ID: 1107062516

View in Genome Browser
Species Human (GRCh38)
Location 13:36174975-36174997
Sequence AAATGGAGACTATATAGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 208}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107062516 Original CRISPR AAATGGAGACTATATAGGGA GGG (reversed) Intronic
902981008 1:20123215-20123237 AAATGTAGTCTATATAGGGTTGG + Intergenic
904394879 1:30213344-30213366 AAGTGGAGAATATATGGGGGTGG - Intergenic
907560745 1:55385394-55385416 AAATGGTGACTATTTATTGAGGG + Intergenic
907700651 1:56784650-56784672 AAAAGGAGACTCTAAAGAGAAGG - Intronic
911361904 1:96886965-96886987 AAATGGATAACTTATAGGGAAGG + Intergenic
911371777 1:97002616-97002638 AAATGCAGACTATATAAGGAGGG - Intergenic
915191747 1:154156545-154156567 AAATGGGGACTGGGTAGGGAAGG + Intronic
918174588 1:182031795-182031817 AAATGGAGACTAAATAGGAGAGG - Intergenic
919067415 1:192710556-192710578 AAATGCAGACTATCCAGGAAAGG - Intergenic
919481109 1:198091001-198091023 AAATGGATACTATATATCAAGGG + Intergenic
919827531 1:201514054-201514076 GAATGGAGACTTTACAGGGAGGG + Intergenic
920063395 1:203245646-203245668 AATTGGGGATTATCTAGGGAGGG + Intronic
921148020 1:212377884-212377906 AAATGGAGAGAAAAGAGGGATGG - Intronic
921427960 1:215026625-215026647 AAATCAAAACAATATAGGGATGG - Intronic
923593012 1:235336979-235337001 AAATGGAGAATTCAAAGGGAAGG + Intronic
1065399962 10:25287917-25287939 AAATGTAGAATATATATGCATGG + Intronic
1065939818 10:30554178-30554200 AAAAGGAGACTAGACATGGAAGG - Intergenic
1066361095 10:34732287-34732309 AAATGGAGACACTCTAGGGTAGG + Intronic
1068875340 10:61990038-61990060 AAAGGGAACCTACATAGGGATGG - Intronic
1071248298 10:83789226-83789248 AAATGTAGACTATGTTAGGAAGG + Intergenic
1071946996 10:90656920-90656942 TAATGGAGAGTAGATGGGGAAGG + Intergenic
1074193415 10:111157742-111157764 AAATGAAGACTATCTATGTAGGG - Intergenic
1074730106 10:116362695-116362717 AGATGGAGACAATATAGGTAAGG - Intronic
1074807791 10:117071354-117071376 AAATGGTGATTAGATAGTGAAGG + Intronic
1074910632 10:117905525-117905547 GAGTGGAGGCTATATAGGCATGG - Intergenic
1075538269 10:123289742-123289764 AAGGGGAGACTATATAAGGTGGG + Intergenic
1080369678 11:31620466-31620488 AAATTGAGATTATAGAGGTATGG + Intronic
1080870308 11:36230919-36230941 ACATAGAGACTATACACGGAGGG - Exonic
1082060078 11:47852447-47852469 ATAGTGAGACTATATAGAGAGGG - Intergenic
1082896638 11:58198494-58198516 AAAAGGAGAATATATATAGAGGG + Intergenic
1085583138 11:77673486-77673508 AAATGGAGCCTAAATAGTGATGG + Intronic
1087460730 11:98443287-98443309 AAATGGAAACTACAAAAGGAAGG - Intergenic
1087931070 11:103978246-103978268 AAATGGACAATCGATAGGGATGG + Intronic
1088384611 11:109239501-109239523 AAAAGGAGGCTAGAGAGGGATGG - Intergenic
