + Intergenic
955167595 3:56529514-56529536 CTGGAGATGAGACTTGGGTGGGG + Intergenic
955247422 3:57239238-57239260 TTGAAGATGAGATTTGGGTGGGG + Intronic
955435366 3:58894117-58894139 TTCAAGATGAGACTTGGGTGAGG + Intronic
955459824 3:59169889-59169911 TTCAAGATGAAACTTGGGTGGGG - Intergenic
955833121 3:63025915-63025937 TTGGAGATGAAATTTGGGTGGGG + Intergenic
956080504 3:65551007-65551029 TTCCAGATGAGATTTGGGTGGGG - Intronic
956187819 3:66579250-66579272 TTCAAGATGAGACTTGGGTAGGG + Intergenic
956279805 3:67544280-67544302 TTTGAGATGACATTTGGGTGGGG - Intronic
956364060 3:68480785-68480807 TTCAAGATGAGACTTGGGTGGGG - Intronic
956379105 3:68647276-68647298 TTCCAGATGAGATTTGGGTGGGG - Intergenic
956638199 3:71387714-71387736 TTGAAGATGACACATGGGTGTGG - Intronic
956712821 3:72053125-72053147 TTCAAGATGACATTTGGGTGGGG - Intergenic
956757810 3:72406462-72406484 CTCCATATGACACTTGTGTCAGG - Intronic
957759757 3:84539755-84539777 TTCAAGATGAGACTTGGGTGGGG - Intergenic
957767790 3:84648457-84648479 TTGAAGATGAGATGTGGGTCAGG + Intergenic
958609933 3:96411599-96411621 TTCGAGATGATACTTGGGTGGGG + Intergenic
958861129 3:99446320-99446342 TTCAAGATGAGACTTGGGTGGGG - Intergenic
959033170 3:101327246-101327268 TTCAAGATGAGATTTGGGTCGGG - Intronic
959182022 3:102993268-102993290 TTTCAGATGAGACTTTGGACTGG + Intergenic
959324719 3:104922245-104922267 TTCTAGATGAGACTTGGGTGGGG - Intergenic
959813144 3:110642982-110643004 TTCAAGATGAGACTTGGGTGGGG - Intergenic
959851926 3:111097524-111097546 TTGAAGATGAGATTTGGGTGGGG - Intronic
959968515 3:112382293-112382315 TTCAAGATGAAATTTGGGTCGGG - Intergenic
960067010 3:113384936-113384958 TTCAAGATGAAACTTGGGTGGGG - Intronic
960540594 3:118857396-118857418 TTTGAGATGAGACTTGGGTGGGG + Intergenic
960954442 3:123021866-123021888 TTCCAGATGATATTTGGCTCAGG + Intronic
961878985 3:130046999-130047021 TTCCAGATGAGATTTGGGTGGGG - Intergenic
962059006 3:131905292-131905314 TTGAGGATGACACAGGGGTCTGG + Exonic
962646580 3:137446340-137446362 TTCAAGATGACATTTGGGTAGGG + Intergenic
963227040 3:142872814-142872836 TTGATGATGATACTTGGCTCTGG - Intronic
963441361 3:145344312-145344334 TTCCAGATGAGATTTGGGTGGGG + Intergenic
963478782 3:145840851-145840873 TTGAAGATGAGATTTGGGTGGGG + Intergenic
963898107 3:150707124-150707146 TTCAAGATGAGATTTGGGTCAGG + Intergenic
964026333 3:152079268-152079290 TTCAAGATGAGATTTGGGTCAGG + Intergenic
964036750 3:152208441-152208463 TTGGAGATGAGATTTGGGTGGGG - Intergenic
964117246 3:153148999-153149021 TTCAAGATGAGACTTGGGTGGGG + Intergenic
964427518 3:156569029-156569051 TTCAAGATGAGACTTGGGTGGGG - Intergenic
964605647 3:158557077-158557099 TTGAAGATGAGATTTGGGTGGGG - Intergenic
964623998 3:158741411-158741433 GTGCAGATGACCCTTGAATCTGG + Intronic
964989275 3:162786206-162786228 TTCAAGATGAGACTTGGGTAGGG + Intergenic
965203782 3:165694021-165694043 TTCAAGATGACATTTGGGTGGGG + Intergenic
965661976 3:171051761-171051783 TTCAAGATGAGACTTGGGTGGGG - Intergenic
965968803 3:174528901-174528923 TTCAAGATGACATTTGGGTGGGG + Intronic
966500665 3:180635260-180635282 TTGTAGATGAGACTTGGGTGGGG + Intronic
966535328 3:181027067-181027089 TTGGAGATGAGATTTGGGTGAGG - Intergenic
966722529 3:183079080-183079102 TTGAAGATGAGATTTGGGTGGGG + Intronic
966797092 3:183725725-183725747 TTGAAGATGAGATTTGGGTGGGG + Intronic
966818592 3:183908276-183908298 CTGCAGATGATGCCTGGGTCCGG + Intergenic
966849294 3:184155137-184155159 TCGCCGATCCCACTTGGGTCCGG + Intronic
966879039 3:184339295-184339317 TTGCAGGTGACACTTGAGATGGG + Intronic
967634529 3:191785441-191785463 TTCAAGATGAGATTTGGGTCAGG + Intergenic
967810783 3:193759171-193759193 TTCCAGATGAGATTTGGGTGGGG + Intergenic
968058062 3:195708241-195708263 TTGCAGAGGACACTGTGGTCTGG - Intergenic
968530339 4:1087672-1087694 TTTGAGATGAGACTTGGGTGGGG - Intronic
968727521 4:2255208-2255230 TTGCCGATGAGACTTGGATAAGG - Intronic
968790805 4:2659947-2659969 TTGCAGATGACACACTGGGCGGG - Exonic
969011085 4:4063315-4063337 TTCAAGATGACACTTGGATGGGG + Intergenic
969300961 4:6296657-6296679 TTGGAGAAGACCCTTGGGCCAGG + Intronic
969546066 4:7828886-7828908 TTCAAGATGAGACTTGGGTGGGG - Intronic
969616812 4:8258008-8258030 TTCAAGATGAGACTTGGGTGGGG - Intergenic
969657314 4:8505721-8505743 TTCAAGATGACATTTGGGTGGGG - Intergenic
