ID: 1107064306

View in Genome Browser
Species Human (GRCh38)
Location 13:36195996-36196018
Sequence GTGGTGACACAGAGGGAATA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 336
Summary {0: 1, 1: 0, 2: 3, 3: 31, 4: 301}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107064297_1107064306 24 Left 1107064297 13:36195949-36195971 CCAAATGTGGAGGTAAGAAAGGC 0: 1
1: 0
2: 0
3: 9
4: 172
Right 1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG 0: 1
1: 0
2: 3
3: 31
4: 301
1107064295_1107064306 28 Left 1107064295 13:36195945-36195967 CCAACCAAATGTGGAGGTAAGAA 0: 1
1: 0
2: 0
3: 11
4: 150
Right 1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG 0: 1
1: 0
2: 3
3: 31
4: 301
1107064301_1107064306 -3 Left 1107064301 13:36195976-36195998 CCTACACTGGTGTAGGTGGTGTG 0: 1
1: 0
2: 2
3: 14
4: 149
Right 1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG 0: 1
1: 0
2: 3
3: 31
4: 301

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107064306 Original CRISPR GTGGTGACACAGAGGGAATA GGG Intronic
901205324 1:7491437-7491459 GAGTAGACACAGAGGGAAGATGG + Intronic
901915772 1:12498774-12498796 GTGGGGACACAGTGAGAAGAGGG - Intronic
902618500 1:17636978-17637000 GTGATGATACAGATGGAGTAAGG - Intronic
904385491 1:30139179-30139201 GTGGTGATAGAGAGGGACTGGGG + Intergenic
905788751 1:40778922-40778944 GAGGAGACACAGAGGGAGAAAGG - Intergenic
907911833 1:58833902-58833924 GTGCTGAGACAGAGGGGATGGGG + Intergenic
908038916 1:60086385-60086407 GTGGTGTCACGGAGTAAATATGG - Intergenic
908487169 1:64606236-64606258 GAGATGAGACATAGGGAATACGG + Intronic
908536954 1:65087153-65087175 GTGAGGACACAGGGAGAATATGG + Intergenic
908683414 1:66687818-66687840 GTGGAGACAGAGAGGGAGCAGGG + Intronic
911038440 1:93573502-93573524 ATGGAGACAAAGAGGGAAAATGG - Intronic
911968636 1:104400570-104400592 GGGGTGTCACAGAGGGCAGAAGG - Intergenic
913079857 1:115373411-115373433 CTGGTGATACAGAGTGAATCAGG - Intergenic
913127597 1:115807469-115807491 ATGGTGCCACAGAGGAGATAAGG + Intergenic
913281987 1:117194714-117194736 GTGGTAACACAGATGGAACCTGG + Intronic
913355709 1:117919532-117919554 GTGGTTGCCCAGAGGGATTAAGG + Intronic
914921872 1:151852799-151852821 ATGGGGAAACTGAGGGAATACGG + Intronic
915128931 1:153683890-153683912 GTGGGGACCCAGAGGGAAGAGGG + Intronic
915799998 1:158780821-158780843 GTGCTGACACAGATGGTAGAAGG - Intergenic
915992945 1:160535186-160535208 CTGGTGTCACAGAGTGAATTAGG + Intergenic
917218380 1:172701705-172701727 GTGGGAACACAGAGGGAAAATGG + Intergenic
918142020 1:181727631-181727653 GTGGTGACACAGAGGGGTGTTGG + Intronic
918578213 1:186090896-186090918 GTGGTGAAACAGAAAGAATCCGG + Exonic
919118236 1:193308127-193308149 GTGTGGGCACAGAGGGTATATGG - Intergenic
919752483 1:201047000-201047022 ATGGAGACATAGAGGGAAAAAGG - Intronic
920213350 1:204344940-204344962 GGGGTGACATACAGGGAATGAGG - Intronic
921088817 1:211823428-211823450 GTGGTGACAGGGAGGGAATAGGG - Intronic
921616771 1:217277600-217277622 CTGTTGACACACAGGGATTATGG - Intergenic
921784335 1:219210338-219210360 GTGGTGACATAGAGGGAACAGGG + Intronic