1089901031 11:121984974-121984996 AAATTGAGACTATAAAATGATGG + Intergenic
1089934896 11:122354136-122354158 AAATGGAGACTAAAGAGAAAGGG + Intergenic
1091709953 12:2732652-2732674 AAATTGAGAATTTAGAGGGAGGG - Intergenic
1093148378 12:15592956-15592978 AAATAAAGACTATTTATGGAGGG - Intronic
1093821227 12:23620348-23620370 ATATGGAGAATAGATTGGGAGGG + Intronic
1094180389 12:27586401-27586423 TAATAAAGACTATATAGGGCAGG + Intronic
1095114448 12:38335079-38335101 AAATAGAGAATATGTAGGGCCGG + Intergenic
1095572114 12:43695221-43695243 AAATGCATACAATATAGGGCAGG + Intergenic
1098124586 12:67277124-67277146 AAATGGATTAGATATAGGGATGG - Intronic
1098618409 12:72558821-72558843 AAAAGGAGCCAATATAGGGGAGG + Intronic
1101212148 12:102545208-102545230 TAGTGCAGACTATTTAGGGAAGG + Intergenic
1101590004 12:106117079-106117101 AAAAGGAGAGTGAATAGGGAGGG - Intronic
1101748852 12:107565908-107565930 ACATTGGTACTATATAGGGAAGG - Intronic
1101806934 12:108072378-108072400 AAATGTAGTCTATATGGGAAGGG - Intergenic
1104473144 12:129047299-129047321 AAATGGTTACTAAATGGGGAAGG - Intergenic
1106965475 13:35060727-35060749 AAATTCAGAGAATATAGGGAAGG + Intronic
1107062516 13:36174975-36174997 AAATGGAGACTATATAGGGAGGG - Intronic
1108067468 13:46592964-46592986 AGGTGGAGACTGTAGAGGGAAGG - Intronic
1110962209 13:81640745-81640767 AAAGGGAGCCTATCTAGGTAGGG + Intergenic
1115778932 14:36747940-36747962 GAATTGAGACTATTGAGGGAGGG + Intronic
1117590214 14:57259656-57259678 TAATGGAGACCATGTAAGGAAGG - Intronic
1117736898 14:58776891-58776913 ACATGGATACAAAATAGGGAAGG + Intergenic
1118777666 14:68983471-68983493 AAATGGAGACTGAATATAGAGGG + Intergenic
1120727775 14:87964583-87964605 AAATTGAGATTATGCAGGGATGG - Intronic
1121400175 14:93669285-93669307 AAATGCTAACTATATAGAGAAGG + Intronic
1122758839 14:104005133-104005155 AAATGGAGAGGATTGAGGGAGGG - Intronic
1123946941 15:25243375-25243397 AAATGGCCTCTATGTAGGGAAGG - Intergenic
1124990434 15:34668107-34668129 AAATGGAGAATATTTAGAGATGG - Intergenic
1128856297 15:71019390-71019412 GAATGGAGAGAATACAGGGATGG + Intronic
1129271205 15:74420172-74420194 AAATGCAGAATCAATAGGGATGG - Intronic
1130666770 15:85876344-85876366 AAAAGGCAACTTTATAGGGATGG + Intergenic
1131211389 15:90499905-90499927 AAAAGGACACAATGTAGGGAGGG - Intronic
1131516220 15:93079044-93079066 AAATGAAGACTATGCAGAGATGG - Intronic
1131569546 15:93520732-93520754 TAATGGAAACTATAAAGGTAGGG - Intergenic
1132315894 15:100890131-100890153 AAAAGGAGAGTGGATAGGGAGGG - Intronic
1136078991 16:27839147-27839169 TCATGGAGACTAGAAAGGGAGGG + Intronic
1137921514 16:52493749-52493771 AAAGGGAGACTTTGTAGGAAAGG - Intronic
1138801561 16:60036780-60036802 CAATGGAAACCATATAGGCAAGG + Intergenic
1143235047 17:5392489-5392511 ACATGGAGACGATATCTGGAAGG + Intronic
