ID: 1107056986

View in Genome Browser
Species Human (GRCh38)
Location 13:36116612-36116634
Sequence ATCCTTCACATTACTAGAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 124
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 108}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107056983_1107056986 24 Left 1107056983 13:36116565-36116587 CCAGTTCTGATACTACTTAACTT 0: 1
1: 0
2: 1
3: 10
4: 146
Right 1107056986 13:36116612-36116634 ATCCTTCACATTACTAGAGCTGG 0: 1
1: 0
2: 0
3: 15
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107056986 Original CRISPR ATCCTTCACATTACTAGAGC TGG Intronic
900252044 1:1675990-1676012 GTCCCTCTCGTTACTAGAGCGGG - Intronic
900262455 1:1738848-1738870 GTCCCTCTCGTTACTAGAGCGGG - Intronic
902817575 1:18925068-18925090 ATCCTTCTCTTTTCTAGCGCTGG + Intronic
909230989 1:73089771-73089793 GTCCATCACATTACTAGACTGGG - Intergenic
909277807 1:73710233-73710255 TACCTTTACATTACTAGGGCAGG - Intergenic
909850887 1:80462359-80462381 ATGCTTCAGATGACTAGAGAAGG - Intergenic
910003254 1:82362297-82362319 ATACTTCTTTTTACTAGAGCAGG + Intergenic
910063036 1:83116889-83116911 ATCCTTCTCATTACTTGTGATGG - Intergenic
911708455 1:101041698-101041720 ATTCTTCACATGGCCAGAGCAGG + Intergenic
915154318 1:153862044-153862066 ATTCTTCACATTTCTTGAGCAGG - Intronic
916746803 1:167691089-167691111 AGCCTTGGCATTACTCGAGCTGG + Intronic
923941707 1:238833821-238833843 AGTCTTCACATGACCAGAGCAGG - Intergenic
1070699809 10:78593476-78593498 TTCCTTCTCATTTCTTGAGCTGG - Intergenic
1072857066 10:98959232-98959254 ATTCTTAACATTCCTAAAGCTGG + Intronic
1076012109 10:126997457-126997479 ACACTTCACATGGCTAGAGCAGG + Intronic
1079606149 11:22369789-22369811 ATCCTGCATATTCCTAAAGCTGG + Intronic
1085768148 11:79301812-79301834 ATACTTCACATGACTGGAGCAGG - Intronic
1086918486 11:92558460-92558482 AACCATCACAATACTAAAGCAGG - Intronic
1088777988 11:113104645-113104667 ATCGTTCAAATTACCAGAGGTGG - Intronic
1090539063 11:127680154-127680176 TTGGTTCACATTGCTAGAGCTGG - Intergenic
1092363751 12:7860069-7860091 ATCCTTGGTATTACCAGAGCTGG + Intronic
1092380798 12:7995424-7995446 ATCCTTGGTATTACCAGAGCTGG - Intergenic
1096057111 12:48663128-48663150 AGCCTTAACATTTTTAGAGCTGG - Intronic
1100813647 12:98364483-98364505 AGCCTTCACATTTCTATAGTTGG - Intergenic
1102476962 12:113195088-113195110 AGCTTTCACAGTGCTAGAGCAGG + Intergenic
1103315029 12:120046362-120046384 ATCTTTCAGGTTATTAGAGCTGG + Intronic
1103613863 12:122140059-122140081 ATCCCTGTCATTAATAGAGCTGG + Intronic
1107056986 13:36116612-36116634 ATCCTTCACATTACTAGAGCTGG + Intronic
1108466059 13:50716215-50716237 AACCTACACATTGCTAGAGAAGG - Intronic
1108969895 13:56361134-56361156 ATCATTTACATGGCTAGAGCAGG + Intergenic
1111342349 13:86903408-86903430 ATCCTCCACATTTCTAGAGATGG + Intergenic
1120958395 14:90102938-90102960 ATACTGCAGACTACTAGAGCAGG - Intronic
1125169771 15:36753223-36753245 ATCGTTAACATTCCTGGAGCTGG + Intronic
1125967727 15:43887707-43887729 ATCCTTCAGGTTACTGGAACTGG + Intronic
1128571889 15:68739687-68739709 ATCCTTTACATCACTAGAATAGG + Intergenic
1139177690 16:64709450-64709472 ATGCTTCAGATTTATAGAGCTGG + Intergenic