969661915 4:8535236-8535258 TTCAAGATGACATTTGGGTGGGG + Intergenic
969742982 4:9046583-9046605 TTCAAGATGAGACTTGGGTGGGG - Intergenic
969802361 4:9578661-9578683 TTCAAGATGACATTTGGGTGTGG - Intergenic
969950609 4:10831479-10831501 TTCAAGATGAGACTTGGGTGGGG - Intergenic
970030942 4:11673832-11673854 TTCCAGATGAGATTTGGGTGGGG + Intergenic
970061637 4:12040186-12040208 TTCAAGATGACAGTTGGGTAGGG - Intergenic
970106564 4:12592478-12592500 TTCAAGATGAGACTTGGGTGAGG - Intergenic
970196943 4:13560464-13560486 TTTCAGATGAGATTTGGGTGGGG + Intergenic
970240468 4:14003321-14003343 TTTCAGATGAGACTTTGGACTGG + Intergenic
970240490 4:14003476-14003498 TTCAAGATGAAATTTGGGTCGGG - Intergenic
970344178 4:15137146-15137168 TTCAAGATGAGACTTGGGTGGGG + Intergenic
970750329 4:19352372-19352394 TTGAAGATGAGACTTGGGTGTGG + Intergenic
970772026 4:19625299-19625321 TTTGAGATGAGACTTGGGTGGGG - Intergenic
970812185 4:20107436-20107458 TTCCAGATGAGATTTGGGTGGGG - Intergenic
971562294 4:28095359-28095381 TTGGAGATGAGATTTGGGTGGGG + Intergenic
971670150 4:29545966-29545988 TTGGAGATGAGATTTGGGTGGGG + Intergenic
971969515 4:33603875-33603897 TTCCAGATGAGATTTGGGTGGGG + Intergenic
971972332 4:33635845-33635867 TTCCAGATGAAATTTGGGTGGGG - Intergenic
972030707 4:34454126-34454148 TTGAAGATGAGATTTGGGTGCGG + Intergenic
972046089 4:34666346-34666368 TTCAAGATGAGACTTGGGTGGGG - Intergenic
972073401 4:35052985-35053007 TTGGAGATGAGATTTGGGTGGGG + Intergenic
972124042 4:35741162-35741184 TTTAAGATGAGACTTGGGTTGGG - Intergenic
972134523 4:35875785-35875807 TTGAAGATGAGATTTGGGTGGGG - Intergenic
972240896 4:37190347-37190369 TTCAAGATGACATTTGGGTGGGG + Intergenic
972242642 4:37209999-37210021 TTCCAGATGAGATTTGGGTAGGG - Intergenic
972381007 4:38520480-38520502 TTCAAGATGACATTTGGGTAAGG - Intergenic
973277169 4:48322400-48322422 TTGAACATGAGACTTGGGTGGGG - Intergenic
973332733 4:48925798-48925820 TTGAAGATGAGATTTGGGTGGGG + Intergenic
973930183 4:55784822-55784844 TTCAAGATGAGATTTGGGTCAGG - Intergenic
974075031 4:57160770-57160792 TTCCAGATGACCCTAGGTTCTGG + Intergenic
974171104 4:58268953-58268975 CTGAAGATGAGACTTGGGTGGGG - Intergenic
974352869 4:60772820-60772842 TTGAAGATGAGATTTGGGTTGGG + Intergenic
974563353 4:63552349-63552371 TTCAAGATGAGACTTGGGTGGGG + Intergenic
974725754 4:65795893-65795915 TTGAAGATGAGATTTGGGTGGGG + Intergenic
974931246 4:68363896-68363918 TTTCAGATGAGATTTGGGTGGGG - Intergenic
975005026 4:69273379-69273401 TTGAAGATGAGATTTGGGTGGGG - Intergenic
975013450 4:69382360-69382382 TTGAAGATGAGATTTGGGTGGGG - Intronic
975318266 4:72980055-72980077 TTCAAGATGAGACTTGGGTGGGG - Intergenic
976212315 4:82683638-82683660 TTACAGATGAGATTTGGGTGGGG - Intronic
976677960 4:87724387-87724409 TTCAAGATGACATTTGGGTAGGG - Intergenic
976678242 4:87726412-87726434 TTCAAGATGAGACTTGGGTGGGG - Intergenic
977039316 4:91995083-91995105 TTCAAGATGACATTTGGGTTGGG + Intergenic
977046428 4:92073325-92073347 TTGAACATGACACTTGAGTGTGG - Intergenic
977345626 4:95812581-95812603 TTACAGATGACACTATAGTCAGG - Intergenic
977415213 4:96723960-96723982 TTGAAGATGAGATTTGGGTGGGG - Intergenic
977459791 4:97310690-97310712 TTCAAGATGAGACTTGGGTGGGG + Intronic
977670211 4:99686124-99686146 TTTCAGATGAGACTTTGGACTGG + Intergenic
977704231 4:100053248-100053270 TTGAAGATGAGATTTGGGTGGGG + Intergenic
978032900 4:103957663-103957685 TTCAAGATGAGACTTGGGTGGGG + Intergenic
978277233 4:106966919-106966941 TTCAAGATGAGACTTGGGTGGGG + Intronic
978467120 4:109019725-109019747 CTGGAGATGAGACTTGGGTGGGG + Intronic
979130315 4:117036526-117036548 TTCCAGATGAGATTTGGGTAGGG + Intergenic
980006967 4:127553208-127553230 TTCAAGATGAGACTTGGGTGGGG - Intergenic
980084614 4:128378345-128378367 TTGGAGATGAGATTTGGGTAGGG + Intergenic
980627164 4:135388607-135388629 TTGGAGATGACATTTGAGTTAGG - Intergenic
980844444 4:138307353-138307375 TTTGAGATGAGACTTGGGTGGGG - Intergenic
981646228 4:147001678-147001700 TTGGAGATGAGATTTGGGTGGGG + Intergenic
981795494 4:148590315-148590337 TTCAAGATGACATTTGGGTGGGG - Intergenic
981875195 4:149533817-149533839 TTGAAGATGAGATTTGGGTGGGG + Intergenic
982505445 4:156211389-156211411 TTCAAGATGACATTTGGGTAGGG + Intergenic
982619053 4:157679674-157679696 TTCAAGATGAGACTTGGGTGGGG + Intergenic