923006221 1:230052186-230052208 GTGAGGACACAGAGAGAAGATGG + Intergenic
923087291 1:230711296-230711318 GTGGGGACACAGAGAGAAGACGG + Intronic
923591375 1:235322788-235322810 GGGGTGAGACAGAAGGAAGAGGG + Intronic
1063607955 10:7539554-7539576 GTGGTGAGAAAGAGAGAAGATGG + Intergenic
1065250673 10:23808299-23808321 GAAGTAACACAGAGGGAATTAGG + Intronic
1065436595 10:25709315-25709337 GTGATGACACAGGGAGAAGACGG - Intergenic
1067015858 10:42755800-42755822 GTGGTGACAGGCAGGGAATATGG - Intergenic
1067155495 10:43777750-43777772 GTGTAGACACAAAGGGAACAAGG - Intergenic
1067222297 10:44352942-44352964 CTGGTGACACAGATGGAGAAAGG + Intergenic
1067516747 10:46954228-46954250 GTGAAGACACAGAGGAAAGACGG - Intronic
1067645504 10:48097598-48097620 GTGAAGACACAGAGGAAAGACGG + Intergenic
1069658183 10:70105812-70105834 GCAGTGACAAAGAGGGAAAAAGG + Intronic
1069887976 10:71635896-71635918 GTGGGGACACAGTGGGAAGCAGG - Intronic
1074005618 10:109420141-109420163 GTGGAGACACAGTGAGAAGAAGG - Intergenic
1074435149 10:113427441-113427463 GAGGTGACAGAGAGGGAAGGAGG - Intergenic
1074935798 10:118180356-118180378 GTGGGGACACAGCTAGAATATGG - Intergenic
1075677614 10:124306986-124307008 GTGATGACACAGAAGGAAAGGGG - Intergenic
1076060835 10:127412803-127412825 TTGGTGACACACAAGGAATCTGG - Intronic
1076107047 10:127831965-127831987 GTGGTGACACAGAGTAAAGGTGG + Intergenic
1076764872 10:132627541-132627563 CTGGGGACACAGAGGGAGTCGGG - Intronic
1077869000 11:6245690-6245712 GTGGTGACTCAGGGTGAATCTGG - Intergenic
1078331634 11:10427011-10427033 GTGGTGTTTCAGAGGGAATCGGG - Intronic
1078513963 11:12007841-12007863 GTGGGGGCAGAGAGGGAAGATGG - Intronic
1078714740 11:13829104-13829126 GTGGGGAGACAGAGGGAGAAGGG - Intergenic
1078860336 11:15240753-15240775 GTGGTAGAACAGAGGGAAGAGGG - Intronic
1078935179 11:15943260-15943282 TTGGTGACAGAGAGGAAAGAGGG + Intergenic
1079668195 11:23134449-23134471 GTGCTAACACATAGAGAATAAGG - Intergenic
1080437821 11:32262431-32262453 GTGGTGGCACAGGCTGAATATGG + Intergenic
1080536837 11:33230244-33230266 GTGGAGACTCAGAGGGATGAAGG + Intergenic
1081227561 11:40543016-40543038 GTGCTGACTCAGAGGAAATCAGG + Intronic
1081417739 11:42835990-42836012 GTGAAGACATAGAGGAAATATGG - Intergenic
1081927424 11:46842613-46842635 ATGGTGAGACAGAGGGCAAATGG + Intronic
1082763610 11:57149319-57149341 TTGGTTACACAAAGGGAGTAAGG + Intergenic
1083912349 11:65717558-65717580 GTGGTGAGACAGACAGAATGGGG - Intronic
1083986493 11:66219211-66219233 GTGGTGTCACAGATGGAAAAGGG + Intronic
1090374158 11:126277269-126277291 GTTGTGACATGGAGGGACTACGG - Intronic
1092056026 12:5508631-5508653 GTGGTAACACAGGGAGAAGATGG + Intronic
1092906239 12:13102378-13102400 GGAGAGACACAGAGGGAATATGG - Intronic
1093505327 12:19858601-19858623 GTGATGATAAACAGGGAATATGG - Intergenic
1097165855 12:57086504-57086526 GTGGTGACAAAAAGGGAGTGGGG - Intronic
1097307151 12:58081754-58081776 CTGGTGACACAGAGGTAACAAGG + Intergenic
1097326558 12:58283906-58283928 ATGGTAACACAGGGGGAATGTGG - Intergenic
1098084873 12:66831638-66831660 GTGGTCACACAGCTGGAAAATGG + Intergenic
1098167784 12:67715809-67715831 GTGATGGCAAAGAGGGAAGAGGG + Intergenic