1140330896 16:74055836-74055858 ATCCTTGACATTACCATACCTGG + Intergenic
1148517944 17:48239445-48239467 ATCCATCACATTTTTATAGCAGG - Intronic
1149428813 17:56580336-56580358 ATCCTTCACATAACTAAAACAGG - Intergenic
1151902224 17:77023947-77023969 ATACTTCACATGGCCAGAGCAGG - Intergenic
1152115827 17:78386462-78386484 CTCCTTCCCATAACTAGAACTGG + Intronic
1154907937 18:20602542-20602564 AACATTCACATTCATAGAGCAGG - Intergenic
1154914079 18:20699158-20699180 AACATTCACATTCATAGAGCAGG + Intergenic
1154914309 18:20702556-20702578 AACATTCACATTCATAGAGCAGG + Intergenic
1154914535 18:20705959-20705981 AACATTCACATTCATAGAGCAGG + Intergenic
1154914663 18:20707831-20707853 AACATTCACATTCATAGAGCAGG + Intergenic
1154915891 18:20726380-20726402 AACATTCACATTCATAGAGCAGG + Intergenic
1154916015 18:20728250-20728272 AACATTCACATTCATAGAGCAGG + Intergenic
1154916241 18:20731652-20731674 AACATTCACATTCATAGAGCAGG + Intergenic
1156656970 18:39299640-39299662 AGCCTTCACATGTCTAGAGGGGG - Intergenic
925626510 2:5846733-5846755 TTCCTTCTCATTGCTAGAGATGG - Intergenic
928037051 2:27834435-27834457 ATCCTTTACATTTGTACAGCAGG - Intronic
928498420 2:31860220-31860242 ATCCTTGAGATTAACAGAGCAGG + Intergenic
931098587 2:58970242-58970264 ATCCCTCTAATTACTAGAGTGGG - Intergenic
935105677 2:100041137-100041159 ATCTATCACTTTAGTAGAGCTGG - Intronic
935246575 2:101224055-101224077 ATTTTGCACATCACTAGAGCTGG + Intronic
936994836 2:118402596-118402618 AGCCTTCACATGACCAGAGCAGG - Intergenic
940937890 2:159519877-159519899 ATCCTGCCCATTACAACAGCTGG + Intronic
942570172 2:177305961-177305983 ATTCTTCCCATTTCTAGAGATGG + Intronic
942671106 2:178377254-178377276 AGCCCTCACATGACCAGAGCAGG + Intronic
944881681 2:204019111-204019133 ATCCCTGACATTCCTAGACCAGG + Intergenic
946231664 2:218295278-218295300 AGCCTTCTCATTTCTAGAACCGG - Intronic
1169810695 20:9606246-9606268 ATACATCACATGGCTAGAGCAGG - Intronic
1171598941 20:26720910-26720932 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171621972 20:27066456-27066478 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171681239 20:27954864-27954886 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171693229 20:28134333-28134355 AACCTTCCCATTCATAGAGCAGG + Intergenic
1171938739 20:31303272-31303294 CTCCTTCACATTTTTAGAACTGG + Exonic
1176696843 21:9988430-9988452 ATCCTGCATATTAATAGAGCAGG + Intergenic
1177888789 21:26779592-26779614 ATATTTCAAATTAATAGAGCAGG - Intergenic
1184180619 22:42821972-42821994 ATGCTTCACATTATTAGAGTTGG - Intronic
1184969413 22:48004596-48004618 AGCCTTCACTTTGCTAGAACTGG - Intergenic
949627670 3:5886450-5886472 ATACTTCATATTATTAGAGCTGG + Intergenic
952123128 3:30268095-30268117 ATCCTTGCCATTACTTGAGGAGG - Intergenic
953541243 3:43820659-43820681 ATCCTTTAGATTACAAGAACTGG + Intergenic
956231717 3:67024271-67024293 ATCATTAGCATTACCAGAGCAGG - Intergenic
958603971 3:96333946-96333968 ATCCTTCACATTAGTTGATTTGG + Intergenic
958997444 3:100921020-100921042 ATCCTTTTCCTCACTAGAGCTGG + Intronic
959103118 3:102036256-102036278 ATCCTTCAGTTAACTAGAGAAGG + Intergenic
959293222 3:104501306-104501328 ATCATTCACATTACTTTATCAGG + Intergenic
