ID: 1107058277

View in Genome Browser
Species Human (GRCh38)
Location 13:36130103-36130125
Sequence CCCTGTGATGTCTACGTCCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 48}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107058277 Original CRISPR CCCTGTGATGTCTACGTCCG TGG (reversed) Intronic
905338362 1:37260757-37260779 CCCTGTGATGTCCCCTGCCGTGG + Intergenic
906781504 1:48576726-48576748 CCCTGTTATGTCAACGACCCTGG - Intronic
924743370 1:246811142-246811164 CCCTGAGATCTCTACTTCCAAGG + Intergenic
1062899013 10:1127741-1127763 CCCTGTGATGTGGAGGCCCGTGG + Intronic
1063179685 10:3586429-3586451 CCCTGTGAAGTCTCAGTCTGAGG - Intergenic
1069245633 10:66201862-66201884 CCCTGTGATCTCCACCTCCTGGG + Intronic
1070907138 10:80083180-80083202 CCCTGCAATCTCTACGTCCTGGG + Intronic
1073881376 10:107984623-107984645 ACCTGTGGTCTCTAAGTCCGGGG - Intergenic
1076946047 10:133651263-133651285 CCCTGTGATCTGTAGGTCCTTGG - Intergenic
1078007923 11:7546520-7546542 CCCTGTCATGTTTACATCTGAGG + Intronic
1078698891 11:13661912-13661934 CACTGTGATGTCCACCTCCTGGG + Intergenic
1083426274 11:62588476-62588498 CACTGTGACGTCTACCTCCTGGG - Intronic
1089532755 11:119141853-119141875 CACTGTGATCTCTACCTCCTGGG - Intergenic
1096580215 12:52580250-52580272 CCCTGTGATGACTAGGTAGGTGG - Intergenic
1107058277 13:36130103-36130125 CCCTGTGATGTCTACGTCCGTGG - Intronic
1108377875 13:49830107-49830129 ACCTTTGATGTCTAAGTCCTTGG - Intergenic
1111125226 13:83906408-83906430 CCCTGTGCTGCCTACCTCCTGGG + Intergenic
1112300205 13:98223099-98223121 CCCTGTCAGGTCTACGTCCTGGG - Intronic
1202920150 14_KI270723v1_random:23858-23880 CCCTGTGATCTGTAGGTCCTTGG - Intergenic
1202924771 14_KI270724v1_random:13785-13807 CCCTGTGATCTGTAGGTCCTTGG + Intergenic
1141483312 16:84321561-84321583 CCCTATGATGTCTAAGACCAAGG + Intronic
1143263430 17:5617360-5617382 ACCTGTCATCTCTACGTCTGTGG - Intronic
1146741165 17:35284914-35284936 TCCTGTGGTTTCTAAGTCCGTGG - Intergenic
1147000557 17:37359201-37359223 CCATGAGGTGACTACGTCCGGGG + Intronic
1203170092 17_GL000205v2_random:140618-140640 CCCTGTGATCTGTAGGTCCTTGG - Intergenic
1161596911 19:5155135-5155157 CCCTGTGAGGTCAGCGTCCCTGG + Intergenic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
925309826 2:2874667-2874689 CCCAGTGAGGTCTAGGTCCAGGG + Intergenic
935090805 2:99893082-99893104 CCCTGTGATGTCTTCTTCATGGG - Intronic
936576866 2:113664456-113664478 CCCTTAGATGTCTAGGTCCCTGG + Intergenic
1174902547 20:54515517-54515539 CCCAGAGATATCTACGTCCTTGG - Intronic
1176331620 21:5553771-5553793 CCCTGTGATCTGTAGGTCCTTGG + Intergenic
1176396137 21:6267180-6267202 CCCTGTGATCTGTAGGTCCTTGG - Intergenic
1176441020 21:6721924-6721946 CCCTGTGATCTGTAGGTCCTTGG + Intergenic
1176465282 21:7048993-7049015 CCCTGTGATCTGTAGGTCCTTGG + Intronic
1176488843 21:7430771-7430793 CCCTGTGATCTGTAGGTCCTTGG + Intergenic
1179614563 21:42573391-42573413 CCCTGTGCTGTCTCCCTCTGAGG + Intronic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
1185423374 22:50748218-50748240 CCCTTAGATGTCTAGGTCCCTGG - Intergenic
957081439 3:75639206-75639228 CCCTGTGATCTGTAGGTCCTTGG + Intergenic
967226828 3:187299825-187299847 ACCAGTGATGTCTAAGTCCAAGG - Intergenic
968547591 4:1206714-1206736 CCCTGTGAGGTCTCCCTCAGGGG + Intronic
996001444 5:118369067-118369089 CCCTGTGGTGACTAGGTCAGGGG - Intergenic
1021704541 7:23353699-23353721 CCATGTGATTTCTATGTCAGAGG + Intronic
1023610415 7:41965955-41965977 CCCGGCGATGGCCACGTCCGCGG - Exonic
1026213339 7:68326217-68326239 CCCAGTGATGTCCACATCCTAGG + Intergenic
1032742714 7:134755074-134755096 CACTGTAATGTCTACTTCCCAGG + Intronic
1061329966 9:129886084-129886106 CTCTGTGATGTCCACACCCGCGG + Intergenic
1203430479 Un_GL000195v1:86563-86585 CCCTGTGATCTGTAGGTCCTTGG - Intergenic
1203436040 Un_GL000195v1:138073-138095 CCCTGTGATCTGTAGGTCCTTGG + Intergenic
1194754315 X:97719694-97719716 CTCTGTGTTGTCTAAGTCAGAGG + Intergenic
1197168359 X:123404280-123404302 CCCTGTGAGGTCAGCGTCCGTGG - Intronic