1143397737 17:6615938-6615960 AAATGAAGAGTACACAGGGAGGG + Intronic
1143878760 17:10013768-10013790 CAAGGGAGAATAGATAGGGAGGG - Intronic
1144830308 17:18127411-18127433 GAGTGGAGACCACATAGGGAAGG + Intronic
1148559906 17:48600026-48600048 AATTGGAGGCCATCTAGGGATGG - Intronic
1149098267 17:52871292-52871314 AAATGAAGATTATATAAGGGAGG + Intronic
1149287458 17:55180589-55180611 AAATGGAGACTTTACAGGTAAGG + Intergenic
1150053222 17:61986303-61986325 AAATGCATATTATATAGGAAAGG + Intronic
1150253785 17:63726967-63726989 AGATGGAACCAATATAGGGAAGG - Intronic
1151221089 17:72613656-72613678 AAATGGAGACAAGATCTGGATGG + Intergenic
1153950985 18:10057504-10057526 GAATGGAGACAACTTAGGGAAGG + Intergenic
1154279468 18:12990111-12990133 AAGTGGAGACCATTAAGGGAAGG + Intergenic
1156687934 18:39672578-39672600 CAATGGAAACTATATGGGAAGGG - Intergenic
1164832380 19:31332584-31332606 AAACTGAGACTAAGTAGGGATGG - Intronic
1164966137 19:32486205-32486227 AAATGGAGATTATATTGGGTGGG - Intergenic
1164966477 19:32489266-32489288 AAATGGAGATTATATTGGGTGGG - Intergenic
1166030884 19:40126700-40126722 AAATTGAGACTATATATTAATGG + Intergenic
926239456 2:11074018-11074040 AAATGGAGACTGGACAGAGATGG + Intergenic
926885012 2:17589115-17589137 AAATTGAGACTATTTAAAGAAGG + Intronic
927773406 2:25883285-25883307 ATATGGAGACTATAAAGGCCTGG + Intergenic
930956894 2:57213658-57213680 AAATGGAGAATAAATTGGCAAGG + Intergenic
933122766 2:78562787-78562809 AAGTGGAGGCTATTTAAGGAAGG - Intergenic
934167648 2:89309569-89309591 AAATGTAGGCAAGATAGGGAGGG + Intergenic
934199636 2:89873014-89873036 AAATGTAGGCAAGATAGGGAGGG - Intergenic
935245471 2:101215540-101215562 AAACAAAGACTATATAGGGCAGG + Intronic
935803425 2:106723076-106723098 CAATGGTGACAATATAGTGATGG + Intergenic
935835711 2:107050917-107050939 AAATAAATAATATATAGGGAGGG - Intergenic
936617776 2:114066081-114066103 GAATGGAGGGTATAGAGGGAAGG - Intergenic
939510723 2:143101256-143101278 AAATACAGAATACATAGGGATGG + Intronic
941034497 2:160553421-160553443 AAATGGAGACTCTGAAGGGCTGG + Intergenic
941371942 2:164676477-164676499 AAATGTAGCCAATATAGAGATGG + Intronic
941554083 2:166953869-166953891 AAATGAAGACTGTATAAGGGAGG - Intronic
943378651 2:187115390-187115412 AAATGGTTACTATAAAGGTAAGG + Intergenic
943444216 2:187963377-187963399 AAAAGGATAATATATAGGGCAGG + Intergenic
944415906 2:199479486-199479508 GTAGGGAGACTTTATAGGGATGG - Intergenic
944794311 2:203166849-203166871 AAATGAAGACTATATTAGGTTGG - Intronic
947336318 2:229088616-229088638 AAATAGAGACTAAATACAGATGG + Intronic
947921815 2:233882514-233882536 AAAACAAGACTACATAGGGAAGG - Intergenic
948224436 2:236298235-236298257 AAATGGAGACCTGAAAGGGAGGG - Intergenic