1098501663 12:71199699-71199721 GTGATGAAAGAGAGGAAATAAGG + Intronic
1100118458 12:91339453-91339475 GTATTTACACAAAGGGAATAGGG - Intergenic
1100143344 12:91646086-91646108 GATGTGACACAGTGGGAAGATGG + Intergenic
1101481966 12:105107345-105107367 GTGGCGACAGAGAGGGAAACAGG + Intronic
1102208706 12:111108665-111108687 GTGGAGACAGAGAGGGGAGATGG - Intronic
1102956139 12:117060304-117060326 GGGGTGATTGAGAGGGAATATGG + Intronic
1103845935 12:123902149-123902171 GTGCAGACACACAGGGAAGAGGG - Intronic
1103965751 12:124638313-124638335 GTGAGGACACAGTGGGAAGACGG + Intergenic
1104254844 12:127127013-127127035 GTGGGGACACAGGGAGAAGACGG - Intergenic
1104750352 12:131234516-131234538 CTGGGGACACAGAGGAATTAAGG - Intergenic
1104782369 12:131429946-131429968 CTGGGGACACAGAGGAATTAAGG + Intergenic
1106313514 13:28574416-28574438 GTTGTGACACAGTGGGCACATGG + Intergenic
1106777136 13:33019486-33019508 GTGGAAACACAGAGGGAGTGAGG - Intronic
1107064306 13:36195996-36196018 GTGGTGACACAGAGGGAATAGGG + Intronic
1107363278 13:39642588-39642610 GTGGTGATACAGGGGTAACAGGG + Intergenic
1107632047 13:42352099-42352121 GTGGTGACAAAGAAGGCACAGGG + Intergenic
1107646554 13:42500007-42500029 GTGGAGACAGAGAGGCAAGACGG - Intergenic
1107721926 13:43258388-43258410 GTGGTGAAACAGCTGGAAGAAGG + Intronic
1109751570 13:66699516-66699538 GAGGAGACACAGAGAGAAAAGGG + Intronic
1109914209 13:68959193-68959215 TTGGAAACACAGAGGGAATTAGG + Intergenic
1110817181 13:79875066-79875088 GAGATGAGACAGAGTGAATAGGG + Intergenic
1112780145 13:102891595-102891617 GAGGTCACAAAGAAGGAATATGG - Intergenic
1113616727 13:111685588-111685610 GAGGTGACAGAGAGGGCATTTGG - Intergenic
1113622257 13:111770859-111770881 GAGGTGACAGAGAGGGCATTTGG - Intergenic
1114069593 14:19096976-19096998 GTGGTGATAGGCAGGGAATATGG + Intergenic
1114092667 14:19303027-19303049 GTGGTGACAGGCAGGGAATATGG - Intergenic
1115823860 14:37242237-37242259 GTGGGGAGACAGAGAGAATGAGG - Intronic
1115956388 14:38784914-38784936 GTGGTGACTCATGGTGAATATGG - Intergenic
1117448642 14:55829150-55829172 GTGGTGACACAGAGGTTAGAAGG + Intergenic
1117708656 14:58500034-58500056 GTTGTGACACACTGGAAATAAGG + Intronic
1120747385 14:88164616-88164638 GGGGTGCCACAGCAGGAATATGG + Intergenic
1122361693 14:101171061-101171083 GTGAAGACACAGAGAGAAGATGG - Intergenic
1122363413 14:101180776-101180798 GGGGTGACCCAGAGGGAGCAGGG - Intergenic
1122375527 14:101254499-101254521 GTGAGGACACAGAGAGAAGACGG - Intergenic
1122550800 14:102548652-102548674 GAGGTGACACAGGGAGAGTATGG + Intergenic
1123174283 14:106401941-106401963 GTGGAGTCACTGAGGGAATGAGG - Intergenic
1123182495 14:106482876-106482898 GTGGAGTCACTGAGGGAATGAGG - Intergenic
1202944408 14_KI270726v1_random:13853-13875 GTGGAGTCACTGAGGGAATGAGG + Intergenic
1124251665 15:28110222-28110244 GTGGTGACACAGGTGTAAGAGGG - Intergenic
1125933403 15:43615816-43615838 GTGGTGGCAGAGAGGGCAGAAGG + Exonic
1125946501 15:43715278-43715300 GTGGTGGCAGAGAGGGCAGAAGG + Intergenic
1130655975 15:85792466-85792488 CTGGTGGTACAGAGGGACTAGGG + Intronic
1132516375 16:367984-368006 ATGGATAAACAGAGGGAATAGGG + Intronic
