ID: 1107058398

View in Genome Browser
Species Human (GRCh38)
Location 13:36130909-36130931
Sequence CCGGGGGCGTTGCGTGCGGG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 155}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107058398_1107058412 -2 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058412 13:36130930-36130952 GGGTCGGGCCAGGCTGGCCAGGG 0: 1
1: 0
2: 4
3: 48
4: 497
1107058398_1107058414 3 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058414 13:36130935-36130957 GGGCCAGGCTGGCCAGGGCAGGG 0: 1
1: 1
2: 13
3: 143
4: 1333
1107058398_1107058416 6 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058416 13:36130938-36130960 CCAGGCTGGCCAGGGCAGGGCGG 0: 1
1: 0
2: 14
3: 138
4: 1161
1107058398_1107058413 2 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058413 13:36130934-36130956 CGGGCCAGGCTGGCCAGGGCAGG 0: 1
1: 0
2: 7
3: 95
4: 871
1107058398_1107058419 27 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058419 13:36130959-36130981 GGCCGCCTTTCGAGGAACTGCGG 0: 1
1: 0
2: 1
3: 4
4: 62
1107058398_1107058420 28 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058420 13:36130960-36130982 GCCGCCTTTCGAGGAACTGCGGG 0: 1
1: 0
2: 0
3: 3
4: 48
1107058398_1107058411 -3 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058411 13:36130929-36130951 CGGGTCGGGCCAGGCTGGCCAGG 0: 1
1: 0
2: 3
3: 45
4: 465
1107058398_1107058406 -8 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058406 13:36130924-36130946 GCCCCCGGGTCGGGCCAGGCTGG 0: 1
1: 0
2: 1
3: 35
4: 367
1107058398_1107058418 19 Left 1107058398 13:36130909-36130931 CCGCCCGCACGCAACGCCCCCGG 0: 1
1: 0
2: 0
3: 12
4: 155
Right 1107058418 13:36130951-36130973 GGCAGGGCGGCCGCCTTTCGAGG 0: 1
1: 0
2: 0
3: 6
4: 69

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107058398 Original CRISPR CCGGGGGCGTTGCGTGCGGG CGG (reversed) Intronic
900180228 1:1307991-1308013 CAGCGGGCGGTGCGCGCGGGCGG - Exonic
901109850 1:6785673-6785695 GCGGGGGCGCGGCGGGCGGGCGG + Intronic
901659089 1:10787505-10787527 CCGGGGGCGAGGGGGGCGGGCGG + Intronic
903233897 1:21937405-21937427 CCGGGGGCGGTCCGTGGGCGGGG - Intergenic
903455501 1:23484248-23484270 TCGGGGGCGGGGCGTGCGGAGGG - Intronic
903506404 1:23838657-23838679 ACGGGGGTGTGGCGTGCGAGGGG - Intergenic
903506415 1:23838693-23838715 ACGGGGGTGTGGCGTGCGAGGGG - Intergenic
905037945 1:34929689-34929711 GCGGGGGCGGAGCGCGCGGGCGG - Intergenic
905626187 1:39491817-39491839 CCGGGGCAGGTGCGCGCGGGGGG + Exonic
907430238 1:54406952-54406974 CCGGGGGCGGGGCGGGCTGGGGG - Intronic
910288126 1:85576839-85576861 CCCGGAGCGTTGCGGGCGGCGGG - Intronic
912670519 1:111620082-111620104 CCGGGGGCCTGGCCGGCGGGAGG + Intronic
1062968678 10:1629548-1629570 CTGGGGGGGTTGGGTGCTGGGGG - Intronic