1169780591 20:9306073-9306095 ATATGGAGACAATGGAGGGATGG - Intronic
1170822437 20:19765907-19765929 AAAAGGAGGCTACAGAGGGAGGG + Intergenic
1171940962 20:31329500-31329522 AAATGGAAAGTATATATAGAAGG - Intergenic
1173544054 20:43878922-43878944 AAATGAAGACTAAATAGCCATGG - Intergenic
1173561531 20:44009327-44009349 AAAAGGAGACAAGAAAGGGAAGG + Intronic
1174236265 20:49094993-49095015 AAATGGAGACTTTAATGGGAGGG + Intronic
1178125438 21:29511038-29511060 AAAGGGAGACTATAGAGCCAAGG - Intronic
1178256707 21:31059473-31059495 CATTGGAGACTGTATAGGTAAGG - Intergenic
1178667297 21:34559728-34559750 ACCTGGAGAGGATATAGGGAAGG + Intronic
1181301166 22:21882328-21882350 AAATGGTGATTAGATAGGGTGGG - Intergenic
949514261 3:4792978-4793000 AAAGGCAGAGTATATGGGGAAGG + Intronic
949966544 3:9361647-9361669 TAATGGCGATTATAGAGGGAGGG - Intronic
951098921 3:18664029-18664051 AAATGGTTACTATTTGGGGAAGG - Intergenic
952544199 3:34400838-34400860 AAATGCAGACTTTATAAAGAAGG + Intergenic
952641638 3:35603711-35603733 AAATGGACATTCTATAGTGAAGG + Intergenic
955566558 3:60253303-60253325 AAAAGGAGAAAATATATGGATGG + Intronic
956383539 3:68691699-68691721 CAATGGAGTCTTTATAGGGTTGG + Intergenic
957946965 3:87077008-87077030 CCATGGGGACTATATTGGGATGG - Intergenic
959403713 3:105934985-105935007 AAAGAGAGACTTTATAGAGAAGG - Intergenic
960482400 3:118208665-118208687 AGATGGAGACTAGCTAGGGCAGG - Intergenic
961858362 3:129894168-129894190 AAATGGGAATTATAAAGGGATGG - Intergenic
963711640 3:148754160-148754182 ATCTGGTGACTATATTGGGAAGG + Intergenic
964989521 3:162790491-162790513 AAAGGGAAAATATATAAGGAAGG - Intergenic
965328768 3:167343060-167343082 AAATGTAGATAATATAGGAATGG + Intronic
967275756 3:187772988-187773010 AACTGGAGACTATATTTTGATGG + Intergenic
970627469 4:17904178-17904200 AAAAGAATCCTATATAGGGAAGG + Intronic
972690663 4:41394727-41394749 AATTGGGGAATATGTAGGGAAGG + Intronic
974516970 4:62928614-62928636 AAATAGAGACCAAATACGGATGG - Intergenic
974986164 4:69028327-69028349 AAGTGGAGACTGTACAGGAAGGG - Intronic
976334265 4:83867545-83867567 GAAGAGAGACTATATAGGCAAGG + Intergenic
976510760 4:85906983-85907005 AAATGGAGACTGACTATGGAAGG + Intronic
977105501 4:92878196-92878218 TAATGCAGACAATGTAGGGAAGG - Intronic
977209135 4:94198132-94198154 AAATGGTGACTATAAAGGAAGGG + Intergenic
977779695 4:100966490-100966512 AAATGGAGGTTATCTAGGGTTGG - Intergenic
978539523 4:109802377-109802399 AAAAGTAGACCATATAGTGAAGG + Intergenic
979293459 4:119003651-119003673 ACATAGAGACTATACTGGGAGGG - Intronic
979991012 4:127375328-127375350 GAATGGAGAATTTATAGGGTAGG + Intergenic
980511614 4:133797674-133797696 AAATGGAGATTCTATAAGCAAGG - Intergenic
982759447 4:159263883-159263905 AAATGGAGATTATATAGTTCAGG - Intronic
