ID: 1107052409

View in Genome Browser
Species Human (GRCh38)
Location 13:36065599-36065621
Sequence CTATAGTTCTAGAGATAAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 0, 2: 3, 3: 11, 4: 157}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107052409 Original CRISPR CTATAGTTCTAGAGATAAGA GGG (reversed) Intronic
902148661 1:14424804-14424826 CTGTAATTCCAGAGAAAAGAAGG + Intergenic
904252238 1:29233346-29233368 CTATAATCCTTGAGAGAAGAAGG - Intergenic
906414175 1:45607017-45607039 CTATAGTTTTACATATCAGATGG + Intronic
910234610 1:85022852-85022874 ATACAGTTATAGAGATAAGGTGG + Intronic
911957747 1:104259723-104259745 TTATGGTTCAAGAGAAAAGAGGG + Intergenic
915730708 1:158052174-158052196 CTAGAGTTCAAGAGAAGAGAGGG - Intronic
916404386 1:164483246-164483268 GGATAGTTCTATAGATAAGCAGG - Intergenic
917831579 1:178895580-178895602 CTAGAGTTCAGGAGACAAGAAGG + Intronic
917872397 1:179253826-179253848 CTCAGGTTCTAGAGATTAGAAGG - Intergenic
918955911 1:191206900-191206922 CTATATTTCAAGAAATATGAAGG + Intergenic
1064225574 10:13481397-13481419 CTATCATTCTAGAGCTAACAGGG + Intronic
1065872801 10:29970421-29970443 CTATAGTTGTGGAGATCAAATGG + Intergenic
1068184636 10:53569200-53569222 CTATATGTCTAGAAAAAAGAAGG - Intergenic
1069015991 10:63429769-63429791 CTATATTACTACAAATAAGAAGG + Intronic
1070090592 10:73281493-73281515 CTATATATCTAGTGATGAGATGG + Intronic
1074610013 10:115012567-115012589 CAATATTTTTGGAGATAAGAAGG + Intergenic
1075971362 10:126656646-126656668 CTATAGCTTTAGAGAGCAGACGG + Intronic
1076201068 10:128558498-128558520 CAGTAATTCTAGAGATAGGAAGG - Intergenic
1078712600 11:13809233-13809255 CTATATTTCTAGAGAAAGGAGGG - Intergenic
1080938862 11:36891835-36891857 CTATAGTTGTTGAGAAGAGAAGG + Intergenic
1086352630 11:85958048-85958070 CTAGAGTTTTAGTGAAAAGAAGG + Intronic
1086594420 11:88554067-88554089 TTACAGTTCTGGAGATCAGAAGG + Intronic
1088266992 11:107997374-107997396 TTATAGTTCTGGAGGTCAGAAGG - Intergenic
1094209877 12:27877910-27877932 CTTAAGTTCTAGAGTTAAAATGG + Intergenic
1095390411 12:41699314-41699336 CTATAATTCTAGAAATAAGAGGG + Intergenic
1095529250 12:43165754-43165776 GTATAGTTTTACAGATAACACGG - Intergenic
1103981536 12:124739924-124739946 TTACAGTTCTAGAGGTCAGAAGG + Intergenic
1104063127 12:125284873-125284895 CTTTATTTTCAGAGATAAGAAGG + Intronic
1105674380 13:22654576-22654598 ATATAGTTACAGAGAGAAGATGG + Intergenic
1107052409 13:36065599-36065621 CTATAGTTCTAGAGATAAGAGGG - Intronic
1107597916 13:41982607-41982629 CTTTAGTTATGGAGATATGACGG - Intergenic
1108785178 13:53891646-53891668 CTATAGTGCTAGAGTGAAGTAGG - Intergenic
1110722592 13:78781165-78781187 CTTTAGTTTTAGAGTTAAAATGG + Intergenic
1111233122 13:85371228-85371250 CTCTACTTCTAGAAATATGATGG + Intergenic
1111489603 13:88954456-88954478 CTACAGCTCCAGAGAGAAGAGGG - Intergenic
1111565068 13:90003339-90003361 CTATGAATCTAGAGACAAGATGG + Intergenic
1114849841 14:26370686-26370708 CTCTTTTTCTAGAGATAAAAGGG - Intergenic
1117359277 14:54957303-54957325 ATTTAGTTCTAAAGATGAGATGG - Intronic
1118900846 14:69984085-69984107 CTAGAGTTCTAGAGATAGTGTGG + Intronic