982723906 4:158885274-158885296 TTGGAGATGAGATTTGGGTGGGG + Intronic
983337420 4:166415249-166415271 TTTCAGATGAGACTTTGGACTGG - Intergenic
983591798 4:169421430-169421452 TTCCAGATGAGATTTGGGTGGGG - Intronic
983874875 4:172863847-172863869 TTCAAGATGAGACTTGGGTGGGG - Intronic
983930699 4:173450305-173450327 TTCCAGATGAGATTTGGGTGGGG + Intergenic
984442667 4:179792326-179792348 TTCAAGATGACATTTGGGTGGGG - Intergenic
984571754 4:181403639-181403661 TTCCAGATGAAATTTGGGTGGGG + Intergenic
984572080 4:181405979-181406001 TTCAAGATGAGACTTGGGTGGGG + Intergenic
985474241 5:69307-69329 TTCCAGATGAGATTTGGGTGGGG - Intergenic
985552778 5:541757-541779 TTGAGGATGACACTGGGGTGGGG + Intergenic
986154716 5:5163333-5163355 ATTCAGATGAGACTTGGGTGGGG - Intronic
986160789 5:5226494-5226516 TTTCAGATGAAATTTGGGTAGGG + Intronic
986401487 5:7385872-7385894 TTCAAGATGACATTTGGGTGGGG + Intergenic
986406231 5:7427590-7427612 TTGAAGATGAGACTTGGGTGGGG + Intronic
986448636 5:7845263-7845285 TTGGAGATGAGATTTGGGTGGGG + Intronic
986486575 5:8243905-8243927 TTGCAGATGCCACTGGGGAAGGG - Intergenic
986512086 5:8517842-8517864 TTTAAGATGAGATTTGGGTCGGG + Intergenic
986677613 5:10200656-10200678 TTTGAGATGAGACTTGGGTGGGG + Intergenic
986975254 5:13386785-13386807 TTGGAGATGAGATTTGGGTAGGG - Intergenic
987013279 5:13790475-13790497 TTCCAGATGAGATTTGGGTGGGG - Intronic
987105034 5:14630188-14630210 TTTGAGATGACACTTGGGTGGGG + Intergenic
987137846 5:14916568-14916590 TTCAAGATGAGACTTGGGTGGGG - Intergenic
987159118 5:15121873-15121895 TTCAAGATGAGACTTGGGTGGGG + Intergenic
987213705 5:15710887-15710909 TTGAAGATGAGATTTGGGTGGGG - Intronic
987350874 5:17020636-17020658 TTCAAGATGACATTTGGGTGGGG + Intergenic
987433668 5:17866146-17866168 TTCAAGATGACATTTGGGTGGGG - Intergenic
987481109 5:18459171-18459193 TTCAAGATGAGACTTGGGTGGGG - Intergenic
987564525 5:19566705-19566727 TTCAAGATGAGACTTGGGTGAGG + Intronic
988111662 5:26830644-26830666 TTGGAGATGAGATTTGGGTGGGG - Intergenic
988230136 5:28466211-28466233 TTCAAGATGAGACTTGGGTGGGG - Intergenic
988425379 5:31057522-31057544 TTGGAGATGACATTTGGATGGGG + Intergenic
988669070 5:33361476-33361498 TTCAAGATGAGATTTGGGTCAGG + Intergenic
988871412 5:35394286-35394308 TTGAAGATGAGATTTGGGTGGGG + Intergenic
989767570 5:45104689-45104711 TTGGAGATGAGATTTGGGTGGGG - Intergenic
989821883 5:45802114-45802136 TTCCAGATGAGATTTGGGTGGGG - Intergenic
990631434 5:57674636-57674658 TTCCAGATGAGATTTGGGTGGGG + Intergenic
991185253 5:63799286-63799308 TTCCAAATGAGATTTGGGTCAGG - Intergenic
991498568 5:67252818-67252840 TTGGAGATGAGATTTGGGTGGGG - Intergenic
991516135 5:67437663-67437685 TTCAAGATGAGACTTGGGTGGGG - Intergenic
991709147 5:69390349-69390371 TTAAAAATGAAACTTGGGTCAGG + Intronic
992583061 5:78201973-78201995 TTGAAGATGAGATTTGGGTGGGG - Intronic
992591356 5:78299489-78299511 TTTCAGATGAGATTTGGGTGGGG - Intergenic
992922604 5:81542656-81542678 TTCCAGATGAGATTTGGGTGAGG - Intronic
993176675 5:84495030-84495052 TTGGAGATGAGATTTGGGTGGGG + Intergenic
993332034 5:86612541-86612563 TTCAAGATGACATTTGGGTGGGG + Intergenic
993442308 5:87972579-87972601 TTCAAGATGAGACTTGGGTAGGG + Intergenic
993761513 5:91801821-91801843 TTCAAGATGACATTTGGGTGGGG + Intergenic
994421040 5:99526617-99526639 TTCCAGATGAGATTTGGGTGGGG + Intergenic
994486004 5:100387697-100387719 TTCCAGATGAGATTTGGGTGGGG - Intergenic
994715660 5:103318758-103318780 TTCAAGATGAGACTTGGGTGGGG - Intergenic
994864350 5:105246536-105246558 TTCCAGATGAGATTTGGGTGGGG + Intergenic
994928126 5:106145882-106145904 TTCAAGATGACATTTGGGTGGGG + Intergenic
994941223 5:106326711-106326733 TTCAAGATGAGACTTGGGTGGGG + Intergenic
995152168 5:108861054-108861076 TTCCAGATGAGATTTGGGTGGGG + Intronic
995299163 5:110557815-110557837 TTGAACATGAGACTTGGGTGAGG + Intronic
996024709 5:118632071-118632093 TTCAAGATGAGACTTGGGTGGGG - Intergenic
996627818 5:125590750-125590772 ATGCAGAAGACACATGGGTCTGG - Intergenic
996819940 5:127615480-127615502 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1000288279 5:159846667-159846689 TTGCACATGGCAGTTGGCTCAGG - Intergenic
1000465139 5:161566571-161566593 TTCCAGATGAAATTTGGGTGGGG - Intronic
1000672335 5:164078151-164078173 TTCAAGATGACACTTGGGTGGGG - Intergenic