1133600279 16:7333568-7333590 GTGGTGGCACTGAGGCAAGAAGG + Intronic
1137016151 16:35377446-35377468 GGGGTGACAGTGAGGGAAAAAGG + Intergenic
1137487605 16:48904745-48904767 ATGGGGACAGAGAGGGAATGAGG - Intergenic
1141749105 16:85946467-85946489 GTGGTGGCCCAGAGGGAGCAGGG - Intergenic
1142342454 16:89532438-89532460 GAGGGGACACAGAGAGAATCAGG - Intronic
1144274857 17:13656463-13656485 GTGGGGACACAGAGGGAAGGGGG + Intergenic
1145888871 17:28400807-28400829 GTGGTGCCAGAGTTGGAATATGG - Exonic
1146941275 17:36845984-36846006 GTGGGGACAGAGAGGGGAGAGGG + Intergenic
1148552230 17:48557424-48557446 GTGGGGAGAGAGAGGGAATGAGG - Intronic
1148652236 17:49258617-49258639 GTGGTGATGCAGAGATAATACGG + Intergenic
1149269080 17:54956839-54956861 GGGGTGATAGAGAGGGAAGAGGG + Intronic
1149451662 17:56754533-56754555 TCGGTGAAACAGAGGTAATAAGG + Intergenic
1150619339 17:66797693-66797715 GTGGGGACACAGAGGGGAGAAGG - Intronic
1153090244 18:1334821-1334843 GTGATGACACAGTGAGAAGATGG - Intergenic
1155573854 18:27224056-27224078 GTGGGGGCACAGTGGGAATGAGG - Intergenic
1157489663 18:48113927-48113949 ATGGAGACACAGAGTGAATGGGG - Intronic
1157569901 18:48705348-48705370 GAGGAGACACAGAGGGATGAAGG - Intronic
1157626381 18:49054689-49054711 CTGGCGACACAGAGGGACTTGGG + Intronic
1157937851 18:51892944-51892966 GTGGCAACAGAGAGGGAAGATGG + Intergenic
1158511981 18:58098528-58098550 GTGGTCACACAGCTGGAAGATGG - Intronic
1159879409 18:73844562-73844584 GTGAGGACACAGAGAGAAGATGG - Intergenic
1160331623 18:77998081-77998103 GAGGCGACACAGAAGGAAGAAGG + Intergenic
1160534684 18:79585718-79585740 GTGGGGACACAGTGGGAGCATGG - Intergenic
1162661840 19:12175568-12175590 GTTGTGACTGAGTGGGAATAGGG - Intronic
1163817421 19:19475389-19475411 GTGGTCACACAAAGGGAAAATGG - Intronic
1164727515 19:30476184-30476206 CTGGGGCCACAGAGGGAAGAAGG - Intronic
1164862034 19:31569194-31569216 GAGGTCACAGAGAGGGAATGTGG - Intergenic
1165486764 19:36101180-36101202 GTGGGGGCAGAGAGGGAACAAGG - Intronic
1165806913 19:38586017-38586039 GGGGTGACCCAGAGGGATTACGG + Intronic
1166901468 19:46067295-46067317 GAGGTGCCACAGAGGCAATGAGG - Intronic
1167102929 19:47415123-47415145 GGGGGGAGACAGAGGGAATTGGG + Intronic
1167211043 19:48134275-48134297 GTGGTGACAGATAGGGAACAGGG - Intronic
1167577491 19:50324841-50324863 GTGGTGCCACAGAGGGGAGGTGG + Intronic
1168460042 19:56547209-56547231 GTGAGGACACAGAGAGAAGACGG - Intronic
925359577 2:3268104-3268126 GTGGGGTCACAGAGGGACCAAGG - Intronic
925863131 2:8199725-8199747 GTGGTAAGGCAGAGGGAATGAGG + Intergenic
926426884 2:12746361-12746383 GTGAGGACACAGCGGGAAAACGG - Intergenic
926802505 2:16671468-16671490 CTGGTGACACAGTGATAATAGGG + Intergenic
928077474 2:28278349-28278371 GTACTGAAACAGTGGGAATAGGG + Intronic
929760286 2:44801197-44801219 GAGGTGACAGAGAAGGAAAAAGG + Intergenic
930115253 2:47712587-47712609 ATGGATACACAGAGGGAATCAGG + Intronic
932605452 2:73162868-73162890 GTGGGGCCAGAGAGGGAAGAAGG + Intergenic
932796342 2:74699349-74699371 GAGGTGACTCAGATGGATTATGG - Intergenic
933213653 2:79600824-79600846 GTGGGAACACAAAGAGAATATGG - Intronic