1120259031 14:82159320-82159342 CTATGATTCTAGAGGCAAGATGG - Intergenic
1124713476 15:32034183-32034205 TTAGAGTTCTAAAGATGAGAAGG + Intronic
1127160975 15:56185543-56185565 GTATAGTCTTAGAGTTAAGAAGG - Intronic
1127354302 15:58183319-58183341 CTATAGTTCTGGGGAAAAGCAGG - Intronic
1127653078 15:61028315-61028337 CTATTGTGCTGGAGATAGGAAGG - Intronic
1129959494 15:79670439-79670461 CTAAAGTTCAAGGGAAAAGAGGG - Intergenic
1135020817 16:18961664-18961686 CTGGAGTTCTAGAGAGAGGATGG - Intergenic
1136271878 16:29153455-29153477 CTCTAGTTCTGGAGACCAGAAGG + Intergenic
1136865338 16:33746104-33746126 CTTTAGTGCAAGAGATGAGAAGG + Intergenic
1142075543 16:88115611-88115633 CTCTAGTTCTGGAGACCAGAAGG + Intronic
1203126700 16_KI270728v1_random:1592370-1592392 CTTTAGTGCAAGAGATGAGAAGG + Intergenic
1144766684 17:17737055-17737077 GAATATTTCTGGAGATAAGATGG + Intronic
1146702329 17:34971968-34971990 CTATACTCCTCGAAATAAGAGGG + Intronic
1146840652 17:36151038-36151060 CCAGAGTTCTACAGATAATAAGG + Intergenic
1149287129 17:55177123-55177145 TTATAGGTACAGAGATAAGAGGG - Intergenic
1150040563 17:61855771-61855793 CTAGAGTTCTAGGGATACAATGG + Intronic
1150055707 17:62013428-62013450 CTATAGTTATTGAGATAATATGG - Intronic
1155951994 18:31923844-31923866 CTCTAGTTCTAAAAATAATAAGG + Intronic
1159102109 18:63969174-63969196 CTATGGCTCTAAAGAAAAGAAGG + Intronic
1159139673 18:64378337-64378359 GTACAGTTCTAGAGAAGAGATGG + Intergenic
1161815043 19:6494796-6494818 TTATAGGTCTAGAGGTAAAATGG + Exonic
1162652048 19:12096209-12096231 CTACAGTTCTAGTAATAAGAGGG + Intronic
925704120 2:6667974-6667996 ATAGAATTCTAGAGATAGGAAGG + Intergenic
926034059 2:9620754-9620776 CTATATTCCTAGGGATAAGATGG + Intronic
928203077 2:29263641-29263663 CTAGAGGACTAGAGAAAAGAAGG + Intronic
930228454 2:48818981-48819003 CTGTAGTTAGATAGATAAGAGGG + Intergenic
934633856 2:95962920-95962942 CTTTAGTGCAAGAGATGAGAAGG + Intronic
934799770 2:97142245-97142267 CTTTAGTGCAAGAGATGAGAAGG - Intronic
939525331 2:143287041-143287063 CTAAAGTTCTAGAGGTGAAATGG + Intronic
941510985 2:166409270-166409292 AAATAGTTTTAGAGATTAGAGGG + Intronic
942554738 2:177160158-177160180 ATGTAGATTTAGAGATAAGATGG - Intergenic
943918219 2:193665953-193665975 TTATATTTCTAGAGGTCAGAAGG + Intergenic
944324010 2:198382250-198382272 CTATAGTCCTAGGCATATGAGGG - Intronic
944590456 2:201212334-201212356 CTATAGTGCTAGAGTGAAGTAGG + Intronic
945397005 2:209331436-209331458 ATTTAGGTCTGGAGATAAGATGG - Intergenic
947286232 2:228518137-228518159 CTATAGTTGTACAGATATGTAGG + Intergenic
947519959 2:230837911-230837933 CAATAGTTCAAGAAATAAGCCGG - Intergenic
947990681 2:234485214-234485236 TTACAGTTCTAGGGATCAGAAGG - Intergenic
1169559184 20:6781069-6781091 CAATAGAACTAGAGATAAAAAGG - Intergenic
1170020504 20:11832132-11832154 CTGTATTTCTATAGAGAAGATGG - Intergenic
1170167098 20:13371897-13371919 ATATATTACTAGAGATAAAAAGG - Intergenic
1173115683 20:40240753-40240775 CTATCTATCTAGAGATAATAGGG - Intergenic
1174812304 20:53657214-53657236 CTAAAGTTCTAGAGATCTTATGG + Intergenic
1174872302 20:54194404-54194426 ATATAGTTATAGAGAACAGAGGG + Intergenic