982926634 4:161345539-161345561 AAATGGAGATTCAACAGGGATGG - Intergenic
983272325 4:165576848-165576870 TAATGTAGACTATAAAGGCAAGG + Intergenic
985172499 4:187167073-187167095 AAATTGAGACTATACAGGCATGG - Intergenic
985181339 4:187267184-187267206 GAATGGAGATTATATAAGAAAGG - Intergenic
986889331 5:12282084-12282106 AAATGTAGACAAGATAGGGCTGG + Intergenic
987231331 5:15896626-15896648 AAATGGAGATTATCTGGGGATGG + Intronic
990024533 5:51169310-51169332 AAATGGAAACTAAATGTGGAAGG + Intergenic
990218791 5:53563796-53563818 AAATGTAGACAACTTAGGGATGG - Intronic
990254448 5:53951637-53951659 ATATCGAAAATATATAGGGAAGG - Intronic
991091932 5:62701974-62701996 AAATGCAGACTTTACAGGTAGGG + Intergenic
992079045 5:73216880-73216902 AAATGGAGACGATTTGGTGAAGG - Intergenic
992981221 5:82175303-82175325 AAAATGTGGCTATATAGGGAAGG - Intronic
994064477 5:95521581-95521603 AAATGTAGGTTATATATGGATGG + Intronic
995116784 5:108490006-108490028 ATAAGCAGAATATATAGGGAAGG + Intergenic
995398981 5:111719260-111719282 AAATGGAGACTAATGTGGGAGGG - Intronic
995983958 5:118145329-118145351 AAATGGAGAGTATGTGAGGAAGG - Intergenic
996196028 5:120608227-120608249 AAATGGATATTATGCAGGGAAGG - Intronic
1000687665 5:164272620-164272642 AAATGGAAAATATCTAGGGTAGG + Intergenic
1001186684 5:169580645-169580667 AAATGTCTACTATATTGGGATGG + Intergenic
1004420673 6:15466917-15466939 AAATGGAGACAATCAAGGGGAGG + Intronic
1005347051 6:24901083-24901105 AAAGGGAGATGATAGAGGGAAGG + Intronic
1006735798 6:36271581-36271603 AAATGGAGACTATTTCAGGAAGG + Intronic
1009277812 6:61706168-61706190 AAAGGGAGAGTACACAGGGAGGG - Intronic
1012252995 6:96999955-96999977 GAATAGAGACTACATGGGGAGGG + Intronic
1012353370 6:98281304-98281326 ATATGGAGAATATATAGCAAGGG - Intergenic
1012510083 6:99992580-99992602 AAACGGAGATTGAATAGGGAAGG - Intronic
1012703110 6:102488103-102488125 AAAGGGAGACTAAAGTGGGAGGG + Intergenic
1013854795 6:114559530-114559552 TCATGGAGACTATAAAGGCATGG - Intergenic
1015611970 6:135032458-135032480 AAATGTGGACTAGACAGGGAGGG - Intronic
1016206965 6:141479950-141479972 AAATTGAGAATACATAAGGAAGG + Intergenic
1016256709 6:142115284-142115306 AGATGGAGAGTATAGTGGGAGGG + Intergenic
1016376376 6:143424924-143424946 AAAAGGTAACTATATAGTGAAGG + Intronic
1020378944 7:7520849-7520871 AAACGAAGACTTTATAGGAAGGG + Intronic
1020709499 7:11589137-11589159 AAAAGGAGAATATTTTGGGAAGG - Intronic
1021603378 7:22386872-22386894 ATAGGGAGACTATATCTGGAAGG + Intergenic
1022599620 7:31745302-31745324 AAATGGAAACAAGATAGGGATGG - Intergenic
1024032673 7:45477260-45477282 AAGTGGAGACATTATAAGGAAGG + Intergenic
1026047852 7:66920167-66920189 AATTGCAGACTATATTGGCAGGG - Intergenic
1028279822 7:88909173-88909195 AACTGAAGACCATATAGGGAGGG - Intronic