1064052238 10:12068915-12068937 GCGGGGGCGTTGTCTGGGGGCGG + Intergenic
1067091143 10:43266467-43266489 CCCGGGGCCTGGCGTGGGGGTGG - Intronic
1068560813 10:58512877-58512899 GCGCGGGCGTTGCTGGCGGGGGG + Intergenic
1069738356 10:70672372-70672394 CCGGGGGCGGGGCGCGCGGCTGG - Intergenic
1069913509 10:71773576-71773598 CCGGGGGCGCTGCGCGAAGGGGG - Intronic
1070199198 10:74186472-74186494 CCGGGGGAGTGGGGTGGGGGTGG + Intronic
1073959814 10:108912660-108912682 GCGGGGGGGTTGTGTGGGGGCGG + Intergenic
1074618305 10:115092937-115092959 CCCGGGGCGCGGGGTGCGGGTGG + Intergenic
1076578323 10:131488003-131488025 CAGGGGGCGCTGCGTGGAGGAGG - Intergenic
1076696338 10:132249143-132249165 CAGGGGGCGGGGCGTGCAGGGGG + Intronic
1076858442 10:133128531-133128553 CCGGGGGCATCGTGTGCGGGTGG - Exonic
1076948126 10:133665464-133665486 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076949116 10:133668774-133668796 CCGGGGGCGGGGGGTGGGGGTGG - Intronic
1076950100 10:133672073-133672095 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076951084 10:133675372-133675394 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076952074 10:133678682-133678704 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076953063 10:133681992-133682014 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076954047 10:133685291-133685313 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076955031 10:133741643-133741665 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076956020 10:133744953-133744975 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076957010 10:133748263-133748285 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076957997 10:133751572-133751594 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076958982 10:133754871-133754893 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076959971 10:133758181-133758203 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1076960955 10:133761480-133761502 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1077204704 11:1336775-1336797 GCGGGGGCGGGGCGTGGGGGCGG + Intergenic
1077204715 11:1336794-1336816 GCGGGGGCGGGGCGTGGGGGCGG + Intergenic
1077250154 11:1557300-1557322 CCGGGGGCGTGGGGGGCGCGGGG + Exonic
1077343799 11:2037355-2037377 CTGGGGGCGGTGGGGGCGGGAGG + Intergenic
1077419792 11:2444875-2444897 GCGGGGGCGGGGCGTGCAGGCGG + Intronic
1079223929 11:18588789-18588811 CCCGGGGCGTTGAATGCGGGTGG - Intergenic
1081462318 11:43283266-43283288 CCGGGGGCGGTGCGGGGGAGTGG + Intergenic
1083758279 11:64802816-64802838 CCGCGGGCGCGGGGTGCGGGCGG - Intronic
1085040469 11:73323687-73323709 GCGGGGGCGTTGCCTGGGGCGGG + Intronic
1089915627 11:122153010-122153032 CGGGGGGCGGGGGGTGCGGGGGG - Intergenic
1090653269 11:128824722-128824744 CCGAGGGCGTTGGGGGCCGGGGG + Intergenic