1000695155 5:164371599-164371621 TTTGAGATGAGACTTGGGTGGGG + Intergenic
1000725887 5:164770166-164770188 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1000946972 5:167435239-167435261 TTCAAGATGAGACTTGGGTGGGG - Intronic
1001663855 5:173416386-173416408 TTCAAGATGACATTTGGGTGGGG - Intergenic
1001779020 5:174351515-174351537 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1001918479 5:175581649-175581671 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1003200807 6:3958604-3958626 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1003330351 6:5123949-5123971 CCTCAGATGACACTGGGGTCTGG + Intronic
1003373794 6:5554999-5555021 TTCAAGATGAGACTTGGGTGGGG - Intronic
1003470413 6:6424689-6424711 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1003632411 6:7799857-7799879 ATGCAGATGACACCTAGGTCAGG - Intronic
1003757269 6:9135720-9135742 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1004343967 6:14831282-14831304 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1004522305 6:16373531-16373553 TTCAGGATGACACTTGGGTGGGG - Intronic
1004854046 6:19731324-19731346 TTCCAGATGACAGTTGGGCCAGG - Intergenic
1005149610 6:22733962-22733984 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1005258604 6:24032176-24032198 TTCAAGATGAAACTTGGGTGGGG + Intergenic
1005499484 6:26417578-26417600 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1005655417 6:27930303-27930325 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1005694622 6:28340310-28340332 TTCAAGATGACATTTGGGTGGGG - Intronic
1007054645 6:38870201-38870223 TTCCAGATGAGATTTGGGTAGGG + Intronic
1007343292 6:41207723-41207745 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1007866357 6:44973967-44973989 TTCCAGATGAGATTTGGGTGGGG + Intronic
1008153695 6:47988512-47988534 TTGAAGATGAGATTTGGGTGGGG - Intronic
1008260891 6:49365787-49365809 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1008871084 6:56272611-56272633 TTGGAGATGAGATTTGGGTGGGG - Intronic
1009058800 6:58372368-58372390 TTTTAGATGACATTTGGGTTGGG + Intergenic
1009181565 6:60524219-60524241 TTCAAGATGAGATTTGGGTCAGG + Intergenic
1009445764 6:63740169-63740191 TTCAAGATGAGACTTGGGTGGGG - Intronic
1010005378 6:70990422-70990444 TTTGAGATGACATTTGGGTGGGG - Intergenic
1010132211 6:72507338-72507360 TTCGAGATTACACTTGGGTGGGG + Intergenic
1010494318 6:76514385-76514407 TTCAAGATGACATTTGGGTAGGG + Intergenic
1010694657 6:78955898-78955920 TGGGAGATGAGACTTGGGTTTGG - Intronic
1010713998 6:79207258-79207280 TTCAAGATGACATTTGGGTGGGG - Intronic
1010909764 6:81538881-81538903 TTCCAGATGAAATTTGGGTGGGG - Intronic
1010929859 6:81788728-81788750 TTGGAGATGGCAATTGGGTTAGG - Intergenic
1011439039 6:87368595-87368617 TTCAAGATGAGACTTGGGTGGGG + Intronic
1011885951 6:92096113-92096135 TTTAAGATGAGACTTGGGTAGGG - Intergenic
1011956557 6:93031061-93031083 TTTGAGATGAGACTTGGGTGAGG + Intergenic
1012223948 6:96684492-96684514 TTCAAGATGAGATTTGGGTCGGG - Intergenic
1012342280 6:98142365-98142387 TTTAAGATGACATTTGGGTGAGG + Intergenic
1012617508 6:101294651-101294673 TTTCAGATGATATTTGGGTGGGG + Intergenic
1012669082 6:102017420-102017442 TTCCAGATGAGACTTGAGTGGGG + Intronic
1012690652 6:102307438-102307460 TTGAAGATGAGATTTGGGTTGGG + Intergenic
1012955300 6:105563517-105563539 TTGCACATGCCACCTGGGACTGG - Intergenic
1013688199 6:112610056-112610078 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1013701034 6:112769939-112769961 TTCAAGATGAGACTTGGGTCGGG - Intergenic
1014019297 6:116569270-116569292 TTCAAGATGACATTTGGGTGGGG + Intergenic
1014487455 6:122016817-122016839 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1014578199 6:123100431-123100453 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1014647148 6:123988195-123988217 TTGCATATGACTTTTGTGTCTGG + Intronic
1014668812 6:124273195-124273217 TTGGAGATGAGATTTGGGTGGGG - Intronic
1014933898 6:127364634-127364656 TTTGAGATGACATTTGGGTGGGG - Intergenic
1015775452 6:136809466-136809488 TTCAAGATGAGACTTGGGTGCGG + Intergenic
1016020893 6:139235514-139235536 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1016168604 6:140978997-140979019 TTCAAGATGAGACTTGGGTAGGG + Intergenic
1016246803 6:141992846-141992868 TTCAAGATGAAACTTGGGTGGGG - Intergenic
