ID: 1107056055

View in Genome Browser
Species Human (GRCh38)
Location 13:36104737-36104759
Sequence ACTTTCTTCTTCAATGGTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 176
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 164}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107056055_1107056057 23 Left 1107056055 13:36104737-36104759 CCTGTACCATTGAAGAAGAAAGT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1107056057 13:36104783-36104805 CACAACTGACTGACAATAAATGG 0: 1
1: 0
2: 0
3: 20
4: 191
1107056055_1107056058 24 Left 1107056055 13:36104737-36104759 CCTGTACCATTGAAGAAGAAAGT 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1107056058 13:36104784-36104806 ACAACTGACTGACAATAAATGGG 0: 1
1: 0
2: 0
3: 44
4: 349

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107056055 Original CRISPR ACTTTCTTCTTCAATGGTAC AGG (reversed) Intronic
902521410 1:17019533-17019555 ACTTTCTACTTCAATGAAGCTGG - Intronic
904976197 1:34458640-34458662 TCTGTGTTCTTCAATGGTTCAGG - Intergenic
908010575 1:59772972-59772994 AGTTTCTTCTTCAATAGAACAGG - Intergenic
908089940 1:60675338-60675360 CCTTTATTCTTCAATGCTTCAGG - Intergenic
908805830 1:67930564-67930586 TCTTTCTTTTTCTATTGTACTGG + Intergenic
909840208 1:80311528-80311550 AGTTTCTTATTCTATGGTATAGG + Intergenic
916873904 1:168947929-168947951 ACTTTCTTCTTGAAAAGTCCAGG - Intergenic
918368392 1:183834091-183834113 ACTTTCTTATTTAATTGTAGAGG + Intronic
918500308 1:185187524-185187546 TCTTTCTTATTCACTGTTACAGG - Intronic
919759956 1:201091639-201091661 ACCTGCTACTTCATTGGTACAGG - Exonic
921411890 1:214844879-214844901 ACTTACTTCTTAAATGGCTCTGG + Intergenic
921629881 1:217420399-217420421 ACTTTCTTCTTCATTGTTCTGGG + Intergenic
921995336 1:221411789-221411811 ACTTTCTTCTGATATGATACGGG + Intergenic
1063141937 10:3263473-3263495 TGTTTCTTCTTCATTGGAACAGG - Intergenic
1065638574 10:27755763-27755785 ACCTTCTTCTTCAAAGCTACTGG - Intergenic
1067181148 10:43986749-43986771 ATTCCCTTCTTCAATGGCACTGG - Intergenic
1068313157 10:55305516-55305538 TCTTTCTTCTTTAATGGCAAAGG - Intronic
1070502724 10:77086785-77086807 TCTTTCTTTTACCATGGTACTGG - Intronic
1071914332 10:90274514-90274536 ACTTTCTTCTTCACTTCCACTGG - Intergenic
1072402840 10:95122804-95122826 ATTTTATTCTTCAATGGAAATGG - Intergenic
1076320004 10:129571263-129571285 TCTTACTTCTTAAATGATACAGG + Intronic
1077607444 11:3621640-3621662 GCATTCTGCTTCAGTGGTACAGG + Intergenic
1077829609 11:5851811-5851833 ACTTTCTTCGTAAATGGTGCTGG - Intronic
1077930729 11:6729727-6729749 ACTGTGTTCTTAAATGGTATGGG + Intergenic
1081135392 11:39434031-39434053 AAATTCTTCTTCCATGGCACTGG + Intergenic