1028379302 7:90180714-90180736 AAATGCAAAATATCTAGGGAAGG + Intronic
1031093831 7:117394701-117394723 AAATGGAAAGTATAAAGGAAAGG - Intronic
1031569342 7:123339863-123339885 CAATGGAAACTATACAGGCAAGG - Intergenic
1035653832 8:1290356-1290378 AAATGGTGCCTACATAGTGACGG + Intergenic
1038748727 8:30277121-30277143 AAGTGCTGACTATATGGGGAAGG + Intergenic
1040762772 8:50870599-50870621 AAATGGAGACAATATTTGAATGG + Intergenic
1043070223 8:75627435-75627457 AAGAGGAGACTGTATATGGATGG + Intergenic
1044650847 8:94493171-94493193 AAATGTTGACTATATAAGGCTGG - Intronic
1045452530 8:102342400-102342422 AAATGGAAACCTTAGAGGGAGGG + Intronic
1046339757 8:112838107-112838129 AGTTGGAGACTATAGAGGAAAGG + Intronic
1048065127 8:130960017-130960039 AAATGGTTAATATAGAGGGAAGG + Intronic
1050733037 9:8731266-8731288 AAAAGAAGACCATATGGGGATGG - Intronic
1051287090 9:15508943-15508965 AAAGGCAGACTTTATAGGCAAGG + Intronic
1051763582 9:20497442-20497464 AAATGGAGCCTAGACAGGGCAGG - Intronic
1052190683 9:25657516-25657538 GAATGGAGACTGAATATGGAAGG + Intergenic
1053206134 9:36188143-36188165 AGATGGAGACTAGAGAGGGAAGG - Intergenic
1056154448 9:83820126-83820148 AAAGGGAGACTAAATTGTGATGG - Intronic
1056439359 9:86604856-86604878 AAATGGTGACTCTACAGGAAAGG - Intergenic
1056922146 9:90800932-90800954 CCATGGAGAAAATATAGGGATGG - Intergenic
1186744771 X:12556302-12556324 AAATGGAGATTATCTTGGGTGGG + Intronic
1187210284 X:17223576-17223598 AAAAGCAGACTTGATAGGGATGG + Intergenic
1187405053 X:18996514-18996536 AAACGGATTCTAAATAGGGAGGG - Intronic
1188854073 X:35170654-35170676 CAATGGAAACTTTATAGGGCAGG - Intergenic
1189906920 X:45770641-45770663 TATTGGAGACTATAGAGGAAGGG - Intergenic
1190377434 X:49803326-49803348 AAATGGGGGCTATCCAGGGAAGG + Intergenic
1190638421 X:52459172-52459194 AAATGCAGACTTTCTCGGGAAGG + Intergenic
1190678236 X:52801272-52801294 AAATGCAGACTTTCTCGGGAAGG - Intergenic
1192126125 X:68502548-68502570 AAATAGATAATATATAAGGAGGG + Intronic
1192484382 X:71512490-71512512 AAAAGGAGACCAAATAGGAATGG + Intronic
1192614366 X:72603271-72603293 AAATAGAGAAAATATAGAGAGGG - Intronic
1194354927 X:92870973-92870995 AAAGGGAGACTATACTGGGTGGG + Intergenic
1194382840 X:93216604-93216626 AAATGCACCCTATATAGGCAGGG + Intergenic
1195411981 X:104577527-104577549 GAATTGAAACTGTATAGGGAAGG + Intronic
1197231823 X:124013730-124013752 AAATGGAGACTTTTTAGGGTGGG + Intronic
1197416722 X:126184487-126184509 AAATGGAGTTTACAAAGGGATGG + Intergenic
1197979536 X:132200608-132200630 AAATGTATACTATAGAGAGATGG - Intergenic
1198734103 X:139767380-139767402 ACATGGCGACTATATATAGAGGG + Intronic
1198916008 X:141672414-141672436 AAGTGGAGAATGTATAGGGGAGG + Intronic
1200663287 Y:5987990-5988012 AAAGGGAGACTATACTGGGTGGG + Intergenic