1016306140 6:142685537-142685559 TTCAAGGTGACATTTGGGTCGGG + Intergenic
1016353605 6:143194420-143194442 TTCCAGATGAGATTTGGGTGGGG + Intronic
1016399262 6:143660503-143660525 TTGGAGATGAGATTTGGGTGGGG + Intronic
1016611846 6:145999050-145999072 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1017186117 6:151602498-151602520 TTCAAGATGACATTTGGGTAGGG - Intronic
1017321668 6:153101626-153101648 TTCAAGATGAGACTTGGGTGGGG - Intronic
1017398351 6:154029661-154029683 TTCAAGATGAGATTTGGGTCAGG - Intronic
1017580311 6:155858148-155858170 TTGAAGATGAGATTTGGGTGTGG - Intergenic
1017652341 6:156595008-156595030 TTCCAGATGAGATTTGGGTAGGG + Intergenic
1018032170 6:159849984-159850006 TTCAAGATGACATTTGGGTGGGG - Intergenic
1018614351 6:165672512-165672534 TTCCAGATGAGATTTGGGTGGGG - Intronic
1019216271 6:170445834-170445856 CCGCAGATCACCCTTGGGTCTGG - Intergenic
1019643601 7:2117451-2117473 TTTCAGATGAGATTTGGGTGGGG - Intronic
1020135728 7:5586856-5586878 TTGCAGAACGCACTTGGGTTTGG + Intergenic
1020704654 7:11529431-11529453 TTCAAGATGAGATTTGGGTCGGG - Intronic
1020789954 7:12615258-12615280 TTACAGATGAGATTTGGGTGAGG - Intronic
1020852808 7:13378328-13378350 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1021201006 7:17728548-17728570 TTGCACATGAGATTTGGGTGGGG + Intergenic
1021311310 7:19101259-19101281 TTCAAGATGTCATTTGGGTCTGG - Intronic
1021619747 7:22539721-22539743 TTGGAGATGAGAGTTGGGTGGGG - Intronic
1021624570 7:22580012-22580034 TTCCAGATGAGATTTGGGTGGGG + Intronic
1021643886 7:22768647-22768669 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1024207679 7:47177727-47177749 TTGAAGATGAGATTTGGGTAGGG - Intergenic
1024272470 7:47652997-47653019 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1024383681 7:48726658-48726680 TTCAAGATGACATTTGGGTGGGG + Intergenic
1024741528 7:52360133-52360155 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1024889796 7:54186765-54186787 TTGCTGATGAAGCTTGGATCTGG - Intergenic
1025725350 7:64053175-64053197 TTCCAGATGAGATTTGGGTGGGG - Intronic
1026307454 7:69154346-69154368 ATTCAGATGAGACTTGGGTAGGG + Intergenic
1026590846 7:71694276-71694298 TTCCAGATGAGATTTGGGTGGGG + Intronic
1026622904 7:71966344-71966366 TTGAACATGAGACTTGGGTGGGG - Intronic
1026654650 7:72246466-72246488 TGGCAGGTGACACTGGGGGCAGG - Intronic
1026676961 7:72436182-72436204 TTCAAGATGAGACTTGGGTGGGG - Intronic
1027442540 7:78235397-78235419 TTCAAGATGAGACTTGGGTGGGG - Intronic
1027558279 7:79693938-79693960 TTCCAGATGAGATTTGGGTAGGG - Intergenic
1027605247 7:80291932-80291954 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1027810803 7:82894616-82894638 TTCAAGATGACATTTGGGTAGGG + Intronic
1027849895 7:83437116-83437138 TTCAAGATGAGATTTGGGTCAGG + Intronic
1028032523 7:85933685-85933707 ATTCAGATGAAATTTGGGTCGGG - Intergenic
1028133802 7:87206225-87206247 TTCAAGATGACATTTGGGTGAGG + Intronic
1028371520 7:90097878-90097900 TTGGAGATGAGAGTTGGGTGGGG + Intergenic
1028720263 7:94022633-94022655 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1028817811 7:95167350-95167372 TTGAAGATGAGATTTGGGTGGGG + Intronic
1029070374 7:97891338-97891360 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1029158383 7:98533494-98533516 TTGCAGCTGATGGTTGGGTCAGG - Intergenic
1029179527 7:98690045-98690067 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1029254331 7:99259129-99259151 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1030487909 7:110194177-110194199 TTCCAGATGAGATTTGGGTGAGG + Intergenic
1030619898 7:111777641-111777663 TTGAAGATGAGATTTGGGTGGGG - Intronic
1031453436 7:121950292-121950314 TTCAAGATGAGACTTGGGTGGGG + Intronic
1031521915 7:122777529-122777551 TTCAAGATGACATTTGGGTGGGG - Intronic
1031543728 7:123027202-123027224 TTCAAGATGACATTTGGGTGGGG + Intergenic
1031800792 7:126242357-126242379 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1031803091 7:126273815-126273837 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1032440191 7:131936937-131936959 TTCAAGATGACATTTGGGTGGGG - Intergenic
1032774868 7:135101800-135101822 TTGAAGATGAGATTTGGGTGGGG - Intronic
1032788460 7:135221025-135221047 TTAAAGATGACATTTGGGTGGGG + Intergenic
1032873921 7:136016960-136016982 TTCGAGATGAGACTTGGGTGGGG + Intergenic