1175177849 20:57124144-57124166 TTATAGTTCTGGAGGTCAGAAGG - Intergenic
1175406636 20:58737265-58737287 CTATAGTTACAGAGAGAAAATGG + Intergenic
1177929662 21:27265285-27265307 CTATAGTTTTAGAGACATAAAGG - Intergenic
1179603996 21:42500171-42500193 TCATAGTTCTATAGTTAAGATGG - Intronic
1184085485 22:42260498-42260520 GTATGGTTCTTGAGATGAGAGGG + Intronic
949439845 3:4068644-4068666 GCATGGTTCTAGAGATGAGAAGG + Intronic
949735055 3:7162177-7162199 GTATAAATCTAGAGTTAAGAGGG + Intronic
951195346 3:19817490-19817512 CTTTAGTTCTAGAGATTGCATGG - Intergenic
955579171 3:60400449-60400471 CTGGAGGTATAGAGATAAGAGGG - Intronic
957392631 3:79597178-79597200 CTAGAGTTCTGTAGATAATACGG + Intronic
960663915 3:120092303-120092325 CTATGGTCCTAGAAATAATAGGG - Intronic
961098600 3:124178846-124178868 CTATAGTTCTAGAGCTTTGGAGG + Intronic
961205114 3:125075697-125075719 TTACAGTTCTAGAGGTCAGAAGG - Intergenic
962124141 3:132597076-132597098 CTATAGTTTTTGAAAAAAGATGG + Intronic
963372515 3:144419334-144419356 TTATAGTTCTAGAGGTCAGAAGG + Intergenic
964344300 3:155740501-155740523 CTATAGTTGTAAATATAAGGTGG - Intronic
964898830 3:161632250-161632272 TTTTATTTGTAGAGATAAGAGGG + Intergenic
964950706 3:162288970-162288992 AAGTAGTTCTAGAGATAAAATGG + Intergenic
965530058 3:169762807-169762829 ATATAATTCTAGAGTAAAGACGG - Intergenic
965887469 3:173464847-173464869 AAATAGTTCTAGAGATAAATAGG - Intronic
966160814 3:176966405-176966427 CTATAGTCCTAGAAATAAGAGGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
967425644 3:189324200-189324222 GTAGAGTTCTGGGGATAAGAAGG + Exonic
970529136 4:16964490-16964512 CCACAGTTCTAGAGGTTAGAAGG - Intergenic
970919400 4:21375445-21375467 CTATAGTGGTAAAGATAACATGG + Intronic
971011982 4:22448442-22448464 CTAAAGTTCTAGAAATGAGGTGG + Intronic
972694427 4:41431322-41431344 CCAAAGTTCTACAGGTAAGAAGG - Intronic
974503493 4:62736248-62736270 CTATATTTATAGAAATAACAAGG + Intergenic
975126916 4:70793323-70793345 CTATAATTCCACATATAAGAAGG + Intronic
975939042 4:79618397-79618419 CTAAAGTTCATGATATAAGATGG - Intergenic
979618493 4:122771600-122771622 CCATAATTCTATAGTTAAGATGG - Intergenic
979918624 4:126471856-126471878 CTTGAGTTCTAGAGAAAAAAGGG + Intergenic
980733484 4:136851176-136851198 ATATAGTTCTGCAGCTAAGATGG + Intergenic
981822561 4:148902773-148902795 CTATAGTTATAGACCTAAGAGGG + Intergenic
982655054 4:158137547-158137569 CTCTAGTTCTATTGATAATATGG - Intronic
982924850 4:161322731-161322753 CTAGAGTTTAAGAGATAACATGG - Intergenic
983286749 4:165749686-165749708 CTATAGGTCTAGACACAATAAGG - Intergenic
984346263 4:178531380-178531402 CTATATGTTAAGAGATAAGAGGG + Intergenic
986482000 5:8198854-8198876 CTGTATTTCTACAGAGAAGATGG + Intergenic
987648117 5:20702685-20702707 TTATACTTCTTGAGATAAAAAGG + Intergenic
990502496 5:56410448-56410470 CTATTTTTATAGAGATGAGAGGG - Intergenic
990722437 5:58711852-58711874 CTATAGTTTTAAAGATAGGGAGG + Intronic
992970729 5:82054643-82054665 CTCTCATTTTAGAGATAAGAGGG - Intronic
993568780 5:89509771-89509793 GTATAGTCCTAGATATAAAAAGG + Intergenic
995391385 5:111643964-111643986 CTATGGCTTTAGAGATAAAATGG - Intergenic
