ID: 1107065892

View in Genome Browser
Species Human (GRCh38)
Location 13:36214291-36214313
Sequence TCCCCCGGCGCCCCGAGCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 164
Summary {0: 1, 1: 0, 2: 2, 3: 19, 4: 142}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1107065892_1107065900 2 Left 1107065892 13:36214291-36214313 CCCCAGCTCGGGGCGCCGGGGGA 0: 1
1: 0
2: 2
3: 19
4: 142
Right 1107065900 13:36214316-36214338 GTGGACTCGCGTCCTGGAAGGGG 0: 1
1: 0
2: 0
3: 7
4: 58
1107065892_1107065899 1 Left 1107065892 13:36214291-36214313 CCCCAGCTCGGGGCGCCGGGGGA 0: 1
1: 0
2: 2
3: 19
4: 142
Right 1107065899 13:36214315-36214337 AGTGGACTCGCGTCCTGGAAGGG 0: 1
1: 0
2: 0
3: 3
4: 41
1107065892_1107065898 0 Left 1107065892 13:36214291-36214313 CCCCAGCTCGGGGCGCCGGGGGA 0: 1
1: 0
2: 2
3: 19
4: 142
Right 1107065898 13:36214314-36214336 GAGTGGACTCGCGTCCTGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 32
1107065892_1107065897 -4 Left 1107065892 13:36214291-36214313 CCCCAGCTCGGGGCGCCGGGGGA 0: 1
1: 0
2: 2
3: 19
4: 142
Right 1107065897 13:36214310-36214332 GGGAGAGTGGACTCGCGTCCTGG 0: 1
1: 0
2: 0
3: 2
4: 48

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1107065892 Original CRISPR TCCCCCGGCGCCCCGAGCTG GGG (reversed) Intronic