1032977391 7:137241232-137241254 TTGGAGATGAGATTTGTGTCGGG + Intronic
1033532434 7:142278380-142278402 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1033833865 7:145284866-145284888 TTGAAGATGAGATTTGGGTAGGG + Intergenic
1034204139 7:149301092-149301114 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1034467894 7:151240434-151240456 TGGTTGATGACAATTGGGTCAGG + Exonic
1034750205 7:153561226-153561248 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1035038566 7:155911158-155911180 TTCAAGATGAGACTTGGGTGAGG + Intergenic
1035116582 7:156529610-156529632 TTCAAGATGACATTTGGGTAGGG + Intergenic
1036444670 8:8811142-8811164 CTGCGGATGACACTTGGGTAGGG - Intronic
1036623021 8:10439274-10439296 TTGAAGATGAAATTTGGGTGGGG + Intergenic
1036886060 8:12554611-12554633 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1037107809 8:15131168-15131190 TTCAAGATGACATTTGGGTGGGG - Intronic
1037126271 8:15354333-15354355 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1037298519 8:17427247-17427269 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1037753700 8:21698299-21698321 TTGCAGATGGCACTGGGGGAAGG + Intronic
1038129067 8:24708583-24708605 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1038345050 8:26725061-26725083 TTCAAGATGACATTTGGGTGGGG - Intergenic
1039037855 8:33378919-33378941 TTCAAGATGACATTTGGGTGGGG - Intronic
1039496991 8:37987733-37987755 TTCGACATGACACTTGGGTGGGG + Intergenic
1039684292 8:39780308-39780330 TTCAAGATGACATTTGGGTGGGG + Intronic
1039726092 8:40218287-40218309 TTCAAGATGAGATTTGGGTCGGG - Intergenic
1040279953 8:46035090-46035112 TTCCAGATGACAAATGGGTGAGG - Intergenic
1040384933 8:46908558-46908580 TTCAAGATGAGACTTGGGTGTGG - Intergenic
1040577628 8:48667598-48667620 TTCCATATGACATTTGGGTGGGG + Intergenic
1040640171 8:49324222-49324244 TTCCAGATGAGATTTGGGTAGGG - Intergenic
1040650626 8:49445495-49445517 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1041422706 8:57686570-57686592 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1041651100 8:60303855-60303877 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1041825818 8:62095452-62095474 TTTAAGATGAGACTTGGGTCAGG + Intergenic
1042393719 8:68266022-68266044 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1042769830 8:72367483-72367505 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1042981337 8:74532373-74532395 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1043073101 8:75664196-75664218 TTGAAGATGAGATTTGGGTAGGG - Intergenic
1043073722 8:75669328-75669350 TTTAAGATGAGATTTGGGTCGGG - Intergenic
1043237171 8:77882182-77882204 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1043517708 8:81011224-81011246 TTCAAGATGACATTTGGGTGGGG - Intronic
1043607434 8:82019441-82019463 TTCAAGATGACATTTGGGTGGGG - Intergenic
1043996739 8:86826923-86826945 TTGCAGGTGACAAGTGGGGCCGG + Intergenic
1044068596 8:87727398-87727420 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1044168438 8:89018448-89018470 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1044290685 8:90465448-90465470 TTCAAGATGACATTTGGGTGGGG - Intergenic
1044538116 8:93380962-93380984 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1044564925 8:93652651-93652673 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1044918933 8:97147764-97147786 TTGAGGATGACATTTGGGTGGGG - Intronic
1044981954 8:97725269-97725291 ATGCAGTTGACACTTGTGTATGG + Exonic
1045349135 8:101322388-101322410 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1046235582 8:111420284-111420306 TTCAAGATGACATTTGGGTGGGG - Intergenic
1046236005 8:111424591-111424613 TTCCAGATGAGATTTGGGTGAGG - Intergenic
1046388235 8:113532132-113532154 TTGAACATGAGATTTGGGTCGGG - Intergenic
1046401084 8:113703967-113703989 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1046499053 8:115052222-115052244 TTCGAGATGAGATTTGGGTCAGG + Intergenic
1046814886 8:118572468-118572490 TTGAAGATGAGATTTGGGTGAGG - Intronic
1047049851 8:121098596-121098618 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1047062496 8:121243770-121243792 TTCAAGATGACATTTGGGTGGGG - Intergenic
1047080769 8:121457997-121458019 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1047799203 8:128291555-128291577 TTCAAGATGACATTTGGGTGAGG - Intergenic