1202826785 11_KI270721v1_random:92544-92566 CTGGGGGCGGTGGGGGCGGGAGG + Intergenic
1091888069 12:4031254-4031276 GCGGGGGCGCGGCGGGCGGGCGG - Intergenic
1094536096 12:31324205-31324227 CCGGCAGCGCGGCGTGCGGGAGG - Intronic
1094536402 12:31325580-31325602 CCGGGGTCGGTGCGTCCGCGTGG - Intronic
1095800658 12:46268031-46268053 CGGGGGGTGCTGCGTGCGGCCGG - Intronic
1096435922 12:51591122-51591144 GCGGGGGCGGGGCGGGCGGGGGG + Intronic
1097155128 12:57006610-57006632 CGGGGGGCGCTGCGGCCGGGCGG - Intergenic
1100260518 12:92928874-92928896 CCGGGGGCGGGGAGGGCGGGTGG - Intronic
1102937579 12:116910887-116910909 CCGGGGGCGTGGCGGGGGCGTGG + Intergenic
1103325358 12:120116656-120116678 GCGGGGGCGGTGCGCGCGGGCGG + Exonic
1103348354 12:120265766-120265788 CCGGGGGCGGGGCGCGCGGCGGG - Exonic
1103906972 12:124332809-124332831 CCGGGGGCGATGGGTGAGGTGGG - Intronic
1104376198 12:128267121-128267143 CCGGGGGCGGGGCGGGCCGGCGG + Intergenic
1104444727 12:128823911-128823933 CTGGGGGCGGTGCGGGCGAGCGG - Exonic
1104919698 12:132284287-132284309 GCGCGCGCGTTGTGTGCGGGTGG - Intronic
1105935659 13:25096106-25096128 CCGGGGGCGTAGCCGGAGGGAGG - Exonic
1107058398 13:36130909-36130931 CCGGGGGCGTTGCGTGCGGGCGG - Intronic
1113813091 13:113154054-113154076 CGGGGGGCGGGGCGTGGGGGAGG + Intergenic
1122194366 14:100074001-100074023 CCGGGGGCGGTGGGGGCGGGGGG + Intronic
1122221360 14:100240452-100240474 CCGGGGAAGTTGGGGGCGGGCGG - Intronic
1122880733 14:104689513-104689535 CCGGGGGCGGGGCCTGGGGGGGG - Intergenic
1124426792 15:29570052-29570074 CCGGGGGCGGTGGGGGTGGGGGG - Intronic
1126766896 15:52019023-52019045 CTGGGGGCTTTGCCTGCGGGCGG - Intronic
1127014240 15:54665525-54665547 CCGGGGGCGTTAGGTGGGGGTGG + Intergenic
1132512981 16:353154-353176 CCGGGGGCGGGGCGTGCCGGGGG + Intergenic
1132683443 16:1153015-1153037 CCGGGGGCGGGGCGGGCGGGGGG - Intergenic
1132889331 16:2196309-2196331 CCGGGGGCGCGGGGCGCGGGTGG - Intronic
1133272378 16:4616469-4616491 CCGGGGGCGGGGCGACCGGGCGG + Intergenic
1134152216 16:11813828-11813850 CGGGGGGCGTGGCGGGGGGGTGG + Intergenic
1135047593 16:19168127-19168149 CCGGGGGCGCTGCTTTCGGTAGG + Intronic
1137261153 16:46831054-46831076 CCGGGGGCCGGGCGCGCGGGCGG - Intronic
1139593107 16:67943984-67944006 CCTTGGGCGTGGTGTGCGGGGGG + Exonic
1141132393 16:81445060-81445082 CGGGGGGCGGCGCGTGCGGCGGG - Intergenic
1141841976 16:86579275-86579297 CCGCGGGCGCTGCCTGCAGGCGG - Exonic
1142054733 16:87986223-87986245 CCCGGAGCCTTGCGTGCTGGCGG + Intronic
1142112735 16:88340891-88340913 CCGGGGGCCTAGCGTGGAGGAGG + Intergenic
1142173441 16:88634460-88634482 CCGGGGGCGTGGTCTGCTGGGGG + Intergenic
1142193064 16:88726679-88726701 CCCAGGGCGGTGGGTGCGGGGGG + Intronic
1142200157 16:88757303-88757325 CAGGGGGCGTTGCTGGCGGGGGG + Intronic