995449365 5:112283519-112283541 CTATAGTTTAAGAGAAAAAAGGG + Intronic
996533733 5:124553866-124553888 TTAAAGTTATAGAGATGAGAAGG - Intergenic
999924937 5:156364834-156364856 CTACAGTTCTGGAGAGAAAATGG - Intronic
1001113382 5:168917696-168917718 GTATGCTTCTAGAGATAATATGG - Intronic
1001115444 5:168935432-168935454 CTCTGGTTGTAGAGATAAGATGG - Intronic
1003272225 6:4617346-4617368 CTACAGTTCTTGAGAGAAGGAGG - Intergenic
1004963184 6:20815970-20815992 CTATAGCTCTGGAGAGAACATGG - Intronic
1008439211 6:51513606-51513628 CAACATTTCTCGAGATAAGATGG - Intergenic
1008652640 6:53578627-53578649 CTATAGTGATAGAAAGAAGATGG - Intronic
1009056315 6:58340480-58340502 CTATAGATCTAGTTATAGGATGG + Intergenic
1009234867 6:61110119-61110141 CTATAGATCTAGTTATAGGATGG - Intergenic
1009321689 6:62298282-62298304 TTATAGTTCTTGAGGTCAGAAGG - Intergenic
1012058588 6:94447252-94447274 CTCTAATTCTAGAAATAAGAGGG + Intergenic
1014620107 6:123657261-123657283 CATTAGTTGTAGAGATAAAAAGG - Intergenic
1014703079 6:124713735-124713757 CTATAACTCTAGAAATAGGAGGG + Intronic
1017528387 6:155263160-155263182 CTATAGTTCTAGAAAAAAATGGG - Intronic
1019924918 7:4185746-4185768 CTAACGTTCTGGGGATAAGAGGG - Intronic
1020894359 7:13921131-13921153 CAATAGTTTTAGAGTTAGGAGGG + Intronic
1024346947 7:48322882-48322904 CTATAGTGATAGAGAACAGATGG - Intronic
1028906111 7:96155857-96155879 CCATCTTTCTAGAGATGAGATGG + Intronic
1032375090 7:131406144-131406166 AAATATTTCTAGAGATAAAAAGG - Intronic
1037613175 8:20493737-20493759 CTAAAGCTCTAGAGAAAACAAGG - Intergenic
1038851724 8:31285158-31285180 CTGTACTTCTTGACATAAGAAGG - Intergenic
1041629938 8:60075890-60075912 CTATAAATCTGGAGATAACAAGG - Intergenic
1042690264 8:71490548-71490570 CAATATTTATAGAGAAAAGATGG + Intronic
1043603834 8:81974907-81974929 CTATAGAGCTAGAAATAAGAAGG + Intergenic
1046042293 8:108920364-108920386 TTAGAGTTGTAGAGAGAAGACGG - Intergenic
1046273252 8:111923139-111923161 ATAAAGTTTCAGAGATAAGAGGG - Intergenic
1046883500 8:119337060-119337082 ATATAGTTCTAGAGATCAAGAGG + Intergenic
1047135775 8:122076494-122076516 AGGGAGTTCTAGAGATAAGATGG - Intergenic
1048196926 8:132339042-132339064 CAAAAGTTCTTGGGATAAGATGG + Intronic
1050441992 9:5674457-5674479 ACAAAGTTCTAGAAATAAGACGG + Intronic
1051390000 9:16553714-16553736 CTTTAGTTCTAGAGAAGAGATGG - Intronic
1188456578 X:30373185-30373207 CTACAGTTCTATAGAGAAGAGGG + Intergenic
1188499506 X:30810122-30810144 CCAGAGTTCTAAAGTTAAGATGG + Intergenic
1189056345 X:37703226-37703248 CTAAAGTCCTAAATATAAGAAGG - Intronic
1193693800 X:84681262-84681284 CAGTAGTTCTAGTTATAAGATGG + Intergenic
1195692363 X:107637833-107637855 CTATACTTCTATAGACAATAAGG - Intronic
1196141271 X:112265864-112265886 TTATAGTTCTAGAGTGAAGGTGG - Intergenic
1196485033 X:116196585-116196607 ATATAGGTCTAGAGACAAAAAGG - Intergenic
1196685853 X:118509729-118509751 TTCCAGTTCTAGAGATCAGAAGG + Intronic
1199067242 X:143434013-143434035 CTATAATTCTAGAAATAAGAGGG - Intergenic
1201480838 Y:14437888-14437910 CTATAGCTTCACAGATAAGAAGG + Intergenic
1202586650 Y:26436538-26436560 CTTTAGTGCAAGAGATGAGAAGG - Intergenic