1081138300 11:39467406-39467428 ACTATATTCTTCAATAGTGCAGG + Intergenic
1081522330 11:43894641-43894663 GCTTTTTTCTCCAATGTTACTGG - Intronic
1081544230 11:44058556-44058578 CCGTTCTTCTTCAAATGTACAGG - Exonic
1082711196 11:56555595-56555617 TCCTTCTTCTTTAATGGTATTGG + Intergenic
1085987895 11:81807561-81807583 ATTTTCTTCTACAATGCCACTGG + Intergenic
1087351246 11:97035578-97035600 ACTTTATTCTTAATAGGTACAGG + Intergenic
1092756374 12:11767020-11767042 ATTTTTTTCTTTAATGGAACAGG + Intronic
1093380999 12:18493058-18493080 ACTTCTTTGTTCAATGGGACTGG - Intronic
1093946425 12:25114870-25114892 ACTTTCTTCATCAATTATAAAGG - Exonic
1094268299 12:28583729-28583751 GGTTTCTTTTTCCATGGTACAGG + Intergenic
1097125788 12:56773887-56773909 ACTACCTTCTGCACTGGTACCGG + Exonic
1097148351 12:56957406-56957428 ACTACCTTCTGCACTGGTACCGG - Exonic
1097151978 12:56985904-56985926 ACTACCTTCTGCACTGGTACTGG - Intergenic
1097716056 12:62967400-62967422 TCTTTCATCTTCATTTGTACTGG + Intergenic
1100418536 12:94405407-94405429 ACTTTTTTCCTCAATGTTTCTGG - Intronic
1101183888 12:102252375-102252397 GCTTTCTTATTCAATTGCACTGG + Intergenic
1101712296 12:107279551-107279573 GCTTGCTTCTTCAAGGGCACAGG - Intergenic
1102504358 12:113374398-113374420 ACCTTCTCCTTCAACGGGACGGG - Intronic
1102803425 12:115757948-115757970 AATTTCTTTTTCAATGGGAAGGG + Intergenic
1103699011 12:122838440-122838462 ACCCTCTTTTTAAATGGTACAGG - Intronic
1106684032 13:32038098-32038120 AGTTTCTTCTTAAATGCTCCTGG + Intronic
1106828230 13:33547735-33547757 ATTTTCTTCTTCAATTTTCCAGG + Intergenic
1107056055 13:36104737-36104759 ACTTTCTTCTTCAATGGTACAGG - Intronic
1109533786 13:63688751-63688773 ACATTCTTCTTCAGTTTTACAGG - Intergenic
1109856132 13:68130192-68130214 ACTTACTTCTTCAGAGGTATGGG + Intergenic
1111224471 13:85251776-85251798 GCTTTCTTCTCCAATTGTATAGG - Intergenic
1111569204 13:90057907-90057929 ACTTTCTTCTTTACTGTTATGGG + Intergenic
1114775017 14:25472147-25472169 ACTTTCTTCCTCTCTGGAACAGG + Intergenic
1114997191 14:28369253-28369275 ACTCTCTTTTTCAATCTTACAGG + Intergenic
1115737475 14:36349405-36349427 ATTTTCTTCTTCATTTGGACTGG - Intergenic
1115825368 14:37266142-37266164 ACTATCTTCTTCAATCTTAGAGG - Intronic
1116590731 14:46768867-46768889 ACTTTATTCTGGAATGGTGCTGG + Intergenic
1116610139 14:47058598-47058620 ACTTTAGTCTTCAATAGTATTGG + Intronic
1117648238 14:57875202-57875224 ACTTGTTTCTTCATTGGTTCAGG + Intronic
1118440845 14:65810224-65810246 ACTTTCTGCCTCAATTGTATAGG + Intergenic
1119077562 14:71657634-71657656 ACTTTGTTCTTCAGTGTTAATGG + Intronic
1119979322 14:79061775-79061797 ACATTCTTCTCCAATGGTGAGGG - Intronic
1123980520 15:25597774-25597796 ACTTTCTTAATCAAAGGAACAGG - Intergenic