1146438211 17:32871199-32871221 CTGGGGGGGTTGTGTGTGGGTGG - Intronic
1152352066 17:79789780-79789802 CCGGGAGCGATGGGTGCGGAGGG + Intergenic
1152426442 17:80220806-80220828 CCGGGGGCGTGGGGGGCTGGGGG + Intronic
1152599015 17:81252230-81252252 CCGGCGGCGTTGCCTGGCGGCGG + Exonic
1152617960 17:81346363-81346385 CAGGGGGCGTGGCTGGCGGGAGG + Intergenic
1152811143 17:82383363-82383385 CCGGGGGCATTGCGGGGGGTGGG - Intergenic
1152965717 18:112055-112077 CCGGGGGCGGGGGGTGGGGGTGG + Intergenic
1161060173 19:2210861-2210883 CGGGGGCCGTGGCGTGGGGGCGG - Intronic
1161490004 19:4556520-4556542 CCGGGGGCGTGGGGGGCGGCAGG + Intronic
1163503292 19:17688420-17688442 GCGGGGGCGCTGCGGGCTGGGGG + Intergenic
1163842301 19:19618825-19618847 CCGGGGGCGGTGCGTGGCGCCGG - Exonic
1165775739 19:38403389-38403411 CAGGGGGCTGTGCGTGCGGCTGG + Exonic
1166394370 19:42427926-42427948 CCGGGGGCGGGGGGTGGGGGTGG - Intergenic
1166853065 19:45769503-45769525 GCGGGGGCGGTGCCTCCGGGTGG + Intergenic
1168301583 19:55407819-55407841 CGGAGGGCGTGGCCTGCGGGCGG - Intergenic
926123425 2:10256958-10256980 CAGGGGGCGCTGCGTGAGGGAGG - Intergenic
927893013 2:26764231-26764253 CCGGGGGCGGGGCGAGCAGGAGG + Intergenic
937854108 2:126660357-126660379 CCTGGGACGGTGCGTGAGGGAGG - Intronic
942360625 2:175168209-175168231 CCGGGAGCGGGGCGAGCGGGCGG - Intronic
942966063 2:181892688-181892710 CCGGGGGAGATCCGTGCGGACGG + Intronic
945225914 2:207530587-207530609 CCGGGGGCGAGGCGGGCGGCGGG - Intronic
948525462 2:238568319-238568341 CCGGGGGTGCTGCGTCTGGGGGG + Intergenic
948632877 2:239313114-239313136 CCGGGGGCGTTCCGAGGTGGCGG + Intronic
1169074340 20:2752029-2752051 CCGCGGGCGCCGCGTGCTGGGGG - Intronic
1170578475 20:17681542-17681564 CCGGAGGGGTGGGGTGCGGGCGG - Intronic
1176028679 20:62999667-62999689 CCTGGGGCATTGCGTCCCGGTGG - Intergenic
1180632692 22:17240773-17240795 CAGGGGGCTTTGTCTGCGGGTGG - Intergenic
1183401748 22:37608996-37609018 CCGGGGGCGGGGCGTGAGGAGGG - Intronic
1184362047 22:44024540-44024562 CCGGGCGGGGTGCGTGGGGGAGG - Intronic
1184415318 22:44348833-44348855 CCGGGGTCGTGGCATGCGTGGGG - Intergenic
1184633720 22:45807836-45807858 CTGGGAGCGTAGCCTGCGGGAGG + Intronic
1185102018 22:48845667-48845689 CCTGGGGCGTTCAGTGCTGGGGG + Intronic
1185259531 22:49853851-49853873 CCGGCGGCGTCGCGGGCGGCGGG + Exonic
950018407 3:9769782-9769804 CCCTGGGCGCTGCGTGGGGGCGG - Intronic
955924908 3:63995241-63995263 ACGGGGGCGTTGGGGGTGGGAGG + Intronic
957076043 3:75603936-75603958 CCGGGGGCGCTGAGGGCGTGGGG + Intergenic
962244808 3:133783897-133783919 CCAGGGGCGCTGCGTCCAGGCGG - Intergenic
967106124 3:186256232-186256254 CCGGGGGAGTGGCGGGCGGCAGG + Intronic
968509560 4:989412-989434 GCGTGGGCGTTGGGTGCGGCCGG + Exonic
968519025 4:1027413-1027435 CCGGGGCCCTTGCCTGCCGGGGG + Intergenic