933246891 2:79985913-79985935 GTGGTCCCCTAGAGGGAATAAGG - Intronic
934579198 2:95425018-95425040 GTGGGGACACAGAGAGGATAAGG + Intergenic
934600248 2:95651706-95651728 GTGGGGACACAGAGAGGATAAGG - Intergenic
934618737 2:95791378-95791400 GTGCTGACAAATAGGGAAGAGGG + Intergenic
934642156 2:96033179-96033201 GTGCTGACAAATAGGGAAGAGGG - Intronic
935399251 2:102643265-102643287 GTGGTGTCAGAGAAGGAAAAGGG - Intronic
935537150 2:104308105-104308127 GTGAGGACACAGTGAGAATATGG - Intergenic
935627224 2:105181215-105181237 GTCATGACTCAGAGGGAAGATGG + Intergenic
936533599 2:113293707-113293729 GTGGGGACTCAGAGAGGATAAGG - Intergenic
936567458 2:113592171-113592193 ATGGTGACAGATAGGGAATGAGG + Intergenic
936715763 2:115186138-115186160 GTGATGAGAGTGAGGGAATAGGG - Intronic
938059159 2:128238731-128238753 GTGCGGACACAGCGGGAAGATGG - Intronic
939684965 2:145188096-145188118 GTGAAGACACAGAGAGAAGATGG - Intergenic
939697076 2:145339928-145339950 TTTCTGTCACAGAGGGAATACGG - Intergenic
941813765 2:169780091-169780113 ATGGTGACACAGTGGAAATAGGG - Intergenic
942341869 2:174957645-174957667 GTGGAGACACACATAGAATATGG - Intronic
943118033 2:183697902-183697924 GTGGTCAGACAGATGAAATATGG + Intergenic
945682527 2:212931468-212931490 ATGGTGATACAGTGGAAATAAGG - Intergenic
945977656 2:216283297-216283319 GTGGAGAATCAGAGGGAAAAGGG - Intronic
946866380 2:224044591-224044613 GGGGTGACTCAGAGGGACTTGGG - Intergenic
948059962 2:235035540-235035562 GTTGTGACAGAGATGGTATACGG - Intronic
948138787 2:235657922-235657944 GTGAGGACACAGGGGGAAGACGG + Intronic
948851082 2:240706275-240706297 GAGGTGACACAGAGGACACACGG + Intergenic
948921683 2:241068878-241068900 GAGGTGACAAAGAGAGAACAGGG - Intronic
1169330660 20:4713699-4713721 GTGATGACACACAGGGAAGGAGG - Intergenic
1170475536 20:16710561-16710583 GCGCTGACACAGAGGGATTGGGG + Intergenic
1170887596 20:20354983-20355005 GTGGTCACACTGAGGGGAGATGG + Intronic
1170888226 20:20357923-20357945 GTGGTCACACTGAGGGAAGGTGG + Intronic
1171190275 20:23154036-23154058 GTGAGGACACAGAGAGAAGATGG - Intergenic
1172158256 20:32844929-32844951 GTGGGGACAGTGAGGGAAAATGG + Intronic
1172514040 20:35520913-35520935 GTGGTGTCAGAGAGGGACTAGGG - Intergenic
1173109022 20:40168003-40168025 GTGGGGACACAGAGGTGAAATGG - Intergenic
1174384378 20:50178418-50178440 GTGAACACACAGAGGGAAGAAGG + Intergenic
1174528372 20:51191548-51191570 GAGGTGACACAGAGATAAGAAGG - Intergenic
1175902123 20:62364072-62364094 CTGGGGACACAGCGGGAATAAGG - Intronic
1175920766 20:62449656-62449678 ATGGGGACACACAGGTAATAGGG - Intergenic
1177802425 21:25841011-25841033 GTGCTGACACAGAGAAAGTAGGG + Intergenic
1177855427 21:26395285-26395307 TTGGTTACACTTAGGGAATAGGG - Intergenic
1178887558 21:36495863-36495885 GAGGAGACACAGGGGGAAGAGGG + Intronic
1179037741 21:37773935-37773957 AGGGTGACCCAGAGGAAATACGG - Intronic
1180488062 22:15819539-15819561 GTGGTGACAGGCAGGGAATATGG + Intergenic
1183338287 22:37263612-37263634 GTGGGGACACAGGGAGAAGACGG + Intergenic
1183599260 22:38830625-38830647 GGTGGGACAGAGAGGGAATAGGG - Intronic
1183775265 22:39959963-39959985 GAGGTGACCCAGAGGGAAAGAGG - Intronic