1128799366 15:70487817-70487839 AGTTTCTTCTTCAGTGGAATAGG - Intergenic
1128808676 15:70554272-70554294 ACTTTCTTCTTCCATCTTGCTGG - Intergenic
1129284195 15:74510699-74510721 AATTTATTCTCCAATGGTTCTGG - Intergenic
1131394150 15:92073395-92073417 ACTTTCTTGTCCACTGGTTCAGG - Intronic
1131580563 15:93638850-93638872 ATTTTCTTCTTAAATGCTAGGGG - Intergenic
1133534364 16:6686673-6686695 ATTTTCTTCTTTAATGCTAAGGG + Intronic
1136124024 16:28163496-28163518 ACTTTTTTCCCCAATGGTCCAGG + Intronic
1138583034 16:57953924-57953946 ACTTTCTGATTCAAGAGTACCGG - Intronic
1139923310 16:70472801-70472823 GCTTTCTTGTTCAATGGTCTGGG + Intronic
1141578611 16:84981992-84982014 ACATTCTTCTTATATGGTAGGGG - Exonic
1146826093 17:36024264-36024286 ACTTTCTTCTTAAGTGATAAGGG + Intergenic
1149217021 17:54369659-54369681 ACTTTTTTCTTCAATACTAGAGG + Intergenic
1149224928 17:54458748-54458770 ATTTTCTTCTTCACTCTTACAGG - Intergenic
1149527075 17:57364930-57364952 ACTTTCTTCCTCCATGGCACAGG + Intronic
1154165243 18:12009793-12009815 ACCTTTTTCTTTAATGGGACTGG + Intronic
1155519961 18:26657359-26657381 ACTTTGTGCTTCAATGTTTCAGG - Intronic
1156523545 18:37743231-37743253 ATTTTCTTCTTAAATCGTACGGG - Intergenic
1156846551 18:41672575-41672597 CTTTGCTTCTTCAATGGTTCTGG + Intergenic
1158004280 18:52654325-52654347 ATTATCTTGTTCAATGGTAATGG - Intronic
1158254070 18:55525852-55525874 TCTTTCTTCTTCCATGAAACTGG - Intronic
1159749981 18:72288160-72288182 ACTTACTTTTTAAATGGTGCCGG - Intergenic
1163143626 19:15366414-15366436 TGTTTCTTCTTAAGTGGTACAGG - Intronic
1165617830 19:37217953-37217975 ACAATCTTCCTCCATGGTACCGG - Intronic
927452258 2:23219207-23219229 ACTTTCTTATATAGTGGTACAGG - Intergenic
928958217 2:36894076-36894098 ATTTTCTTATTCAGTGGTAAAGG - Intronic
929036792 2:37700733-37700755 ATTTTCTTCTACACTGGTAATGG + Intronic
936751750 2:115650780-115650802 TCTTTCTCCTTCAATGCTACTGG - Intronic
938652234 2:133395418-133395440 CCTTTCCCATTCAATGGTACTGG + Intronic
940419569 2:153463924-153463946 ACTTTCCTCTTCCAGGGAACTGG - Intergenic
940658307 2:156515799-156515821 ACCTTGTTCTGAAATGGTACAGG + Intronic
941036901 2:160578729-160578751 GCTTTCTTCTTCAAGGATAGTGG + Intergenic
941080233 2:161052092-161052114 ACTTTCTTCTTCAAGGAAATTGG - Intergenic
941224017 2:162822415-162822437 ACTTTCTTCATCAGTGGAAATGG - Intronic
941770602 2:169341238-169341260 ACATTCTTCATCAATGTCACTGG + Intronic
942864007 2:180650389-180650411 ACTTTCTTTCCCAATGATACAGG + Intergenic
943166841 2:184339404-184339426 ACTTACTTCTTCTATGGGAACGG + Intergenic
944080792 2:195786374-195786396 AAGTGCTTCTTCAAAGGTACAGG + Intronic