1048030564 8:130627849-130627871 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1048222933 8:132560206-132560228 TTCCAGATGAGATTTGGGTGAGG + Intergenic
1048226668 8:132594515-132594537 TTCCAGATGATATTTGGGTGGGG - Intronic
1048318529 8:133380064-133380086 TTGGAGATGAGACTTGGATGGGG + Intergenic
1048676444 8:136788336-136788358 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1049626464 8:143624674-143624696 TTCCAGATGAGATTTGGGTGGGG + Intergenic
1050043188 9:1516862-1516884 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1050769383 9:9177353-9177375 TTCCAGATGAGATTTGGGTGGGG + Intronic
1050987668 9:12103345-12103367 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1051028744 9:12647690-12647712 TTGGAGATGAGATTTGGGTGAGG + Intergenic
1051089177 9:13385957-13385979 TTCAAGATGAGATTTGGGTCAGG - Intergenic
1051366483 9:16325066-16325088 TTGTAGATAACACACGGGTCTGG + Intergenic
1051493820 9:17696745-17696767 TTGAAGATGAGATTTGGGTGGGG + Intronic
1051830101 9:21266371-21266393 TTGCCTGTGACACTTGGCTCAGG - Intergenic
1051967274 9:22844480-22844502 TTCCAGATGAGATTTGGGTGAGG + Intergenic
1052062972 9:23983585-23983607 TTCAAGATGACATTTGGGTGGGG + Intergenic
1052267322 9:26589900-26589922 TTCAAGATGATACTTGGGTAGGG + Intergenic
1052368534 9:27639928-27639950 GTGCAGAAGACAGATGGGTCTGG + Intergenic
1052397189 9:27953474-27953496 TTCCAGATGAGATTTGGGTGGGG - Intronic
1052472595 9:28918371-28918393 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1052522324 9:29563683-29563705 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1052557275 9:30033248-30033270 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1052571831 9:30235282-30235304 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1055534788 9:77229006-77229028 TTCAAGATGAGATTTGGGTCGGG + Intronic
1055714907 9:79107480-79107502 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1056360809 9:85855748-85855770 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1057560030 9:96120101-96120123 TTCAAGATGACATTTGGGTGGGG + Intergenic
1057744989 9:97744112-97744134 TTGGAGATGAGATTTGGGTGAGG - Intergenic
1057749256 9:97778571-97778593 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1058324754 9:103681492-103681514 TTGGAGATGAGATTTGGGTGGGG - Intergenic
1058604094 9:106702360-106702382 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1058940363 9:109807754-109807776 TTCAAGATGAGATTTGGGTCGGG - Intronic
1058988004 9:110227272-110227294 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1059177755 9:112182955-112182977 TTGCAGATGAGATTTGGATGGGG - Intergenic
1059578854 9:115521820-115521842 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1059581265 9:115550998-115551020 TTGCTTAGGACACTGGGGTCAGG + Intergenic
1059826100 9:118030562-118030584 TTCAAGATGACATTTGGGTGGGG + Intergenic
1059946386 9:119412657-119412679 ATGCAGGTGACACTTGGGTCAGG + Intergenic
1059968163 9:119636863-119636885 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1060008333 9:120020398-120020420 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1060291338 9:122305625-122305647 GAGCAGATGACACTGGGGTCAGG + Intronic
1060327863 9:122634673-122634695 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1060603755 9:124896065-124896087 TTGTAGATGACACCTAGGTTTGG - Intronic
1062064467 9:134518672-134518694 TTCCAGATGAGATTTGGGTAGGG - Intergenic
1203611385 Un_KI270749v1:9111-9133 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1185952913 X:4456333-4456355 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1186025286 X:5304272-5304294 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1186042893 X:5501490-5501512 TTCAAGATGAAATTTGGGTCGGG - Intergenic
1186086986 X:6001209-6001231 TTCAAGATGACATTTGGGTGAGG + Intronic
1186379827 X:9046441-9046463 TTCGAGATGAGACTTGGGTGGGG + Intronic
1186468254 X:9801309-9801331 TTGAAGATGAGATTTGGGTGGGG + Intronic
1187331508 X:18344478-18344500 TTGAAGATGAGATTTGGGTAGGG - Intronic
1187796351 X:23007869-23007891 TTCAAGATGACATTTGGGTGGGG + Intergenic
1188662530 X:32776703-32776725 TTTGAGATGAGACTTGGGTAGGG + Intronic
1188873019 X:35397782-35397804 TTCAAGATGACATTTGGGTGGGG + Intergenic