1183994247 22:41621030-41621052 GAGGTGACAGAGAGGGGACAGGG + Exonic
1184120548 22:42447002-42447024 GAGGAGACACAGAGGAAAGAGGG + Intergenic
1184563695 22:45278446-45278468 GTGGTGACACCTGGGGAATGTGG + Intergenic
1185051669 22:48557325-48557347 GTGAGGACACAGAGAGAAGACGG + Intronic
1185319952 22:50196073-50196095 GCGGTGTCACAGAGGGAAGGGGG + Intronic
949346592 3:3082671-3082693 GTGGCAACACAGAGGGCAGAAGG + Intronic
949529146 3:4936823-4936845 GTAGTGACATAGAGGGAGCATGG + Intergenic
951162129 3:19436945-19436967 GTAGCAACACAGAAGGAATAAGG + Intronic
952893220 3:38058313-38058335 GTGGTGTCACACAGGGGATCAGG - Intronic
953920651 3:46949138-46949160 GTGGTGACCCACAGGGGAAAAGG + Intronic
956651582 3:71509347-71509369 GTGATGACACAGAGGGAAGATGG - Intronic
956708756 3:72022209-72022231 GTGATGACACAGAGAGAAGGTGG + Intergenic
959605878 3:108241652-108241674 CTGGTGACCCAGATGGAATTGGG + Intergenic
960436110 3:117628798-117628820 GTGGTGAGAGAGAGAGAAGAAGG - Intergenic
960920253 3:122739372-122739394 GTGTTGTCACAGAGGGAAGGAGG - Intergenic
961639565 3:128356719-128356741 GTGGATACACAGAAGGAATCAGG - Intronic
961682809 3:128610278-128610300 GTGGTGAGACACGGGGAAGATGG + Intergenic
964178422 3:153854813-153854835 GTGGGGAGGAAGAGGGAATAGGG - Intergenic
966328849 3:178789025-178789047 ATGGTGAAACTGGGGGAATAGGG + Intronic
968717317 4:2170003-2170025 GTGGTGCTGGAGAGGGAATAGGG + Intronic
969286348 4:6204748-6204770 GTGGAGACACAGTGAGAAGATGG + Intergenic
970287333 4:14532476-14532498 GTGCTGAGACTGAGGGGATATGG + Intergenic
971243311 4:24907953-24907975 GTGAAGACACAGACGGAAGAAGG - Intronic
972984669 4:44749265-44749287 CTGGTGACACCGAGGGAAACAGG - Intergenic
973032235 4:45359474-45359496 GTCATGACACATAGGGATTATGG - Intergenic
973173037 4:47168904-47168926 GTGGAGACACAGGGGGAAGATGG - Intronic
974466059 4:62258087-62258109 CTGGAGACACAGAGAGAAAATGG - Intergenic
979307996 4:119170170-119170192 ATGGTGGCAGAGAGGGAATGGGG - Intronic
979434736 4:120674532-120674554 GTGGTGTGCCAGAGGGAATAAGG - Intergenic
979636707 4:122963376-122963398 GTGGTGACTCAGATGAAATGAGG + Intronic
980310211 4:131118350-131118372 GAGGTGATTAAGAGGGAATACGG - Intergenic
981444826 4:144823620-144823642 GTGGTGAGACTGTGGGAAAAAGG - Intergenic
983309859 4:166045710-166045732 GAGCTGACACAGAGGGAGTGAGG - Intronic
985002628 4:185500948-185500970 GTGGTGAGACAGAGGGTCTGAGG + Intronic
986375281 5:7124760-7124782 GTGGTGCTATAGAGGCAATAGGG + Intergenic
986472844 5:8093238-8093260 TGGGAGAGACAGAGGGAATAGGG + Intergenic
986673851 5:10166974-10166996 GAGGAGACACACAGGGAAGAAGG + Intergenic
987377384 5:17248872-17248894 GTGGTGGTACAAAGGGAAGAAGG - Intronic
992437201 5:76766201-76766223 GTGGTGTTGCAGAGGGAATGGGG + Intergenic
993593298 5:89822951-89822973 GTGAAGACACAGTGAGAATATGG + Intergenic
994282498 5:97922233-97922255 GAGAAGACACAGAGAGAATATGG - Intergenic
995164080 5:109016963-109016985 GTGAGGACACAGTGGGAAGAAGG + Intronic
995396898 5:111696742-111696764 GTGAGGACACAGAGAGAAGATGG - Intronic
995601046 5:113796549-113796571 GTAGTGTCTCAGAGGGCATAAGG - Intergenic