968584590 4:1410259-1410281 ACGGGGGCGGGGGGTGCGGGCGG + Intergenic
984206627 4:176793293-176793315 CTGGGGGCCAGGCGTGCGGGAGG - Intergenic
984823655 4:183905962-183905984 CCGGGCGCTGTGCGTGCGCGCGG - Exonic
984928393 4:184826114-184826136 CCGGGGGCGGGGCCTGCGGGCGG - Intronic
985531159 5:434498-434520 CCTGGGGCACGGCGTGCGGGGGG + Exonic
998583537 5:143403929-143403951 CCTGGGGAGTTGGGGGCGGGGGG - Intronic
1002286442 5:178165678-178165700 CCGGGGGCGCGCCGTGCGAGCGG + Intergenic
1003290815 6:4776756-4776778 GCGGCGGAGTTGCGGGCGGGAGG - Exonic
1007098554 6:39229240-39229262 CGGGGAGCGGTGCTTGCGGGGGG - Exonic
1007581176 6:42960991-42961013 CCGGGGGCGTTGCATGAGATCGG + Intronic
1011516978 6:88166014-88166036 CAGAGGGAGTAGCGTGCGGGAGG + Exonic
1018995264 6:168705533-168705555 CCTGGGGTGTTGTGTGCTGGAGG - Intergenic
1018995274 6:168705569-168705591 CCTGGGGTGTTGTGTGCTGGAGG - Intergenic
1018995284 6:168705605-168705627 CCTGGGGTGTTGTGTGCTGGAGG - Intergenic
1018995294 6:168705641-168705663 CCTGGGGTGTTGTGTGCTGGAGG - Intergenic
1018995306 6:168705677-168705699 CCTGGGGTGTTGTGTGCTGGAGG - Intergenic
1023243699 7:38178265-38178287 CCGGGGCTGCTGGGTGCGGGCGG + Exonic
1025106463 7:56175182-56175204 GCGGGGGCGTGGCGTCCGGTGGG + Intergenic
1026025440 7:66740677-66740699 CCGGGGGCGGGGCGAGCAGGAGG + Intronic
1029496050 7:100895904-100895926 CCGGAGGGGGTGTGTGCGGGGGG - Exonic
1033186295 7:139230680-139230702 CAGTGGGCGTTGCGTGGGGCAGG - Intronic
1034951129 7:155297781-155297803 CCCTGGGCGGTGCGCGCGGGCGG + Exonic
1035404281 7:158587884-158587906 CCGGGGGCGTGGCCTGAGGGCGG - Intergenic
1036663058 8:10720880-10720902 GCGGGGGCGTTGGGGGCGCGGGG - Intergenic
1041648715 8:60280877-60280899 CCTGGTGCGTTTCGGGCGGGAGG - Intronic
1048410602 8:134168647-134168669 GCGGGGGCGTTGCCAGCTGGAGG - Intergenic
1049194670 8:141308588-141308610 CCGGGGGCGTAGCGGGAGGAGGG - Intergenic
1049718172 8:144103539-144103561 CCTGGGGCGGTGAGTGGGGGCGG - Exonic
1049803178 8:144527502-144527524 CCGGCGCCGGAGCGTGCGGGCGG - Exonic
1056992287 9:91423572-91423594 CAGGGCGCGCTGCGGGCGGGCGG - Intronic
1061559656 9:131394281-131394303 CCGGGGCCGGGGCGTGGGGGCGG + Intronic
1062049082 9:134437980-134438002 CCGGGGGCAGAGCCTGCGGGAGG - Intronic
1062538360 9:137030677-137030699 CCGGGGGAGGTGGGTGTGGGTGG - Exonic
1188225974 X:27598346-27598368 TCGGGGGGGTTGGGTGGGGGGGG - Intronic
1190554420 X:51618754-51618776 CCGGGGGCACTGCGCGCGGCTGG + Intergenic
1190560721 X:51682712-51682734 CCGGGGGCACTGCGCGCGGCTGG + Intergenic
1190563570 X:51710609-51710631 CCGGGGGCACTGCGCGCGGCTGG - Intergenic
1191211805 X:57892393-57892415 CAGGGGGCGGTGGGTGGGGGGGG + Intergenic
1197754431 X:129984095-129984117 CCGGCGGCGGGGCGGGCGGGCGG + Intronic
1200124686 X:153807713-153807735 CTGGGGGCGTTGCATGAGTGGGG - Intronic