1189087890 X:38046571-38046593 TTCAAGATGAAACTTGGGTGGGG + Intronic
1189228693 X:39435140-39435162 TCTCAGATGAGACTTGGGACTGG - Intergenic
1189410442 X:40765715-40765737 TTGAAGATGAAATTTGGGTGGGG + Intergenic
1189958859 X:46306158-46306180 TTCGAGATGAGACTTGGGTGGGG + Intergenic
1190169558 X:48101077-48101099 TTCCAGATGAGATTTGGGTGAGG + Intergenic
1190170159 X:48105950-48105972 TTCGAGATGAGACTTGGGTGGGG + Intergenic
1190656963 X:52621073-52621095 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1192323454 X:70111886-70111908 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1193140216 X:78019047-78019069 TTAGAGATGAAACTTGGGTGGGG + Intronic
1193280555 X:79643609-79643631 TTCAAGATGACATTTGGGTGGGG - Intergenic
1193679165 X:84496910-84496932 TTCCAGATAAGACTTGGGTGGGG - Intronic
1193702674 X:84781726-84781748 TTCCAGATGAGATTTGGGTAGGG + Intergenic
1193761330 X:85470024-85470046 TTCCAGATGAGATTTGGGTGGGG - Intergenic
1193795416 X:85867119-85867141 TTGCAAATGAGATTTGGGTAGGG - Intronic
1194082445 X:89485932-89485954 TTCAAGATGACATTTGGGTGGGG + Intergenic
1194087975 X:89552404-89552426 TTCCAGATGATATTTGGGTGGGG + Intergenic
1194107937 X:89794121-89794143 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1194159598 X:90434492-90434514 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1194252991 X:91600780-91600802 TTCAAGATGACATTTGGGTGGGG + Intergenic
1194332327 X:92599324-92599346 TTCAAGATGAGACTTGGGTGTGG - Intronic
1194448864 X:94017595-94017617 TTTAAGATGAGACTTGGGTGGGG - Intergenic
1194501866 X:94691148-94691170 TTTGAGATGAGACTTGGGTGGGG - Intergenic
1194578356 X:95641208-95641230 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1194720724 X:97337315-97337337 TTCAAGATGACATTTGGGTGGGG - Intronic
1194841873 X:98753415-98753437 TTCAAGATGAGATTTGGGTCGGG + Intergenic
1194861095 X:98999652-98999674 TTCAAGATGACATTTGGGTGGGG - Intergenic
1194886006 X:99317475-99317497 TTGAAGATGAGATTTGGGTGGGG - Intergenic
1194982441 X:100454039-100454061 TTCAAGATGAGATTTGGGTCAGG - Intergenic
1195126622 X:101814755-101814777 TTGAAGATGAGATTTGGGTGGGG + Intergenic
1195300822 X:103528366-103528388 TTCAAGATGAGACTTGGGTGGGG + Intergenic
1195634385 X:107097354-107097376 TTCCAGATGAGATTTGGGTGGGG - Intronic
1196129512 X:112139739-112139761 TTCAAGATGACATTTGGGTGGGG - Intergenic
1196268750 X:113685672-113685694 TTTCAGATGAGATTTGGGTGGGG + Intergenic
1196276590 X:113772973-113772995 TTGGAGATGATATTTGGGTGGGG + Intergenic
1196522335 X:116687909-116687931 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1196548973 X:116998665-116998687 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1196998643 X:121413401-121413423 TTTGAGATGAGACTTGGGTGGGG - Intergenic
1197483346 X:127014813-127014835 TTCAAGATGACATTTGGGTGGGG - Intergenic
1198497036 X:137203461-137203483 TTTGAGATGAGACTTGGGTGGGG + Intergenic
1198673779 X:139110311-139110333 TTCAAGATGACATTTGGGTGGGG - Intronic
1198693398 X:139308317-139308339 TTTGAGATGAGACTTGGGTGGGG - Intergenic
1198999347 X:142615832-142615854 TTGAACATGAGATTTGGGTCGGG - Intergenic
1199178926 X:144829199-144829221 TTTCAGATGAGATTTGGGTGGGG - Intergenic
1199240934 X:145546438-145546460 TTCAAGATGACATTTGGGTAGGG + Intergenic
1199880033 X:151966769-151966791 TTTCAAAAGACACTTGGCTCAGG + Intronic
1200367346 X:155681109-155681131 TTGAAGATGAAATTTGGGTGGGG - Intergenic
1200381692 X:155843666-155843688 TTCAAGATGACATTTGGGTTGGG - Intergenic
1200440646 Y:3208397-3208419 TTCCAGATGATATTTGGGTGGGG - Intergenic
1200459889 Y:3441906-3441928 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1200505899 Y:4011458-4011480 TTCAAGATGAGACTTGGGTGGGG - Intergenic
1200571926 Y:4842020-4842042 TTCAAGATGACATTTGGGTGGGG + Intergenic
1200777966 Y:7186675-7186697 TTGGAGATGAGATTTGGGTGGGG + Intergenic
1200805253 Y:7427292-7427314 GTGCTGTTGACACTTGGGGCTGG + Intergenic
1201381832 Y:13388706-13388728 TTGAAGATGAGATTTGGGTGGGG - Intronic
1201475222 Y:14374547-14374569 TTGGAGATGAGATTTGGGTTGGG - Intergenic
1201504382 Y:14681479-14681501 TTCTAGATGACATTTGGGACAGG + Intronic
1201590593 Y:15610748-15610770 TTGCAGATGCCACTGGTGTATGG - Intergenic
1201619353 Y:15938571-15938593 TTCAAGATGACATTTGGGTGGGG - Intergenic