995673634 5:114636519-114636541 GTGGTGAGAGAGAGAGAAGAGGG + Intergenic
998824059 5:146083332-146083354 ATAGAGACACAGAGGGAAGACGG - Intergenic
999694680 5:154178631-154178653 CCAGTGACACAGAGGGAAGAAGG - Intronic
999797406 5:155001467-155001489 ATAGAGACACAGAGGGAAGATGG + Intergenic
1000112343 5:158120931-158120953 AAGGTGACTCAGAAGGAATAGGG + Intergenic
1000181966 5:158820279-158820301 GCGGAGACACAGAGGGATGAGGG + Intronic
1000484591 5:161824774-161824796 GTGGTGACAGAGAGGAAAATTGG - Intergenic
1000969791 5:167701087-167701109 GTGGTCACACAGATGAAATGTGG - Intronic
1002439172 5:179255529-179255551 GTGGAGGCAGAGAGGGAAGATGG - Intronic
1002585598 5:180245039-180245061 GTGGAGGGACAAAGGGAATAGGG - Intronic
1002650954 5:180693251-180693273 GTGGCCACACAGAGGCAAAATGG + Intergenic
1003502122 6:6711578-6711600 GTGGGGACACAGGGAGAAGATGG - Intergenic
1003617737 6:7670659-7670681 GTGGGGACACAGGGAGAAGATGG - Intergenic
1003882216 6:10489172-10489194 GTGGGGACACAGGGAGAAGATGG - Intergenic
1006165075 6:32059665-32059687 GTTGGGAAACAGGGGGAATAGGG - Intronic
1006782851 6:36643793-36643815 GAGGTCACACAGAGGGTAAAAGG - Intergenic
1007270192 6:40630449-40630471 GTAGAGAGACAGAGGGAATGGGG + Intergenic
1007836575 6:44678591-44678613 GAGGAGACAGAGAGGGGATAAGG - Intergenic
1008855271 6:56077955-56077977 GTGGTGACACTGAGGGCTTGTGG - Intronic
1010022335 6:71174908-71174930 GCCTTGACACAGAGGCAATAAGG - Intergenic
1010651857 6:78464990-78465012 GTAGGGACACAGAGGGAAAAAGG - Intergenic
1011031555 6:82929793-82929815 GTGTGGATACAGAGGGAATATGG - Intronic
1011598711 6:89040519-89040541 ATGGTGACACAGAGGTAAGAAGG - Intergenic
1011613470 6:89176552-89176574 GTGAAGACACAGTGGGAAGATGG + Intergenic
1012180177 6:96143232-96143254 GTGATGACACAGTGAGAAGATGG + Intronic
1013805234 6:113989405-113989427 GTGAGGACACAGAGAGAAGAGGG - Intronic
1014594358 6:123314690-123314712 GCAGTGACACAGATGGAACAAGG + Intronic
1014688636 6:124533870-124533892 GTGAGGACACAGAGGGAAGATGG - Intronic
1015831134 6:137370145-137370167 GTGGTTACAAAGAGGGTAAATGG - Intergenic
1016852634 6:148636561-148636583 GTGAAGACACAGGGGGAAGATGG + Intergenic
1018408824 6:163519451-163519473 GTGGCGACAGAGATGAAATAAGG + Intronic
1019558349 7:1643576-1643598 CTGGGGACTCAGAGGGAATGGGG + Intergenic
1022470139 7:30677007-30677029 GTGGTTCCACAGAAGGAAAATGG + Intronic
1022539960 7:31126170-31126192 GTGAGGACACAGAGAGAAGACGG + Intergenic
1022716301 7:32901720-32901742 GTGATGAAAGAGAGGGAATGGGG - Intergenic
1022818259 7:33934070-33934092 GTGGTGACACATAGTGCATGTGG + Intronic
1022863985 7:34398385-34398407 GTGAGGACACAGAGAGAAGATGG - Intergenic
1023193472 7:37608857-37608879 GTAGAAGCACAGAGGGAATATGG - Intergenic
1023292041 7:38678656-38678678 GGGGGCACACAGAGGGAATCAGG + Intergenic
1026019586 7:66697071-66697093 TGGTTGACACAGAGGGAAGATGG - Intronic
1026289083 7:68989791-68989813 ATGGAGACACAGATGGAAGAAGG - Intergenic
1028202342 7:87976424-87976446 GTGAGGACACAGAGAGAAAATGG + Intronic
1028354058 7:89885316-89885338 GTGGGGACACTGAGGGTAGATGG - Intergenic
1029160046 7:98545046-98545068 GGGGTGACACTGAGGGAGCAAGG - Intergenic