944655542 2:201873545-201873567 ACTATCTTCTGCCATGGGACAGG - Intronic
946678888 2:222192905-222192927 ATTTTCTTCTCCAATTGTAATGG + Intergenic
947671999 2:231943355-231943377 ACTTTATTCTTCACTGGTAATGG - Intergenic
948573745 2:238936484-238936506 GCTTTCTTCTTCCATGTTGCAGG + Intergenic
1170760554 20:19245473-19245495 ACTGTCTTCTTCAAAAATACAGG - Intronic
1172803233 20:37592981-37593003 ACTTTCTTCTTCCATGAAATGGG - Intergenic
1177080812 21:16636374-16636396 CCTTTCTTCTGCAATTGTTCAGG + Intergenic
1177324376 21:19565127-19565149 CCTTGCTTCTGCAATGGTTCTGG + Intergenic
1177622772 21:23618200-23618222 ATTTTCTTCTTCATTGGAAGTGG + Intergenic
951596882 3:24328153-24328175 ACATTCTTCTACAATGCTAATGG + Intronic
951766658 3:26206962-26206984 CCTTTCCTCTTCCAGGGTACTGG - Intergenic
961434432 3:126906856-126906878 ACGTGCTTCTTCATTGGTCCAGG - Intronic
962655883 3:137543521-137543543 AGTTTCTTAATAAATGGTACTGG - Intergenic
963245002 3:143049622-143049644 ACCTTCTTCTTGAATTCTACGGG - Intronic
963931902 3:151012402-151012424 ACTTTGTTCTTCACTGGGGCAGG + Intergenic
964225989 3:154402667-154402689 CCTTTCTTCCTCAATGTTGCTGG + Intronic
966305169 3:178524154-178524176 TCTTTCTTTTTTAATAGTACAGG + Intronic
966322264 3:178714175-178714197 TCTTTCTTCTTCAGTGCTTCTGG + Intronic
970944076 4:21669673-21669695 AGTTTCTTCTTTAATGATAGGGG - Intronic
971182110 4:24338309-24338331 CCTTTCTTCTTCATTGGAAGAGG - Intergenic
972727384 4:41756980-41757002 ACTTTCTTCCTCTGTGATACTGG - Intergenic
972912509 4:43835216-43835238 ACTTTTATTTTTAATGGTACTGG - Intergenic
973695868 4:53490480-53490502 ACTTTCTTCTTAAAAGGGCCTGG + Intronic
976576296 4:86676209-86676231 AATTTCTTCTTCAGTGGCACAGG - Intronic
977061095 4:92257367-92257389 ACTTTCTTCTTCTATGCCCCAGG + Intergenic
977392647 4:96431327-96431349 TCTTTCTTTTTCAATAGTTCAGG + Intergenic
977584040 4:98755649-98755671 AAATTCTTCATCAATGGTCCTGG + Intergenic
979738029 4:124112912-124112934 ACTTTCTTCTCCCATGGAAAAGG + Intergenic
980395269 4:132205269-132205291 ACTCTCTTCTTAAAATGTACAGG + Intergenic
982368825 4:154610787-154610809 CCTTTCTTCTTTAATGCTTCTGG + Intronic
984156826 4:176204494-176204516 ACTTTCTTCTTGAGTTGTATAGG - Intergenic
987217375 5:15751013-15751035 TCATTCTTTTTCAATGGAACAGG - Intronic
989143717 5:38227750-38227772 ACATTCTTCTCAAATGGTATCGG - Intergenic
990967740 5:61467937-61467959 ACTTTCTTTTTCTAAGCTACTGG - Intronic
991185532 5:63802238-63802260 AATTTCTTCATCAATGAAACTGG + Intergenic
993394396 5:87365393-87365415 ACTTTCTTGTTCAATCATCCAGG + Intronic
994443490 5:99841307-99841329 ACTTTCCTCTTCAATTGAATTGG + Intergenic
994837349 5:104872469-104872491 ACTCTCTTCTTCACAGATACTGG - Intergenic