959298150 3:104564644-104564666 ATCCATCAAATTACTATATCAGG + Intergenic
962154604 3:132932886-132932908 ATCCTTCACATTTTAAAAGCAGG - Intergenic
965219632 3:165911986-165912008 ATCATTGAAATTACTAGAGGAGG + Intergenic
970419127 4:15888622-15888644 GTGCTTCACATGGCTAGAGCAGG - Intergenic
973409119 4:49788489-49788511 ATCATTCACTTTTATAGAGCAGG + Intergenic
973418311 4:49940135-49940157 ATCATTCACTTTTATAGAGCAGG + Intergenic
973469276 4:50782274-50782296 ATCATTCACTTTTATAGAGCAGG + Intergenic
976639458 4:87322708-87322730 ATTGTTCTCATTACTGGAGCTGG - Exonic
979377094 4:119959840-119959862 TTCCTTTACATTGATAGAGCTGG + Intergenic
980369444 4:131848617-131848639 ATCCTGCATATTAATAGAGCAGG + Intergenic
985425290 4:189824253-189824275 ATCCTACAGATCACTAGAACTGG - Intergenic
997236062 5:132272511-132272533 CACCTTCGTATTACTAGAGCTGG - Exonic
998367682 5:141641333-141641355 CCCCTTCCCATTTCTAGAGCTGG - Exonic
1001882023 5:175252730-175252752 ATCCTTTACATTACTCAGGCAGG + Intergenic
1012300378 6:97580218-97580240 ATCCTTCAGATTTCTAAAGTTGG - Intergenic
1013112541 6:107075852-107075874 CTCCCTCACATTCCTACAGCAGG + Intronic
1014603114 6:123440845-123440867 ACCCTTCAAATTAATATAGCTGG + Intronic
1021476265 7:21065042-21065064 ATTCTTCAGATTACTCTAGCAGG + Intergenic
1022069322 7:26896565-26896587 ATATTTCACATTACTAGACATGG + Intronic
1025101560 7:56139873-56139895 ATCTTTCACATGGCCAGAGCAGG + Intergenic
1034532102 7:151702269-151702291 ATCCTTTACATCCCTAGTGCCGG + Intronic
1037232775 8:16679483-16679505 TTCCTTCAGATTTCCAGAGCTGG + Intergenic
1040151300 8:44123536-44123558 AACATTCACATTCATAGAGCAGG + Intergenic
1040161265 8:44271303-44271325 AACATTCACATTCATAGAGCAGG + Intergenic
1040198744 8:44825831-44825853 AACATTCCCATTACTAGAGCAGG + Intergenic
1040228985 8:45273236-45273258 AACATTCACATTCATAGAGCAGG + Intergenic
1040255400 8:45662544-45662566 AACATTCCCATTACTAGAGCAGG + Intergenic
1040270108 8:45929918-45929940 ATCATTCCCATTCATAGAGCAGG + Intergenic
1040278843 8:46027427-46027449 ACCTTTCATATTACTAGAGAAGG + Intergenic
1040885627 8:52260589-52260611 CTGGATCACATTACTAGAGCTGG + Intronic
1044141711 8:88662741-88662763 TTCCTTCTCATTACTTGTGCAGG - Intergenic
1045234361 8:100337188-100337210 CTCCTTCCCATTACTTGTGCTGG - Intronic
1046160339 8:110354762-110354784 ATTCTTTACATTTCTAGAGGAGG + Intergenic
1047860023 8:128955651-128955673 ATCCTTGTCATTGCTAGAGGAGG + Intergenic
1053633823 9:39974285-39974307 ATCCTGCATATTAATAGAGCAGG + Intergenic
1053715198 9:40880665-40880687 AACATTCACTTTCCTAGAGCAGG + Intergenic
1053771924 9:41489215-41489237 ATCCTGCATATTAATAGAGCAGG - Intergenic
1054210064 9:62276412-62276434 ATCCTGCATATTAATAGAGCAGG - Intergenic
1054314930 9:63572514-63572536 ATCCTGCATATTAATAGAGCAGG + Intergenic
1055207119 9:73745729-73745751 ATAGTTCAGATTACTAGAGAGGG - Intergenic
1060067051 9:120511701-120511723 ATCCTTCACAGTGCTAAAGAGGG - Intronic
1186108454 X:6229982-6230004 ATCCTTCACATCACCATGGCAGG - Intergenic
1199376905 X:147123521-147123543 ATACTGCGTATTACTAGAGCAGG - Intergenic
1201522899 Y:14896285-14896307 AGTCTTCACATTGCTAGAGAAGG + Intergenic