1031313319 7:120227160-120227182 GGGAAGACACAGAGGGAAGATGG - Intergenic
1033173730 7:139106869-139106891 TTGGGGACACATGGGGAATAGGG + Intronic
1033944401 7:146698085-146698107 GTGATGACATAGGGGGAATTGGG - Intronic
1034535041 7:151721079-151721101 GAGGGGACACAGAGGGCAGAGGG + Intronic
1034827067 7:154275292-154275314 GAGGGGACACAGAGGGAAGGAGG - Intronic
1035140225 7:156752304-156752326 GTGGTGACCTGGAGGGGATATGG + Intronic
1036045851 8:5139591-5139613 GTGTTGACACAAATGGAAGATGG - Intergenic
1036133735 8:6140083-6140105 CTGTTTACACAAAGGGAATAGGG - Intergenic
1036819485 8:11928732-11928754 GTGGTGACACAGCTGAAATCAGG + Intergenic
1039261274 8:35774592-35774614 GTGGGAACACACAGGAAATATGG - Intronic
1039410954 8:37354740-37354762 GTGAAGACACAGGGGGAATATGG - Intergenic
1040087013 8:43354128-43354150 GTGGTGACACAAAGAGAAATTGG - Intergenic
1040353378 8:46590890-46590912 GTAGTGACCCTGAGGGGATAGGG - Intergenic
1044627190 8:94245578-94245600 GAGGGGACACAGAGGGAAGAAGG - Intergenic
1045054901 8:98360381-98360403 ATGGAGACACAGAGGGAAGAAGG - Intergenic
1045498057 8:102725132-102725154 GTGAGGACACAGAGAGAATGAGG - Intergenic
1045867019 8:106878970-106878992 GTGCTGACTCAGAGGACATAAGG - Intergenic
1046236268 8:111427787-111427809 GTGATGACACACAGGGAAAGAGG + Intergenic
1048936921 8:139365141-139365163 GTGAGGACACAGAGAGAAGACGG - Intergenic
1048952666 8:139509217-139509239 TTGAGGACACAGAAGGAATAGGG + Intergenic
1049427976 8:142545721-142545743 CTGGAGACACAGAGGGAAGCAGG - Intergenic
1049511458 8:143028741-143028763 GTGGGGACACAGAGACAATCAGG + Intergenic
1056853630 9:90105764-90105786 GTGTTCACACAGATGAAATAAGG - Intergenic
1057151650 9:92801202-92801224 GTGAAGACACAGGGGGAAGATGG - Intergenic
1057251757 9:93508777-93508799 GTGGTGACACATATGAAGTAGGG - Intronic
1058217474 9:102253239-102253261 GTTGTCACAGTGAGGGAATAGGG + Intergenic
1058524821 9:105846587-105846609 GTGGTTACACAGAAGGCAAAAGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060482095 9:124022634-124022656 GAGGTGACACAGAGGGATGACGG + Intronic
1060492255 9:124093504-124093526 GTGGTGACATAGAGGAAGAATGG + Intergenic
1060654142 9:125357180-125357202 CTGGTCTCGCAGAGGGAATAAGG - Intronic
1185618424 X:1437473-1437495 GTGAGGACACAGGGGGAAGACGG - Intronic
1185631107 X:1516332-1516354 GTGGGGACACAGGGAGAAGACGG + Intronic
1185704736 X:2258289-2258311 GTGAGGACACAGAGAGAAGATGG + Intronic
1185770398 X:2761522-2761544 GTGGGGACACAGGGAGAAGATGG + Intronic
1188541242 X:31253049-31253071 GTGGTGACAAAGAGGAACTGGGG + Intronic
1189018807 X:37313118-37313140 GTGGGGACAGAGAGTGAATATGG - Intergenic
1189985409 X:46549172-46549194 CTTGAGACACAGAGGGAAAAAGG - Intergenic
1192511427 X:71722654-71722676 AGGGAGACACAGAGGGAGTATGG - Intergenic
1192515270 X:71758851-71758873 AGGGAGACACAGAGGGAGTATGG + Intergenic
1196145204 X:112308843-112308865 GTGGAAACACAGAGGGGTTAGGG + Intergenic
1197635346 X:128908614-128908636 GTGGTGGCACAGAGGCCTTATGG - Intergenic
1197788430 X:130224239-130224261 GTGAAGACACAGTGAGAATATGG + Intronic
1199982135 X:152926996-152927018 GGGCAGACACAGAGGGAAGACGG - Intronic