996268486 5:121573113-121573135 ACTTTCTTCTGCAAAGCTTCAGG - Intergenic
998616211 5:143743459-143743481 ACTTTCTTGATCAGTGATACTGG - Intergenic
1002651214 5:180696748-180696770 ACTCTCTTCTCAAATGATACTGG + Intergenic
1002892727 6:1350011-1350033 TCTTCCTTCTTCAGTGGTTCTGG - Intergenic
1007985899 6:46206592-46206614 ATTTTTATCTTCAAGGGTACAGG + Intergenic
1011506382 6:88048263-88048285 ACATTCTTCTTCAAGGCCACAGG - Intronic
1011877631 6:91980695-91980717 ACTTTCTTCTTCAAGGTATCAGG - Intergenic
1012633552 6:101505426-101505448 TCTTTCTCCTTCAATGTTTCAGG + Intronic
1016605160 6:145912699-145912721 ACTTTCTTCTTGATTATTACTGG + Intronic
1018614478 6:165673704-165673726 TCTTTCTTCTTTAATGGTGAAGG + Intronic
1020721807 7:11754687-11754709 ACTTTCTATTTCAATTGTAATGG + Intronic
1021191800 7:17629097-17629119 ACTTTCCTCTTCAGTGGAAATGG - Intergenic
1021648996 7:22814532-22814554 GGTCTCTTCTTCAATGGTAATGG + Intronic
1023256986 7:38322323-38322345 ACTTTTTTCTTCTATGCCACAGG + Intergenic
1025619976 7:63159747-63159769 ACTTTCTACTTCAATGGGTTTGG + Intergenic
1030853260 7:114517559-114517581 AATGTCTTCATAAATGGTACAGG - Intronic
1037399058 8:18475221-18475243 ACTTTCTTCCTCAAAGCCACTGG + Intergenic
1039031642 8:33316212-33316234 ACTTCCTGCTTCTATGGTGCTGG + Intergenic
1039583426 8:38685488-38685510 ACCTTCTTCTTAAAAGGTACGGG - Intergenic
1039927560 8:41950398-41950420 AATTTCTTCTTCAAAGGAAGAGG + Intronic
1041719903 8:60966154-60966176 TCTTTCTTCTTCTAAGGTAGAGG + Intergenic
1042380000 8:68102962-68102984 ACTTTCTCCTTAAATTGTCCTGG + Intronic
1044636055 8:94325327-94325349 AGCTTCTTCTTCAATGATGCAGG + Intergenic
1046824393 8:118671213-118671235 ACTTACTTCCTTTATGGTACTGG + Intergenic
1051334806 9:16056274-16056296 ACTTTCTACAACAATGGAACTGG + Intronic
1051546952 9:18287160-18287182 TTTTTCTTCTTCAGTGATACTGG - Intergenic
1058196591 9:101984464-101984486 ACTTTGTTCTTCATTGGCTCTGG - Intergenic
1059091977 9:111369205-111369227 ATTTTCTTCTTCAAAGTTACAGG + Intronic
1186780214 X:12904486-12904508 ATTTTCATCTTTTATGGTACTGG + Intergenic
1187280226 X:17852879-17852901 ACTTTCTCTCTCAATAGTACTGG + Intronic
1188812846 X:34673041-34673063 AGTTTCTTCCACAATGATACAGG + Intergenic
1191214064 X:57917505-57917527 ACTTTCTACTTTGATGGTATAGG - Intergenic
1193370596 X:80692803-80692825 AATTTCTTCTTTACAGGTACAGG + Intronic
1193418265 X:81250792-81250814 ACGTTTTCCTTCAATTGTACTGG + Intronic
1194002139 X:88443625-88443647 ACATTTTTCTTCAATGGAACTGG + Intergenic
1196969755 X:121096008-121096030 ACTTTCTTCTTAAATCGTCAGGG - Intergenic
1199787215 X:151116287-151116309 ACAGTATTCTTTAATGGTACTGG - Intergenic
1201687317 Y:16720908-16720930 ACATTCTTATTCAATGCTGCTGG - Intergenic